A novel ROGDI gene mutation is associated with Kohlschutter-Tonz syndrome

A novel ROGDI gene mutation is associated with Kohlschutter-Tonz syndrome

Accepted Manuscript Title: A novel ROGDI gene mutation is associated with kohlschutter-tonz syndrome Author: Nalini Aswath, Sankar Narayanan Ramakrish...

1013KB Sizes 23 Downloads 142 Views

Accepted Manuscript Title: A novel ROGDI gene mutation is associated with kohlschutter-tonz syndrome Author: Nalini Aswath, Sankar Narayanan Ramakrishnan, Nithya Teresa, Arvind Ramanathan PII: DOI: Reference:

S2212-4403(17)31077-5 https://doi.org/doi:10.1016/j.oooo.2017.09.016 OOOO 1852

To appear in:

Oral Surgery, Oral Medicine, Oral Pathology and Oral Radiology

Received date: Revised date: Accepted date:

2-8-2017 12-9-2017 27-9-2017

Please cite this article as: Nalini Aswath, Sankar Narayanan Ramakrishnan, Nithya Teresa, Arvind Ramanathan, A novel ROGDI gene mutation is associated with kohlschutter-tonz syndrome, Oral Surgery, Oral Medicine, Oral Pathology and Oral Radiology (2017), https://doi.org/doi:10.1016/j.oooo.2017.09.016. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Title: A novel ROGDI gene mutation is associated with Kohlschutter-Tonz syndrome Running title: ROGDI exon 6 mutation in KTS Names of authors: 1. Nalini Aswath, MDS, Department of Oral Medicine and Radiology, Sree Balaji Dental College and Hospital, Bharath University, Chennai 600100 2. Sankar Narayanan Ramakrishnan, MDS, Department of Oral Medicine and Radiology, Sree Balaji Dental College and Hospital, Bharath University, Chennai 600100 3. Nithya Teresa, MDS, Department of Oral Medicine and Radiology, Sree Balaji Dental College and Hospital, Bharath University, Chennai 600100 4. Arvind Ramanathan, BDS, MSc, PhD, Principal Investigator, Human Genetics Laboratory, Central Research Facility, Sree Balaji Medical and Dental College and Hospital, Bharath University, Chennai 600100 Total number of pages: 7 pages Total number of images: Three photograph and one figure Word count (Abstract): 197 words Word count (Introduction and Discussion): 774 words Previous publication / presentations: Not published or presented earlier. Source of support: None Acknowledgment: The authors wish to thank the Central Research Funding Authority of Sree Balaji Medical and Dental College and Hospital, Bharath University, Chennai 600100, for providing financial support to conduct the research work. Conflicts of Interest of each author/ contributor: None declared. Acknowledgement The authors wish to thank the Central Research Funding Authority of Sree Balaji Medical and Dental College and Hospital, Bharath University,Chennai-600 100, for providing financial support to conduct the research work. ABSTRACT

Page 1 of 12

Background: Kohlschutter-tonz syndrome (KTS) is a rare neurodegenerative disorder that presents with seizures, developmental regression and characteristic hypoplastic dental enamel indicative of amelogenesis imperfecta besides dysmorphologies. Genetic analysis has identified loss of function mutations within the coding region of ROGDI gene, which indeed has been reported in KTS patients of European or Jewish decent. In the present study, we have investigated the genetic status of ROGDI in a fourteen year old South Indian patient of Dravidian race born to consanguineous parents, who was clinically diagnosed with KTS. Methods: In order to confirm the clinical diagnosis of KTS in the patient, primers were designed flanking each of the eleven exons of ROGDI gene. 50ng of chromosomal DNA extracted from peripheral blood of the patient and his parents were then used to amplify with the above primers and were subjected to direct sequencing with the same primers. Result: Genetic analysis identified a novel homozygous nonsense mutation in the exon 6 of ROGDI gene that caused premature termination of ROGDI translation resulting in truncation and loss of function of the ROGDI protein. Taken together, the clinical presentation and loss of function mutation in ROGDI gene confirms the clinical diagnosis of KTS.

