A peptidogalactomannan isolated from Cladosporium herbarum induces defense-related genes in BY-2 tobacco cells

A peptidogalactomannan isolated from Cladosporium herbarum induces defense-related genes in BY-2 tobacco cells

Accepted Manuscript A peptidogalactomannan isolated from Cladosporium herbarum induces defenserelated genes in BY-2 tobacco cells Bianca Braz Mattos, ...

3MB Sizes 0 Downloads 14 Views

Accepted Manuscript A peptidogalactomannan isolated from Cladosporium herbarum induces defenserelated genes in BY-2 tobacco cells Bianca Braz Mattos, Caroline Montebianco, Elisson Romanel, Tatiane da Franca Silva, Renato Barroso Bernabé, Fernanda Simas-Tosin, Lauro M. Souza, Guilherme L. Sassaki, Maite F.S. Vaslin, Eliana Barreto-Bergter PII:

S0981-9428(18)30075-5

DOI:

10.1016/j.plaphy.2018.02.023

Reference:

PLAPHY 5160

To appear in:

Plant Physiology and Biochemistry

Received Date: 17 December 2017 Revised Date:

21 February 2018

Accepted Date: 22 February 2018

Please cite this article as: B.B. Mattos, C. Montebianco, E. Romanel, T. da Franca Silva, R.B. Bernabé, F. Simas-Tosin, L.M. Souza, G.L. Sassaki, M.F.S. Vaslin, E. Barreto-Bergter, A peptidogalactomannan isolated from Cladosporium herbarum induces defense-related genes in BY-2 tobacco cells, Plant Physiology et Biochemistry (2018), doi: 10.1016/j.plaphy.2018.02.023. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT

A peptidogalactomannan isolated from Cladosporium herbarum induces defenserelated genes in BY-2 tobacco cells

RI PT

Bianca Braz Mattos2,5,7, Caroline Montebianco2,7, Elisson Romanel2,3,6, Tatiane da Franca Silva3,6, Renato Barroso Bernabé3, Fernanda Simas-Tosin4, Lauro M Souza4, Guilherme L Sassaki4, Maite F S Vaslin1,3, Eliana Barreto-Bergter1,2 2

M AN U

SC

Laboratório de Química Biológica de Microorganismos, Instituto de Microbiologia, Universidade Federal do Rio de Janeiro (UFRJ), Av. Carlos Chagas Filho, 373, CCS 21941599, Rio de Janeiro, Brazil 3 Laboratório de Virologia Molecular Vegetal, Departamento de Virologia, Instituto de Microbiologia, Universidade Federal do Rio de Janeiro (UFRJ), Av. Carlos Chagas Filho, 373, CCS, 21941590, Rio de Janeiro, Brazil 4 Departamento de Bioquímica e Biologia Molecular, Universidade Federal do Paraná (UFPR), Curitiba, Paraná, Brazil 5 Present address: Embrapa Solos, Rua Jardim Botânico, 1024. Jardim Botânico. RJ, Brazil. 6 Present address: Departamento de Biotecnologia (Debiq), Escola de Engenharia de Lorena (EEL), Universidade de São Paulo (USP), Estrada Municipal do Campinho s/n, 12602-810, Campinho, Lorena, São Paulo, Brazil 7 Both authors contributed equally to this work. 1

1

TE D

To whom correspondence should be addressed: Tel/fax: + 55 21 2560-8344; e-mail: [email protected]

EP

To whom correspondence should be addressed: Tel/fax: + 55 21 2560-8344; e-mail: [email protected]

AC C

Keywords: Cladosporium herbarum; glycoprotein; peptidogalactomannan; plant defenserelated genes

ACCEPTED MANUSCRIPT Abstract Cladosporium herbarum is a plant pathogen associated with passion fruit scab and mild diseases in pea and soybean. In this study, a peptidogalactomannan (pGM) of C. herbarum mycelium was isolated and structurally characterized, and its role in plant-fungus interactions

RI PT

was evaluated. C. herbarum pGM is composed of carbohydrates (76%) and contains mannose, galactose and glucose as its main monosaccharides (molar ratio, 52:36:12). Methylation and

13

C-nuclear magnetic resonance (13C-NMR) spectroscopy analysis have

SC

shown the presence of a main chain containing (1→6)-linked α-D-Manp residues, and β-DGalf residues are present as (1→5)-interlinked side chains. β-Galactofuranose containing

M AN U

similar structures were characterized by our group in A. fumigatus, A. versicolor, A. flavus and C. resinae.

Tobacco BY-2 cells were used as a model system to address the question of the role of C.herbarum pGM in cell viability and induction of the expression of plant defense-related

TE D

genes. Native and partially acid hydrolyzed pGMs (lacking galactofuranosyl side-chain residues) were incubated with BY-2 cell suspensions at different concentrations. Cell viability drastically decreased after exposure to more than 400 µg ml-1 pGM; however no cell viability

EP

effect was observed after exposure to a partially acid hydrolyzed pGM. BY-2 cell contact with

AC C

pGM strongly induce the expression of plant defense-related genes, such as phenylalanine ammonia lyase (PAL) and lipoxygenase (LOX), as well as the pathogen-related PR-1a, PR-2 and PR-3 genes, suggesting that pGM activates defense responses in tobacco cells. Interestingly, contact with partially hydrolyzed pGM also induced defense-related gene expression at earlier times than native pGM. These results show that the side chains of the (1→5)-linked β-D-galactofuranosyl units from pGM play an important role in the first line fungus-plant interactions mediating plant responses against C. herbarum. In addition, it was observed that pGM and/or C.herbarum conidia are able to induced HR when in contact with

ACCEPTED MANUSCRIPT tobacco leaves and in vitro plantlets roots, producing necrotic lesions and peroxidase and NO burst, respectively.

Introduction

RI PT

The fungal cell wall is responsible for maintaining cell morphology and protecting fungal cells from environmental stresses. The fungal cell wall is basically composed of chitin and βglucans, which form a rigid inner core. However, several other structurally complex

SC

polysaccharides, glycoproteins extensively modified with both N-and O-linked carbohydrates, enzymes, and lipids have been identified as cell wall components that are frequently loosely

M AN U

anchored in the external layer (Latgé, 2010).

Peptidogalactomannans (pGMs) have been characterized in several fungal species, including Aspergillus fumigatus (Haido et al. 1998), Aspergillus wentii, Chaetosartorya chrysella (Gomez-Miranda et al. 2003), Cladosporium wernecki (Lloyd, 1970) and Cladosporium

TE D

resinae (Calixto et al. 2010). β-Galactofuranose-containing oligosaccharides from the pGM of A. fumigatus and C. resinae are regarded as immunodominant epitopes (Calixto et al. 2010; Leitão et al. 2003) and are important virulence factors in human aspergillosis (Schmalhorst et

EP

al. 2008). In phytopathobiology, little is known regarding the involvement of fungal glycoproteins in the pathogenesis or in the development of resistance responses. Recognition

AC C

of microbes glycoconjugates by plant cells was reported to induces defense responses, such as the production of reactive oxygen intermediates (ROS), increase in the intracellular pH, cell wall thickening and accumulation of pathogenesis-related (PR) proteins (Erbs and Newman, 2009; Lee et al. 2010; Narasimhan et al. 2003). Previously, it was demonstrated that a 34-kDa glycoprotein (GP 34 or CBEL) from the mycelium of Phytophthora parasitica var. nicotianae oomycete induced plant defense responses when in contact with the roots of whole tobacco plants. After contact, the roots showed enhanced lipoxygenase activity and hydroxyprolinerich glycoprotein accumulation (Sejálon-Delmas et al. 1997).

ACCEPTED MANUSCRIPT C. herbarum is a plant pathogen associated with passion fruit scab (Pio-Ribeiro and Mariano, 1997) causing important losses in passion fruit production in Brazil and has been described as an etiologic agent of diseases in onions, wheat, oats, peanuts, potatoes, grapes and coffee (Pitt and Hocking, 2009). Biotypes of C. herbarum were identified causing leaf

RI PT

spots disease in Caltha leptosepala spp., marshmarigold, in mountains in the USA and in Centaurea solstitialis in Greece (Berner et al. 2007; Johnson et al. 2008). However, nothing is known concerning the role of pGM in the elicitation of plant immune responses.

SC

The aim of this study is to characterize C. herbarum pGM, as well its possible role in the elicitation of plant defense responses, using Nicotiana tabacum L. cv Bright-Yellow-2

M AN U

(BY2) cells as a model system. After incubation with pGM, the viability and morphology of BY2 cells were affected and expression of defense-related genes, such as phenylalanine ammonia lyase (PAL) and lipoxygenase (LOX), as well as the pathogen-related genes PR-1a, PR-2 and PR-3 were strongly induced, suggesting that C. herbarum pGM is capable of

TE D

inducing defense responses in tobacco cells. The biological relevance of the galactofuranose chains of C. herbarum pGM in the induction of the plant defense response was also evaluated.

EP

Materials and Methods

AC C

Microorganism and growth conditions Cladosporium herbarum is a filamentous fungus that presents flat, velvety or glabrous

colonies of color ranging from green to brown. The mycelium is formed by hyaline septate and branched hyphae, and its conidia are cylindrical or ellipsoids (Lacaz et al. 2002). C. herbarum used in the experiments was supplied by Dr. J. Guarro, Facultat de Medicina i Ciencies de la Salut (FMR), Universitat Rovira I Virgili, Réus, Spain, and was maintained on slants of potato dextrose agar (PDA). Cell suspensions were inoculated in Erlenmeyer flasks

ACCEPTED MANUSCRIPT containing 3 l of potato dextrose broth, which were incubated in the presence of light for 7 days at 25 °C, with shaking (150 rpm), to obtain mycelia. Mycelia were recovered via paper

Extraction and fractionation of the pGM

RI PT

filtration, washed with distilled water, and stored at -20°C (yield wet weight 200 g).

pGM was extracted from the mycelial forms of C. herbarum. The mycelia were filtered, washed with distilled water and dried (Calixto et al. 2010). Crude extracts were

SC

obtained by extracting the mycelia with hot phosphate buffer (50 mM, pH 7.2) at 100°C for 2

M AN U

h. The extracts were concentrated under reduced pressure, followed by ethanol precipitation. The precipitate was dissolved in distilled water and subsequently lyophilized. This fraction, described as the crude glycoprotein (Haido et al. 1998), was then fractionated via Cetavlon precipitation according to Lloyd (Lloyd, 1970). The mother liquors from the first Cetavlon precipitation were adjusted to pH 8.8 with sodium borate, and the resulting precipitate was

TE D

recovered via centrifugation to produce the pGM. After uncoupling the Cetavlon from the complex using acetic acid, the pGM was dialyzed and lyophilized (1.90 g).

EP

Analytical procedures

AC C

The total carbohydrate content was determined using the phenol-sulfuric acid method (Dubois et al. 1956), protein content was determined using the Lowry method (Lowry et al. 1951), phosphate content was determined using the procedure from Ames (1966), and hexosamine content was determined using the method from Belcher et al. (1954).

Monosaccharide composition of the pGM pGM was hydrolyzed using 3 M trifluoroacetic acid at 100 °C for 3 h, and the resulting monosaccharides were analyzed (a) via HPTLC in n-butanol/acetone/water (5/4/1,

ACCEPTED MANUSCRIPT v/v/v) (Ovodov et al. 1967) and (b) as their alditol acetates, which were characterized and quantified via GC-MS (Sassaki et al. 2014).

Methylation analysis

RI PT

pGM was permethylated according to Tischer et al. (2002). The partially methylated derivatives were converted to the corresponding alditol acetates and subsequently analyzed via gas chromatography coupled to electron-impact mass spectrometry (GC-MS). The

SC

partially methylated alditol acetates were separated on a fused silica OV-225 capillary column (30.0±25 mm, i.d.), which was programmed from 50 to 220°C at a rate of 50°C min-1, and

impact spectra (Jansson et al. 1976).

NMR spectroscopy

M AN U

then held. The products were identified via their retention times and the typical electron

TE D

Native and partially hydrolyzed pGM from C. herbarum were dissolved in D2O obtained at 343 K and chemical shifts referenced with TMSP-d4 (2,2,3,3-tetradeuterium-3trimethylilsilylpropionate, δ = 0). The spectra were obtained using a Bruker 600 MHz

EP

AVANCE III NMR spectrometer with a 5-mm inverse gradient probe (QXI probe). 2D-NMR HSQC with spectral widths of 6393 Hz (1H) and 13582 Hz (13C) was used, and the

AC C

experiments were recorded for quadrature detection in the indirect dimension, using 8 scans per series of 2 K x 256 data points with zero filling in F1 (2 K) prior to the Fourier transformation. A recycle delay of 1.16 s (1 s relaxation delay and 0.160 s acquisition time) was used (Sassaki et al. 2014).

Partial hydrolysis and trypsin treatment of the pGM C. herbarum pGM was treated with 0.1 M HCl and heated at 100°C for 20 min. The

ACCEPTED MANUSCRIPT degraded glycoprotein was recovered via dialysis, lyophilized and subsequently reduced by the addition of 40 ml of 2.5 mM dithiothreitol (DTT) at 56°C for 45 min (Calixto et al. 2010). A trypsin digestion was performed in 100 mM Tris-HCl buffer (pH 8.5) using a ratio of 1:20 enzyme:pGM at 37°C for 24 h and was stopped by boiling the treated sample (Calixto et al.

RI PT

2010).