Keywords ROGDI mutation, Kohlschutter-Tonz syndrome, Consanguineous marriage, Consanguinity and syndrome, Consanguinity and birth defect.

Introduction Kohlschutter-Tonz syndrome (KTS) is an early onset autosomal recessive neurodegenerative condition caused by loss-of-function mutation of ROGDI gene.[1,2] ROGDI encodes for a protein with leucine zipper domain (LZ domain), but the cellular function of ROGDI protein remains unknown.[2] LZ domains in other proteins such as transcription factors for example are known to act as dimerization domains.[1] As ROGDI protein localizes in the nucleus, it is likely that ROGDI dimerizes with other nuclear proteins to exert a regulatory role.[2] Gene expression analyses have shown higher levels of expression of ROGDI transcripts in the central nervous system (CNS), marrow cells, leukocytes and cardiac cells relative to other tissues.[1,2] Predictably, the loss-of-function of ROGDI gene causes a global developmental delay. The extent of CNS defects varies among the KTS patients and may include ventricular enlargement, delayed myelination, atrophy of cerebellar vermis, microcephaly and bilateral atrophy of basal ganglia. As a result the clinical manifestation may be limited to cognitive problems, speech delay and learning problems, or may be associated with psychomotor delay or regression, spasticity and epilepsy. These CNS defects may also be associated with dysmorphologies such as scoliosis, broad digits, café-aut-lait spots and vitiligo, bristly hair, deeply set eyes, palpebral fissures, smaller ears and shorter nose, concave nasal ridge and smooth philtrum, and amelogenesis imperfecta.[3-5] The most common dominant features that are commonly found in all KTS patients are seizure and amelogenesis imperfecta. Symptoms of KTS may progress with some developing tetraplegia, while some succumbing during early childhood.[6-8] Such variation in the extent of symptoms, its progression and longevity of survival may be associated with the locus and / or zygosity of the ROGDI mutation(s).[9] Although several cases of KTS have been reported in the literature, only thirty one of them have been genetically characterized. A majority of these patients have been reported from Europe (Swiss, Italy, Austria and Germany) and Israel, where the parents of KTS patients had confirmed consanguinity (Table 1). In the present study, we report of a patient

Page 2 of 12

from southern region of India of Tamil speaking Dravidian race, with symptoms of KTS along with genetic status of ROGDI gene. Materials and Methods Genomic DNA extraction, Polymerase Chain Reaction and Direct sequencing: 1ml of peripheral blood sample was obtained from the patient after getting informed consent from the care giver. The study protocol was cleared by the institutional ethics committee. The blood sample was processed for DNA extraction with GenElute Blood Genomic DNA Kit (cat # NA2000, Sigma-Aldrich, St.Louis, MO, USA) as described earlier. [11] 50ng of genomic DNA was subjected to PCR amplification with independent set of primers flanking the exons (Table 2) with Taq DNA polymerase kit (cat# D1806-1.5KU, Sigma-Aldrich). Primer sequences were designed based on the ROGDI genomic sequence NM_024589.2 available at the NIH public database. The following amplification protocol was used to amplify all the exon regions: after an initial denaturation at 94°C for 2 min, the exons were amplified for 30 cycles with denaturation at 95°C for 45 sec, annealing at 55°C for 45 sec, and extension at 72°C for 1 min, which was followed by a final extension at 72°C for 5 min. The amplified regions of the exons were confirmed by running a 1.2% agarose gel along with DNA molecular size marker (data not shown) and were column purified to remove primer dimers. In order to perform sequencing, 20ng of purified amplicons were amplified with 40pM of forward or reverse PCR primers in individual reactions with bigdye direct PCR master mix (cat# 4458687, Life Technologies). The following sequencing reaction protocol was used: after an initial denaturation at 95°C for 1 min, the samples were sequenced for 25 cycles with denaturation at 96°C for 10 sec, annealing at 50°C for 5 sec, and extension at 60°C for 4 mins. The products were then subjected to sequencing in a ABI PRISM® 3700 DNA Analyzer to identify the mutations.