SDS-PAGE

SC

pGM was solubilized at 100°C for 5 min in a disrupting buffer containing 0.06 M TrisHCl, pH 6.8, 2% (w/v) SDS, 25% (v/v) glycerol and 0.1% (w/v) bromophenol blue, with the

M AN U

reducing conditions obtained by adding 5% (w/v) 2-mercaptoethanol immediately before use (Laemmli, 1970). Electrophoresis was performed in a 10% polyacrylamide separating system, and gels were stained for carbohydrate using the periodic acid-Schiff (PAS) reagent and for

TE D

proteins using silver nitrate (Calixto et al. 2010).

Plant and cell culture conditions

Nicotiana tabacum L. cv Bright-Yellow 2 (BY-2) cell suspensions were grown in

EP

modified Linsmaier and Skoog medium (Nagata et al. 1992) at pH 5.7, in which concentrations of KH2PO4 and thiamine HCl were increased to 370 and 1 mg.l-1, respectively.

AC C

Sucrose and 2,4-D were supplemented at 3% and 0.2 mg.l-1, respectively. The cell suspension was agitated on a rotary shaker at 200 rev min-1 at 28 +/- 2°C in the dark. For mRNA expression analysis, each biological sample comprised a mix of two

independent BY-2 cell populations grown in distinct Erlenmeyer flasks. All of the experiments were conducted in duplicate in six-well plates and repeated three times. Tobacco (N. tabacum) SR1 seedlings were immersed in 70% ethanol for 1 min and further incubated in 2% hypochlorite salt for 7 min under gently agitation. After incubation,

ACCEPTED MANUSCRIPT the seeds were washed 6 times with sterile water and transferred to Petri dishes. The seedlings were grown in vitro in MS semi-solid 0.8% agar medium (Murashige and Skoog, 1962) containing Sigma MS salt diluted at 1/2 straight, pH 5.8. The Petri dishes were maintained in a growing chamber at 26 °C and photoperiod of 12:12 (dark/light). Forty days post-

RI PT

germination (dpg), the plantlets were removed from the medium, the roots were washed in sterile water and the plantlets transferred to culture plates containing liquid MS 1/2 straight medium plus 107 C. herbarum conidia.ml-1. After 10 s of contact, the roots were rinsed in

medium were they stay for 24, 48, 72 or 96 h.

SC

sterile water for several times and the plantlets transferred to new plates contain fresh MS

M AN U

For the pGM:plant interaction, tobacco and N. benthamiana were germinated in substrate TopGarden Base Co. and grown in a greenhouse at approximately 24 +/-2°C.

pGM x BY2 cells incubation assays

TE D

Three days after BY-2 cell propagation, approximately 2.6 ml of cell suspension (obtained by mixing 1.3 ml from two distinct growing flasks) was transferred to six-well plates and incubated with native or the partially hydrolyzed pGM at different concentrations.

EP

To test the phytotoxicity of pGM, native pGM was suspended in an isotonic solution (pH 5.7; 0.011 g/ 50 ml calcium chloride; 0.037 g/ 50 ml potassium chloride; 10 mM/ 50 ml 4-

AC C

morpholinethane-sulfonic acid) to a final concentration of 200, 400 or 600 µg ml-1. A total of 400 µl of the isotonic solution containing different concentrations of native pGM were added to each BY-2-containing well. As a negative control, the same volume of isotonic solution without pGM was added to the BY-2-containing wells. The plates were maintained at 28 +/2°C in the dark under continuous shaking for 120 h. After 0, 24, 48, 72, 96 or 120 h of the BY-2 x pGM incubation, cell viability was assayed using 0.4% trypan blue staining (de Pinto et al. 1999). One-thousand microliters of

ACCEPTED MANUSCRIPT the BY2 cell suspension treated with the different concentrations of pGM for different time periods were incubated for 5 min in trypan blue at a final concentration of 0.1%. After incubation, the cells were rinsed 4 times with the isotonic solution and counted via light microscopy. Trypan blue-stained cells were considered dead. Four optical fields (400x) were

RI PT

counted for each concentration/treatment. All experiments were repeated at least three times. For the callus formation ability preservation assay, 50 µl of the cell suspension obtained from each treatment was spotted onto the same medium used for the BY-2

SC

suspension culture medium supplemented with 0.8% of agar. The cells were maintained at 28 +/- 2°C in the dark and evaluated after 20 days. Subsequently, the callus size was measured.

M AN U

To assess the effect of the Galf non-reducing end units of pGM in BY2 cells, new assays were conducted using a concentration of 400 µg.ml-1 of the partially hydrolyzed pGM and the native pGM. At 3, 6, 12, 24, 72 and 120 h after the incubation of BY-2, the viability

TE D

of the cells was evaluated as described above.

Nicotiana tabacum x pGM and/or C. herbarum in vivo assays C. herbarum pGM at concentrations from 50-600 µg ml-1 was placed in contact with

EP

Nicotiana tabacum SR1 leaves under greenhouse conditions. To examine the effect of pGM

AC C

contact with N. tabacum plants, small scratches of approximately 0.5 cm were made at the adaxial surface of the developed leaves. Fifty microliters of each pGM concentration (0, 50, 100, 200, 400 and 600 µg.ml-1) was dropped over each scratch. Each concentration site was observed daily. All experiments were repeated 4 times for each concentration. Water and isotonic solution were used as negative controls, and BSA (600 µg.ml-1) diluted in water or in an isotonic solution was used as the positive control. pGM was diluted in isotonic solution as described above.

ACCEPTED MANUSCRIPT To examine the C. herbarum x tobacco interaction, roots of N. tabacum SR1 30 days post-germination (dpg) plantlets were submersed in a solution containing 107 C. herbarum conidia.ml-1 for 10 s and washed in sterile water. After 24, 48, 72 and 96 h of C. herbarum conidia contact, the roots were assessed for hydrogen peroxide accumulation and oxide nitric

RI PT

medium exudation. For hydrogen peroxide (H2O2) detection, the seedlings were gently removed from the wells, and the roots were incubated with 3,3 - diaminobenzidine (DAB) (Sigma Co.) at a concentration of 1 mg.ml-1 for 2 h in the dark. The roots were further

SC

transferred to another tube containing boiling ethanol for 10 min. Subsequently, the roots were observed under an optical microscope with a 10x magnification. The evaluation of the

M AN U

presence of nitric oxide (NO) was performed after dosing the supernatants using the Griess Reagent System (Promega Co.) according to the manufacturer’s instructions.