Result Clinical findings A 14 year old South Indian male child from a consanguineous family of South Indian Dravidian origin was brought by his caregiver with complaint of stained dentition. Intraoral examination revealed high arch palate, retained deciduous in relation to 53, 63 and 73, with generalized yellowish brown discolouration and pitting of all the surfaces of the teeth that chipped upon probing suggestive of enamel hypoplasia (Figure 1A, B). Radiographic analysis revealed generalised thinning of enamel, based on which the condition was diagnosed as amelogenesis imperfecta (Figure 1C). As the patient was mentally challenged and exhibited restlessness during oral examination, a complete medical examination was performed by a neurologist, which revealed delay in the patient’s early childhood milestones such as speech and walking. Seizure episodes had started when the patient was 10 months of age that later improved following medication. The patient is currently under paediatric dose of phenytoin and clobazam, and has had not seizure episodes. Neurological examination revealed learning deficiency associated with attention-deficit/hyperactivity disorder. Both short term and long term memory of the patient was found to be normal, as the patient was able to identify the dentist and physician and recollect the immediate sequence of events, and was again able to identify the dentist and physician after a period of thirty days. Physical examination did not reveal any dysmorphologies. As the neurological findings in association with amelogenesis imperfecta have been reported in KTS, the child was provisionally diagnosed with KTS. Genetic analysis of ROGDI gene

Page 3 of 12

As the majority of KTS patients have been reported to carry loss of function mutation in ROGDI gene, genetic analysis of the ROGDI gene was performed in the patient. The ROGDI gene consists of eleven exons, of which mutations in exons 2, 4, 5, 6 and 7 have been reported to be associated with KTS (Table 1). In order to investigate the genetic status of ROGDI gene in the subject, 50ng of genomic DNA was amplified with intronic primers flanking each of the eleven exons, and subjected to direct sequencing. Sequence analysis identified a single homozygous point mutation at c.402C>G within exon 6 of ROGDI that caused substitution of the tyrosine codon at position 134 to a premature STOP codon (Figure 1D).

Discussion In the present study we have reported a case of KTS, which was diagnosed based on the specific clinical observation of amelogenesis imperfecta associated with neurological disorders. The subject did not present any other dysmorphologies as described in other KTS patients.[1-10] Since genetic mutations in the ROGDI gene cause KTS, we analyzed the entire coding region of the ROGDI gene by direct sequencing of the genomic DNA extracted from the peripheral blood of the patient. Sequence analysis revealed a single homozygous point mutation at c.402C>G in exon 6 that caused substitution of the tyrosine amino acid at 134th position in the protein sequence to premature STOP codon. Although similar mutations have been reported in other exons of ROGDI, the present finding of mutation homozygous c.402C>G (Y134STOP) is being reported for the first time in a KTS patient. As the c.402C>G mutation causes premature translation termination in exon 6, the truncated protein may be expected to cause to loss of function as described in other KTS studies. [1,2,9,10] Despite being a carrier of the nonsense mutation in ROGDI, the patient lives an active life, attends school for children with special needs, has short and long term memory and is able to feed and tend to himself with reasonable effort and assistance. These aspects of the patient suggests for the possibility of occurrence of additional mutation(s) in a compound heterozygous or homozygous manner in those patients in whom the disease progresses and / or causes death. Such compound mutations have indeed been reported in two European families. Given the above clinical and genetic finding of the patient, the reported condition may be regarded as a variant of KTS as, 1) the subject carried the two classical clinical features of KTS namely, amelogenesis imperfecta and seizure, 2) most of other symptoms of KTS as has been elaborated in other studies were not observable in the subject, and 3) that the patient carried a loss of function mutation in ROGDI gene. However, it remains to be determined whether the co-occurrence of amelogenesis imperfecta and neurological findings alone with absence of other reported dysmorphologies as observed in the present patient is due to the c.402C>G (Y134STOP) mutation. Reports on penetrance of disease phenotype and its clinical presentation based on the presence of a particular type of mutation have not yet been characterized due to the rarity of the condition. But it may be inferred safely that the dominant clinical presentations of KTS namely, amelogenesis imperfecta and neurological conditions may be present in all of these patients irrespective of the type of mutation, as most of the reported mutations are predicted to cause loss of function of the ROGDI protein. Whether the generation of consanguinity of parents has any bearing on the disease penetrance is yet another area that remains to be addressed, as the severity of clinical presentations may vary due to cumulative effect of detrimental genetic aberrations in different in-bred generations. In order to address these issues, further clinical and genetic characterization of KTS subjects by including the