RNA extraction, DNase treatments, cDNA synthesis and real-time quantitative polymerase

TE D

chain reaction (qRT-PCR)

At 3, 6, 12, 24, 72 and 120 h of incubation with 400 µg ml-1 of partially hydrolyzed or native pGM, 1.5 ml of BY-2 cells suspension were collected from each concentration. The

EP

samples were centrifuged at 16,000x g in an Eppendorf microcentrifuge. The pellets were

AC C

rapidly frozen in liquid nitrogen and stored at -80 °C until further RNA extraction. Total RNA was extracted using either the Invisorb Spin Plant RNA Mini Kit (Invitek)

or Trizol (Thermo Fisher Scientific) according to the manufacturer’s instructions. The RNA concentration and purity were determined using a NanoDrop2000 Spectrophotometer (Thermo Scientific). The integrity of RNA was assessed using 1% agarose gel electrophoresis and ethidium bromide staining. One microgram of total RNA from each sample was treated with RQ1 RNase-Free DNase (Promega Corporation) according to the manufacturer’s instructions. DNA contaminants in the RNA samples were verified using actin (Nt-ACT9)

ACCEPTED MANUSCRIPT PCR reactions with RNA strands as the template. No DNA amplification was observed (data not shown). Complementary DNA (cDNA) synthesis was performed using 1 µg of total RNA as a template with M-MLV reverse transcriptase (Promega) and 100 µM of Oligo dT24V primer, according to the manufacturer’s instructions. Following cDNA synthesis, the samples

RI PT

were diluted 25-fold in sterile water.

Primers were designed for seven defense-related genes (PR-1a, PR-2, PR-3, PR-5, NtPrxN1, LOX1 and NtPAL) and two constitutively expressed genes (PP2A and Nt-ACT9)

SC

(Supplementary Table 1) for RT-qPCR using Primer and the criteria for generating amplified products with sizes ranging from 80 to 200 bp and a Tm of approximately 60°C.

M AN U

RT-qPCR analysis was performed in an optical 96-well plate using 2.5 µl of diluted cDNA, 12.5 µl of MaximaTM SYBR Green/ROX qPCR Master Mix (Fermentas), 0.6 µl of forward and reverse primers (10 mM) and water to final volume of 25 µl. The following cycling conditions were used: 5 min at 95° C, followed by 40 amplification cycles of 15 s at

TE D

95 °C, 10 s at the annealing temperature and 15 s at 72 °C (Supplemental Table 2) using the Applied Biosystems 7500 Fast Real-Time PCR System. The melting curve of the amplification products was used to confirm the amplification

EP

of a single product for all the primers used. All of the reactions were performed using two independent biological samples and three technical replicates for each biological replicate.

AC C

The mean Ct values of four constitutive genes in two biologically replicated control and treatment

samples

were

plotted

in

the

RefFinder

web-based

tool

(http://www.leonxie.com/referencegene.php) to identify the best reference gene (data not shown). RefFinder integrates the major computational programs (geNorm, Normfinder, BestKeeper and Delta CT) to compare and rank the tested candidate reference genes. The analysis indicated PP2A and Nt-ACT9 as the most stable constitutive genes for the tested experimental conditions, which were used as the reference genes. The relative expression

ACCEPTED MANUSCRIPT ∆∆Ct

levels (R.E.L.s) were calculated using the 2-

method (Livak and Schmittgen, ,2001).

Student’s t test was performed to compare the pairwise and two-tailed distribution parameters. The means were considered significantly different when P < 0.01. Data were plotted using

RI PT

GraphPad Prism v5.0 (http://www.graphpad.com) to generate the graphs. Primer set efficiencies (Supplemental Table 1) were estimated for each experimental set using the online Real-time PCR Miner software (Zhao and Fernald, 2005).

SC

Results

M AN U

Analysis of the C. herbarum pGM

Hot phosphate buffer extraction of C. herbarum mycelia provided a crude glycoprotein composed of 63% carbohydrates and 24% protein, which was purified by selective precipitation using Cetavlon/sodium tetraborate at pH 8.8, as previously described (Calixto et al. 2010). A purified pGM containing 78% carbohydrates and 22% protein was

TE D

obtained.

SDS-PAGE of pGM showed a band with an apparent molecular mass ranging from 44 to 47 kDa when stained for protein and carbohydrates (Figure 1, lanes 2 and 5). Trypsin

AC C

(Figure 1, lane 4).

EP

treatment decreased the molecular mass of pGM, confirming the presence of a protein moiety

Total acid hydrolysis of pGM, followed by sodium borohydride reduction and

acetylation, generated alditol acetates of mannitol (Man), galactitol (Gal) and glucitol (Glc) at a molar ratio of 52:36:12.

Methylation analysis of the pGM Methylation analysis of pGM showed a branched structure containing a non-reducing end of Galf (6.1%) and 5-O Galf (35%), non-reducing end of Manp (6.6%), 2-O (16.6%), 6-O

ACCEPTED MANUSCRIPT (13.5%), 2,6-di-O-substituted (11.2%) and 2,4-di-O-substituted Manp (2.1%). 4,6-di-Osubstituted units of Glcp (6.9%) were also identified, in addition to a small percentage (2.2%) of non-reducing terminal units of Galp (Table 1).

RI PT

NMR spectroscopy of the pGM

The 2D HSQC spectra of the anomeric region (Figure 2) showed a characteristic signal with chemical shifts attributed to α-linked Manp (1,2) and (1,6) at δ 101.4/5.199 and δ

SC

101.5/5.186, respectively, consistent with the methylation analysis. A cross peak observed at 102.3/5.027 confirmed the presence of di-O-substituted 2,6 α-Manp units, which is a branch

M AN U

point of β-D-Galf units. The presence of β-linked (1,5) Galf units was observed at δ 108.8/5.056 and 108.7/5.026, and β-Galf non-reducing ends were observed at δ 109.7/4.907 and δ 109.5/4.864 (Sassaki et al. 2011, Viccini et al. 2009).

Evaluation of the partially hydrolyzed and native pGM showed important

TE D

characteristic profiles on 2D HSQC (Figure 2). Hydrolyzed pGM was composed of 74% Manp-linked units and 26% β-linked (1,5) Galf chains. The native pGM was composed of 47% linked α-Manp (1,2) and (1,6) and 53% β-D-Galf units (Viccini et al. 2009). The latter

EP

presented a monosaccharide composition of 52% Man and 36% Gal, as described above. Analysis of these data suggested that the galactofuranosyl units are more flexible because the

AC C

peak volume is significantly altered based on T2 differences (Sassaki et al. 2014), which alters the peak volume of integration described by the equation Vc∝exp(-2D/T2). These observations are consistent with the high content of branched Manp units, which are substituted by side chains of β-linked (1,5) Galf and terminal β-galactofuranosyl units.

Phytotoxicity assays To evaluate the ability of C. herbarum pGM to induce defense responses in plants,

ACCEPTED MANUSCRIPT pGM was added to tobacco BY-2 cell suspensions at three different concentrations (200, 400 and 600 µg ml-1), and the viability of the cells was measured daily during a five-day incubation period. Mortality rates of 92.8 and 95.4% were observed using 400 and 600 µg ml1

pGM, respectively, at four and five days after the initial contact between pGM and BY-2

RI PT

cells (Figure 3A and Supplemental Figure 1A). The viability of cells exposed to pGM was also evaluated. Calli were recovered from cells exposed to up to 400 µg ml-1 pGM (Figure 3B), although calli obtained after exposure to 400 µg ml-1 pGM were white and did not grow

SC

any further (Supplemental Figure 1B). However, BY-2 cells treated with lower doses of pGM showed recovery of calli of normal sizes after 20 days of incubation (Supplemental Figure

M AN U

1B). In addition to the significant decrease in cell viability, pGM induced a series of morphological changes in cells, including abnormal size and shape as well as cell membrane detachment, which may be indicative of cell death (Supplemental Figure 1A).

TE D

Involvement of 5-O-linked Galf side chains from pGM in tobacco cell phytotoxicity To evaluate the importance of 5-O-linked Galf side chains from C. herbarum pGM in tobacco cell culture phytotoxicity, the labile galactofuranosyl side-chain residues present in C.

EP

herbarum pGM were removed by partial acid hydrolysis. BY2 cells were incubated with

AC C

native and partially hydrolyzed pGM, the cell viability was evaluated at 3, 6, 12, 24, 72 and 120 h. A significant difference (p <0.01) in the phytotoxic effect induced by native and partially hydrolyzed pGM was observed at 24 h after incubation (Figure 4A). Removal of the galactofuranosyl units by partial acid hydrolysis resulted in a complete loss of pGM toxicity. After 120 h of incubation, the percentage of viable cells incubated with partially hydrolyzed pGM was equivalent to that of the control (p> 0.05). For native pGM, however, the viability declined at 24 h after incubation and reached 20% after 120 h (Figure 4A and B). These data suggest that, similar to A. fumigatus in human models, 5-O-linked Galf side chains may be

ACCEPTED MANUSCRIPT important for the C. herbarum phytopathogenesis.

pGM is capable of inducing plant defense responses BY2 cells incubated with high concentrations of native pGM from C. herbarum

RI PT

induce morphological alterations and drastic decreases of cell viability To check if whole plant tissue is also able to respond to C. herbarum pGM, pGM was put in contact with scratches performed in Nicotiana tabacum SR1 leaves at concentrations ranging from 50 to

SC

600 µg ml-1 under greenhouse conditions. Figure 5 shows the leaf infiltration sites 48 h after

M AN U

pGM infiltration, and pGM at concentrations of up to 50 µg ml-1 induced weak to moderate necrotic local dose-dependent responses in N. tabacum leaves (Figure 5A). At 50 µg ml-1, no effect was observed at the infiltration site. Induction of weak necrotic lesions may indicate that local responses are activated against C. herbarum pGM by tobacco tissues.

TE D

To confirm whether tobacco plants recognize and respond to C. herbarum by activating defense responses, roots of N. tabacum SR1 plantlets were submerged in a solution containing 107 C. herbarum conidia ml-1 for 10 s and were subsequently washed with sterile

EP

water. After 24, 48, 72 and 96 h of C. herbarum conidia contact, the root tissues were assessed for hydrogen peroxide accumulation and oxide nitric medium exudation. As

AC C

observed in Figure 6, at 24 h after fungus contact, oxygen reactive species (ROS) started to accumulate in root tissues. At this point, an increase in nitric oxide production was also observed (Figure 6B). These results showed that C. herbarum induces primary plant defense responses, such as ROS and NO production, in tobacco plantlets.

Expression of defense- and stress-related genes As the contact with C. herbarum induces plant defense responses in tobacco roots, we evaluated whether other typical defense responses were also induced by C. herbarum pGM,

ACCEPTED MANUSCRIPT which localizes at the fungus cell wall outer layer and could be recognized by plants as a PAMP. The peroxidase NtPRxN1 and lypoxigenase (LOX) transcript expression profiles were evaluated using RT-qPCR after incubation of BY2 cells with 400 µg ml-1 pGM and partially hydrolyzed pGM at early stages until 120 h (Figure 7). As shown in Figure 7A, the NtPRxN1

RI PT

transcript levels increased at 6 h after incubation with partially hydrolyzed pGM. For native pGM, the NtPRxN1 expression levels were significantly increased after 12 h of incubation, and approximately 5 times higher expression was observed compared with control cells that

SC

were not exposed to native or partially hydrolyzed pGM. The highest levels of NtPRxN1 expression were observed at 24 h for both pGM forms. Subsequently, the decrease in

M AN U

transcript levels was similar to that of untreated cells at 120 h post-incubation. To assess whether genes from the phenylpropanoid pathway were also induced in BY2 cells after incubation with native pGM and partially hydrolyzed pGM, expression of phenylalanine ammonia lyase (PAL) was evaluated. As shown in Figure 7B, PAL was also upregulated after

TE D

incubation with both molecules. Twelve hours after incubation, PAL expression was 5 and 7.5 times higher in cells incubated with partially hydrolyzed and native pGM, respectively, compared with control cells, and 50- and 150-fold higher gene expression was detected after

EP

72 h of incubation with partially hydrolyzed and native pGM, respectively. At 120 h, the PAL

AC C

levels decreased in treated cells, and the values were the same as in untreated control cells. The results showed that both LOX and PAL transcripts were highly expressed 72 h after incubation with native and partially hydrolyzed C. herbarum pGM. Expression of LOX transcripts after incubation with native and partially hydrolyzed pGM was upregulated at 24 and 72 h, respectively. The levels of LOX expression were 60 and 40 times higher in cells that were incubated with both molecules for 72 h. However, upregulation of LOX was only maintained in cells that were partially incubated with partially hydrolyzed pGM. Thus, the results showed that similar to NtPRxN1 and PAL, LOX transcripts are highly

ACCEPTED MANUSCRIPT expressed 72 h after incubation with native and partially hydrolyzed pGM. Interestingly, partially hydrolyzed pGM, induced a stronger response than native pGM.

Expression of pathogen-related genes

RI PT

Expression of four pathogen-related genes, PR-1a (with unknown function), PR-2 (a β1-3 endoglucanase), PR-3 (a endochitinase), and PR-5 (a thaumatin-like protein), was evaluated in BY2 cells incubated with native and partially hydrolyzed pGM. Figure 7

SC

summarizes the expression levels observed for these genes. All of the PRs genes were induced in BY2 cells after incubation with both pGMs. However, each PR transcript showed a

M AN U

distinct expression profile. PR-1a was induced at the earliest time, showing strong upregulation at 12 and 24 h after BY2 incubation with both forms of pGM. At 24 h, partially hydrolyzed pGM induced higher PR-1a levels (approximately 80 times more expressed than the observed for untreated cells) than native pGM (15 times more expressed than untreated

TE D

cells). After 72 h, PR-1a levels decreased in both pGMs treatments (partially hydrolyzed and native) and were similar to those observed for untreated cells. The PR-2 and PR-3 genes were significantly upregulated in the first few hours. PR-2 expression was induced early, at 6 h

EP

after incubation with partially hydrolyzed pGM. However, the most pronounced induction

AC C

was observed at 24 h after incubation, when an increase of more than 50 times was observed in cells incubated with both native and partially hydrolyzed pGM. At 72 h, PR-2 was 3 times more expressed compared with untreated cells. For PR-3, native pGM was responsible for the higher induction at 24 h, showing 1,600 times greater than untreated cells. Partially hydrolyzed pGM induced approximately 13 times greater expression than that observed in untreated cells. This higher induction observed for native pGM was not maintained at the subsequent time points. At 72 and 120 h, PR-3 was approximately 3-10 times more expressed than in untreated cells for both pGMs. Thaumatin-like PR5 was also induced and showed low

ACCEPTED MANUSCRIPT levels of induction as well as a delayed pattern of expression compared with the other PR and defense genes analyzed. A 3 to 6X upregulation of PR5 expression was only observed at 72 h after incubation with native and partially hydrolyzed pGM, respectively. After 72 h, PR5 expression remained downregulated in BY2 cells incubated with partially hydrolyzed pGM.