Page 4 of 12

SLC13A5 (SoLute Carrier family 13, subtype 5) gene, which was recently shown to be mutated in patients negative for ROGDI mutations,[12] from ethnically defined patients is necessary.

Conclusion Taken together the present study is the first to report KTS in a patient of Dravidian race from the Indian subcontinent with a confirmed loss of function mutation in the ROGDI gene.

References: 1.

Schossig A, Wolf NI, Fischer C, Fischer M, Stocker G, Pabinger S, Dander A, Steiner B, Tönz O, Kotzot D, Haberlandt E, Amberger A, Burwinkel B, Wimmer K, Fauth C, Grond-Ginsbach C, Koch MJ, Deichmann A, von Kalle C, Bartram CR, Kohlschütter A, Trajanoski Z, Zschocke J. Mutations in ROGDI Cause Kohlschütter-Tönz Syndrome. Am J Hum Genet 2012;90:701-7.

2.

Mory A, Dagan E, Illi B, Duquesnoy P, Mordechai S, Shahor I, Romani S, Hawash-Moustafa N, Mandel H, Valente EM, Amselem S, Gershoni-Baruch R. A nonsense mutation in the human homolog of Drosophila rogdi causes Kohlschutter-Tonz syndrome. Am J Hum Genet 2012;90:708-14.

3.

Kohlschütter A, Chappuis D, Meier C, Tönz O, Vassella F, Herschkowitz N. Familial epilepsy and yellow teeth--a disease of the CNS associated with enamel hypoplasia. Helv Paediatr Acta 1974;29:283-94.

4.

Christodoulou J, Hall RK, Menahem S, Hopkins IJ, Rogers JG. A syndrome of epilepsy, dementia, and amelogenesis imperfecta: genetic and clinical features. J Med Genet 1988;25:827-30.

5.

Zlotogora J, Fuks A, Borochowitz Z, Tal Y. Kohlschütter-Tönz syndrome: epilepsy, dementia, and amelogenesis imperfecta. Am J Med Genet 1993;46:453-4.

6.

Wygold T, Kurlemann G, Schuierer G. Kohlschütter syndrome--an example of a rare progressive neuroectodermal disease. Case report and review of the literature. Klin Padiatr 1996;208:271-5.

7.

Haberlandt E, Svejda C, Felber S, Baumgartner S, Günther B, Utermann G, Kotzot D. Yellow teeth, seizures, and mental retardation: a less severe case of Kohlschütter-Tönz syndrome. Am J Med Genet A 2006;140:281-3.

8.

González-Arriagada WA, Carlos-Bregni R, Contreras E, Almeida OP, Lopes MA. Kohlschütter-Tönz Syndrome – Report of an additional case. Journal of Clinical and Experimental Dentistry 2013;5:e108e111.

9.

Tucci A, Kara E, Schossig A, Wolf NI, Plagnol V, Fawcett K, Paisán-Ruiz C, Moore M, Hernandez D, Musumeci S, Tennison M, Hennekam R, Palmeri S, Malandrini A, Raskin S, Donnai D, Hennig C, Tzschach A, Hordijk R, Bast T, Wimmer K, Lo CN, Shorvon S, Mefford H, Eichler EE, Hall R, Hayes I, Hardy J, Singleton A, Zschocke J, Houlden H. Kohlschütter-Tönz syndrome: mutations in ROGDI and evidence of genetic heterogeneity. Hum Mutat 2013;34:296-300.