RI PT

The results showed that the expression profiles of all seven genes tested responded to C. herbarum pGM treatment, suggesting that pGM presents an elicitor activity. Nevertheless, similar to the LOX transcript profile, PR1 and PR5 showed stronger up-regulation in response

SC

to the partially hydrolyzed pGM than the native pGM incubation, with PR1 activated at the earliest stages, followed by LOX and PR5. The LOX up-regulation response was still observed

M AN U

at 120 h, and PR5 showed a down regulation at 72 h.

Discussion

In the present study, we characterized the structure and biological activities of the

TE D

peptidogalactomannan (pGM) isolated from C. herbarum, the causal agent of passion fruit scab, using the tobacco BY-2 cells as a model system. Monosaccharide composition, methylation and 2D NMR analyses were performed to determine the structural features of

EP

pGM (Figures 1 and 2). This glycoconjugate is composed of a main chain containing (1→6)linked α-D- mannopyranosyl units substituted at O-2 by side chains containing consecutive

AC C

(1→2)-linked α-D-mannopyranose residues. β-D-galactofuranosyl units are present as (1→5)interlinked side chains. The galactomannan complex from C. herbarum is similar to that of pGMs isolated from Aspergillus fumigatus (Haido et al. 1998) and C. resinae, a contaminant in fuel storage tanks (Calixto et al. 2010), and differs from other Cladosporium species, such as that of C. werneckii, the causative agent of tinea nigra (Lloyd, 1970). Previous studies have demonstrated that the galactofuranosyl unit is essential for the survival or virulence of certain fungi (Schmalhorst et al. 2008). Molecules containing β- Galf-

ACCEPTED MANUSCRIPT bearing chains are regarded as immunodominant epitopes in mammals (Bennett et al. 1985, Leitao et al. 2003), particularly when they are (1→5)-linked (Calixto et al. 2010, Haido et al. 1998, Leitao et al. 2003, Notermans et al. 1988). Our results suggested that similar to human pathogenic fungi, the galactofuranosyl units present in C. herbarum pGM are involved in its

RI PT

phytotoxicity. Removal of the (1→5)-linked β-D-galactofuranosyl side chains by partial hydrolysis with 0.1 M HCl at 100 °C almost completely abolished pGM toxicity to BY2 cells, restoring cell viability and callus formation.

SC

At high concentrations (>400 µg ml-1), C. herbarum pGM induced BY2 cell death after 4-5 days of incubation. Additionally, infiltration of tobacco leaves with C. herbarum pGM

M AN U

induced local necrotic lesions in tobacco (Figure 5A), showing that a hypersensitive response (HR) was activated, and indicating an incompatible interaction between C. herbarum and tobacco. HR activation in BY2 cells that were in contact with the native pGM may explain it drastic phytotoxic effects. Contact of C. herbarum conidia with tobacco plantlets also induced

TE D

plant defense responses associate to HR, as observed by peroxide hydrogen and nitric oxide (NO) production in fungus-exposed roots. In response to pathogen attack, reactive nitrogen species are generated together with peroxide hydrogen, and both compounds mediate defense

EP

responses during HR (reviewed by Bailey-Serres and Mittler, 2006). To understand which plant resistance response pathways may be elicitate by the

AC C

contact of C. herbarum pGM with tobacco BY2 cells, the expression profiles of plant defense key genes were evaluated. Peroxidase or peroxiredoxin (NtPRx-N1), phenylalanine lyase (PAL) and lipoxygenase (LOX) mRNA accumulation after BY2 cell incubation with both native and partially hydrolyzed pGM showed that these three genes were upregulated (Figure 7A-C). Peroxidase gene expression was upregulated shortly after incubation of BY2 cells with native pGM, indicating that pGM alone induces this plant primary defense response. Curiously, partially hydrolyzed pGM induced upregulation of peroxidase transcripts earlier

ACCEPTED MANUSCRIPT than native pGM. Activation of peroxidase expression to manage ROS damage is an important biotic stress response. Both detection of hydrogen peroxide accumulation in roots after C. herbarum conidia contact and induction of the Nt-PRx-N1 peroxidase indicate that the fungus and/or both pGM structures induce ROS in tobacco, likely helping the plant to

RI PT

make this interaction incompatible. PAL expression was also highly activated early postincubation. In addition to plant peroxidases, non-enzymatic antioxidants, such as flavonoids, phenolic compounds, alkaloids, among others, are also crucial for plant defense against

SC

oxidative stress, playing a key role as antioxidant buffers (Foyer and Noctor, 2005; Gratão et al. 2005). Thus, upregulation of the key enzymes in the phenylpropanoid biosynthesis

M AN U

pathway shows that this effect is mediated by both forms of pGM (Figure 7A and B) and is likely induced early after C. herbarum pGM and tobacco cells interactions. The increase of the PAL enzyme in plant-fungi interactions was previously reported. Dewanjee et al. (2014) inoculated death cultures of Alternaria alternata in Solenostemon scutellarioides plant

TE D

cultures and observed an enhancement of secondary metabolic rosmarinic acid production, induction of oxidative stress and an increase of PAL biosynthesis. Similarly, distinct polysaccharides obtained from crude extracts of the mycelium of Fusarium oxysporum Fat9

EP

induced flavonoid production and strongly enhanced PAL activity in Fagopyrum tataricum sprout cultures (Zhong et al. 2016). Here, we observed higher levels of PAL expression when

AC C

BY2 cells interacted with native pGM compared with the partially hydrolyzed pGM. As observed for Nt-PRx-N1 and PAL, pGM incubation also induced LOX expression (Figure 7C). The 34-kDa CBEL glycoprotein purified from the oomycete Phytophthora parasitica var. nicotianae induced lipoxygenase activity between 24 and 48 h after CBEL contact with roots (Séjalon et al. 1995; Séjalon-Delmas et al. 1997). During plant defenses, lipoxygenase pathway activation increases production of compounds through fatty acid oxidation, including JA and aldehyde, which are associated with pathogen growth inhibition (Chauvin et al. 2013).