10. Huckert M, Mecili H, Laugel-Haushalter V, Stoetzel C, Muller J, Flori E, Laugel V, Manière MC, Dollfus H, Bloch-Zupan A. A Novel Mutation in the ROGDI Gene in a Patient with Kohlschütter-Tönz Syndrome. Mol Syndromol 2014;5:293-8.

Page 5 of 12

11. Aswath N, Swamikannu B, Ramakrishnan SN, Shanmugam R, Thomas J, Ramanathan A. Heterozygous Ile453Val codon mutation in exon 7, homozygous single nucleotide polymorphisms in intron 2 and 5 of cathepsin C are associated with Haim-Munk syndrome. Eur J Dent 2014;8:79-84. 12. Schossig A, Bloch-Zupan A, Lussi A, Wolf NI, Raskin S, Cohen M, Giuliano F, Jurgens J, Krabichler B, Koolen DA, de Macena Sobreira NL, Maurer E, Muller-Bolla M, Penzien J, Zschocke J, KapfererSeebacher I. SLC13A5 is the second gene associated with Kohlschütter-Tönz syndrome. J Med Genet 2017;1:54-62.

Figure 1. Clinical images of KTS patient. A, Generalized yellowish brown discolouration, pitting of the teeth surfaces. B, Discolouration and pitting involving all the surfaces of the teeth. C, Orthopantomogram of maxilla and mandible. D, Chromatogram of genotype of the mutant sequence of exon 6 of ROGDI gene. The wild type base, C in the patient’s caregiver is indicated by a bold blue arrow and the mutant base, G is indicated by a bold black arrow.

Page 6 of 12

Table 1. Mutation profile of ROGDI gene in KTS patients Studyorder (year wise)

Ancestry of patient(s)

KTS sample size

ROGDI Gene Mutation

Mutated Exon

1

Moroccan

2

Hmz c.229_230del

4

Austrian

1

Hmz c.286C>T

5

Swiss

1

Compound Htz c.531 + 5G>C and c.532-2A>T

7

2

Northern Israeli

14

Hmz c.469C>T

7

3

Italian

8

Hmz c.507delC, Hmz c.46–37_46–30del

7 2

German

4

Hmz c.507delC, Hmz c.45+9_45+20del, Comp Het c.366dupA/c.45+9_45+20del

7 2 6

4

France

1

Hmz c.117+1G>T

Splice donor site of intron 2

10

5

Indian (Tamil Dravidian)

1

Hmz c.402C>G (Y134STOP)

6

Present study

Reference

1

2

9

Page 7 of 12

Table 2. Primer sequences that were used to amplify exons 1 to 11 of ROGDI gene.

Primer ID

Nucleotide sequence

Exon1,2F1

AGATTGGTGGACAGGAGCAGCG

Exon1,2R1

TGAGGTCGGCTCGAGTTCGC

Exon3,4F

TAAGCAGAGATCGGGCTCACGG

Exon3,4R

GGAGAAGGTGTGAGGGTTGCTG

Exon5,6F

AAGGGCTCAGAGTGGCTGTGG

Exon5,6R

TGGAACCCAGGTGTGATTCCGG

Exon7,8,9F

GCTGGAGCCCAACTACCTGTC

Exon7,8,9R

GCCCCTGCCTACTTACAACATGG

Exon10,11F

CGACCTGCTGGTCAACGTCTAC

Exon10,11R

GGTGCTCTGTGGTGGGTATGAG

Page 8 of 12

Figure 1A11 Improved_bestsetConverted.png

Page 9 of 12

Figure 1B11 Improved_bestsetConverted.png

Page 10 of 12

Figure 1C11 Improved_bestsetConverted.png

Page 11 of 12

Figure 1D1 Improved_bestsetConverted.png

Page 12 of 12