ACCEPTED MANUSCRIPT For example, transgenic tobacco plants expressing LOX1 antisense mRNA showed enhanced susceptibility toward the compatible fungus Rhizoctonia solani (Rance et al. 1998). Although both pGMs lead to increased LOX levels, hydrolyzed pGM treatment induced an earlier and

of cells under this condition (Figures 3 and 4).

RI PT

stronger response that is likely associated with BY2 cell resistance and the increased viability

The four pathogen-related genes evaluated here were also upregulated during incubation with partially hydrolyzed and native pGM (Figure 7D-G). PR-1a showed the

SC

earliest upregulation (Figure 7D). Previous studies with a non-pathogenic fungi have shown an apparent association between PR-1 proteins and enhanced resistance against oomycetes

M AN U

(van Loon et al. 2006). PR-1a induction is classically associated with the hormones salicylic acid and SAR (De Coninck et al. 2015, Penninckx et al. 1996). Similar to LOX, the PR-1 gene showed early induction and higher levels after hydrolyzed pGM treatment, likely in association with BY2 cell tolerance. Expression of the beta-1,3-glucanase gene (PR-2) has

TE D

been associated with plant resistance to several phytopathogenic fungi and oomycetes, such as Peronospora tabacina and Phytophthora parasitica (Lusso and Kuc, 1996), Ralstonia solanacearum (Chen et al. 2006), and Rhizoctonia solani (Sridevi et al. 2008) in tobacco,

EP

tomato and rice, respectively. More recently, volatiles of Bacillus sp JS protected tobacco

AC C

plants against pathogenic fungi through induction of PR-2, PR-3 and PR-5 expression (Kim et al. 2015). Herein, we observed induction of PR-2 expression during incubation with partially hydrolyzed or native pGM (Figure 7E). Similar data were obtained for the expression of the chitinase gene (PR-3), which was highly induced at 24 h after incubation, and thaumatin-like gene (PR-5) (Figures 7F and G). As observed for LOX and PR1, PR5 expression was also more highly activated during incubation with partially hydrolyzed pGM compared with native pGM (Figure 7G), which may be associated with tobacco cell viability. Strong induction of defense related genes mediated by either partially hydrolyzed or native

ACCEPTED MANUSCRIPT pGM suggests that C. herbarum pGM could induces incompatible plant pathogen-interaction responses and may be an interesting glycoprotein for the development of new strategies to combat pathogen-associated plant diseases. High H2O2 and NO production together with upregulation of Nt-PRX-N1 and PAL and LOX transcription indicated that pGM is likely

RI PT

recognized by tobacco cells as a virulence effector. So, based on the results observed, we hypothesize that the native pGM of C. herbarum may function as a pathogen effector and that it’s recognition by an unknown tobacco R protein may is inducing an effector-triggered

SC

immunity (ETI) in the tobacco cells and plants (Figure 8).

M AN U

Abbreviations

GC-MS, gas–liquid chromatography-mass spectrometry; HPTLC, high-performance thin layer chromatography; 2D-NMR HSQC, heteronuclear single quantum coherence; RT-qPCR,

TE D

reverse transcriptase, followed by quantitative real-time PCR.

Funding

This work was supported by the Conselho Nacional de Desenvolvimento Científico e

EP

Tecnológico (CNPq), Fundação de Amparo à Pesquisa no Estado do Rio de Janeiro

AC C

(FAPERJ), Coordenação de Aperfeiçoamento Pessoal de Nível Superior (CAPES-PROEX) and Universidade Federal do Rio de Janeiro (UFRJ).

Acknowledgements

We thank Dr. Jean Louis Simões-Araújo for critical riding of the manuscript.

References Ames GR, King TA. 1966. The assay and pH profile of lipoxidase. J Sci Food Agric. 17(7):301-303.

ACCEPTED MANUSCRIPT Bailey-Serres J, Mittler R. 2006. The roles of reactive oxygen species in plant cells. Plant Physiol. 141(2):311. Belcher R, Nutten AJ, Sambrook CM. 1954. The determination of glucosamine. Analyst. 79:201-208.

RI PT

Bennett JE, Bhattacharjee AK, Glaudemans CPJ. 1985. Galactofuranosyl groups are immunodominant in Aspergillus-fumigatus galactomannan. Mol Immun. 22:251-254. Berner, D. K., Smallwood, E. L., McMahon, M. B., Luster, D. G., Kashefi, J. 2007. First report of leaf spot caused by Cladosporium herbarum on Centaurea solstitialis in Greece. Plant Dis. 91:463.

SC

Calixto R, Mattos B, Bittencourt V, Lopes L, Souza L, Sassaki G, Cipriani T, Silva M, Barreto-Bergter E. 2010. Beta-galactofuranose-containing structures present in the cell wall of the saprophytic fungus Cladosporium (Hormoconis) resinae. Res Microb. 161:720-728.

M AN U

Chauvin A, Caldelari D, Wolfender JL, Farmer EE. 2013. Four 13-lipoxygenases contribute to rapid jasmonate synthesis in wounded Arabidopsis thaliana leaves : a role for lipoxygenase 6 in responses to long-distance wound signals. New Phytol. 197(2):566-575. Chen SC, Liu AR, Zou ZR. 2006. Overexpression of glucanase gene and defensin gene in transgenic tomato enhances resistance to Ralstonia solanacearum. Russian J Plant Physiol. 53:671-677.

TE D

De Coninck B, Timmermans P, Vos C1, Cammue BP, Kazan K. 2015. What lies beneath: belowground defense strategies in plants. Trends Plant Sci. 20(2):91-101. De Pinto MC, Francis D, De Gara L. 1999. The redox state of the ascorbate-dehydroascorbate pair as a specific sensor of cell division in tobacco BY-2 cells. Protoplasma. 209:90-97.

EP

Dewanjee S, Gangopadhyay M, Das U, Sahu R, Samanta A, Banerjee P. 2014. Signal transducer and oxidative stress mediated modulation of phenylpropanoid pathway to enhance rosmarinic acid biosynthesis in fungi elicited whole plant culture of Solenostemon scutellarioides. Enzyme Microb Technol. 66:1-9.

AC C

Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F. 1956. Colorimetric method for determination of sugars and related substances. Analyt Chem. 28:350-356. Erbs G, Newman M. 2009. MAMPs/PAMPs - elicitors of innate immunity in plants. In: Jackson RW editor. Plant pathogenic bacteria: genomics and molecular biology. Caister Academic Press, Norfolk, pp. 227-240. Foyer CH and Noctor G. 2005. Redox homeostasis and antioxidant signaling: A metabolic interface between stress perception and physiological responses. Plant Cell 17:1866-1875. Gomez-Miranda B, Prieto A, Leal JA, Ahrazem O, Jimenez-Barbero J, Bernabe M. 2003. Differences among the cell wall galactomannans from Aspergillus wentii and Chaetosartorya chrysella and that of Aspergillus fumigatus. Glycoconjugate J. 20:239-246.

ACCEPTED MANUSCRIPT Gratão PL, Polle A, Lea PJ and Azevedo RA. 2005. Making the life of heavy metal-stressed plants a little easier. Funct Plant Biol. 32:481-494. Haido RMT, Silva MH, Ejzemberg R, Leitao EA, Hearn VM, Evans EGV, Bergter EB. 1998. Analysis of peptidogalactomannans from the mycelial surface of Aspergillus fumigatus. Med Mycology. 36:313-321.

RI PT

Jansson P-E, Kenne L, Liedgren H, Lindberg B, Lonngren J. 1976. A practical guide to the methylation analysis of carbohydrates. Chem Commun Univ Stockholm 8: 51. Johnson DA, Pimentel G, Dugan FM. 2008. Cladosporium herbarum causes a leaf spot on Caltha leptosepala (marshmarigold) in western North America. Online. Plant Health Progress. doi:10.1094/PHP-2008-1121-01-RS

SC

Kim JS, Lee J, Lee CH, Woo SY, Kang H, Seo SG, Kim SH. 2015. Activation of pathogenesis-related genes by the rhizobacterium, Bacillus sp. JS, which induces systemic resistance in tobacco plants. Plant Pathol. J. 31(2):195-201.

M AN U

Lacaz CS, Porto E, Martins JEC, Heins-Vaccari EM, Takahashi MN. 2002. Tratado de Micologia médica 9a ed., Sarvier, São Paulo. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680-685. Latgé JP. 2010. Tasting the fungal cell wall. Cell Microbiol. 12(7):863-872.

TE D

Lee H, Damsz B, Woloshuk CP, Bressan RA, Narasimhan ML. 2010. Use of the plant defense protein osmotin to identify Fusarium oxysporum genes that control cell wall properties. Eukaryot Cell. 9(4):558-568.

EP

Leitao EA, Bittencourt VCB, Haido RMT, Valente AP, Peter-Katalinic J, Letzel M, de Souza LM, Barreto-Bergter E. 2003. β-galactofuranose-containing O-linked oligosaccharides present in the cell wall peptidogalactomannan of Aspergillus fumigatus contain immunodominant epitopes. Glycobiol. 13:681-692.

AC C

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−∆∆CT method. Methods 25(4):402-408. Lloyd KO. 1970. Isolation, characterization, and partial structure of peptido galactomannans from yeast form of Cladosporium werneckii. Biochem. 9(17):3446-3453. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. 1951. Protein measurement with the Folin phenol reagent. J Biol Chem. 193(1):265-275 Lusso M, Kuc J. 1996. The effect of sense and antisense expression of the PR-N gene for beta-1,3-glucanase on disease resistance of tobacco to fungi and viruses. Physiol Mol Plant Pathol. 49:267-283. Murashige T, Skoog F. 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant 15:473–497.

ACCEPTED MANUSCRIPT Nagata T, Nemoto Y, Hasezawa S. 1992. Tobacco BY-2 cell line as the Hela-cell in the cell biology of higher-plant. Inter Rev Cytol Survey Cell Biol. 132:1-30. Narasimhan ML, Lee H, Damsz B, Singh NK, Ibeas JI, Matsumoto TK, Woloshuk CP, Bressan RA. 2003. Overexpression of a cell wall glycoprotein in Fusarium oxysporum increases virulence and resistance to a plant PR-5 protein. Plant J. 36:390-400.

RI PT

Notermans S, Veeneman GH, Vanzuylen C, Hoogerhout P, Vanboom JH. 1988. (1-5)-linked beta-D-galactofuranosides are immunodominant in extracellular polysaccharides of Penicillium and Aspergillus species. Mol Immun. 25:975-979.

SC

Ovodov YS, Evtushen.Ev, Vaskovsk.Ve, Ovodova RG, Soloveva TF. 1967. Thin-layer chromatography of carbohydrates. J Chromatogr. 26:111-115.

M AN U

Penninckx IA, Eggermont K, Terras FR, Thomma BP, De Samblanx GW, Buchala A, Métraux JP, Manners JM, Broekaert WF. 1996. Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid- independent pathway. Plant Cell 8(12):2309–2323 Pio-Ribeiro G, Mariano R de LRM. 1997. Doenças do Maracujazeiro (Passiflora spp.). In: Kimati H. et al. Manual de Fitopatologia: Doenças das Plantas Cultivadas. Editora Agronômica Ceres, São Paulo, v.2, pp. 488-497. Pitt JI, Hocking AD. 2009. Fungi and Food Spoilage. Springer press, Springer.

TE D

Rance I, Fournier J, Esquerre-Tugaye MT. 1998. The incompatible interaction between Phytophthora parasitica var. nicotianae race 0 and tobacco is suppressed in transgenic plants expressing antisense lipoxygenase sequences. Proc Nat Acad Sci USA. 95:65546559.

EP

Sassaki GL, Czelusniak PA, Vicente VA, Zanata SM, Souza LM, Gorin PAJ, Iacomini M. 2011. Some biomolecules and a partially O-acetylated exo-galactomannan containing betaGalf units from pathogenic Exophiala jeanselmei, having a pronounced immunogenic response. Int J Biol Macromol. 48:177-182.

AC C

Sassaki GL, Guerrini M, Serrato RV, Santana Filho AP, Carlotto J, Simas-Tosin F, Cipriani TR, Iacomini M, Torri G, James Gorin PA. 2014. Monosaccharide composition of glycans based on Q-HSQC NMR. Carbohyd Polym. 104:34-41. Schmalhorst PS, Krappmann S, Vervecken W, Rohde M, Mueller M, Braus GH, Contreras R, Braun A, Bakker H, Routier FH. 2008. Contribution of galactofuranose to the virulence of the opportunistic pathogen Aspergillus fumigatus. Eukaryotic Cell, 7:1268-1277. Schmidt GW, Delaney SK. 2010. Stable internal reference genes for normalization of realtime RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress. Mol Genet Genomics. 283:233-241. Séjalon N, Villalba F, Bottin A, Rickauer M, Dargent R, Esquerré-Tugayé MT. 1995. Characterization of a cell surface antigen isolated from the plant pathogen Phytophthora

ACCEPTED MANUSCRIPT parasitica var. nicotianae. Can J Bot. 73S:1104-1108. Séjalon-Delmas N, Villalba Mateos F, Bottin A, Rickauer M, Dargent R, Esquerré-Tugayé M T. 1997. Purification, elicitor activity, and cell wall localization of a glycoprotein from Phytophthora parasitica var. nicotianae, a fungal pathogen of tobacco. Phytopath. 87:899909.

RI PT

Sridevi G, Parameswari C, Sabapathi N, Raghupathy V, Veluthambi K. 2008. Combined expression of chitinase and beta-1,3-glucanase genes in indica rice (Oryza sativa L.) enhances resistance against Rhizoctonia solani. Plant Sci. 175:283-290. Tischer CA, Gorin PAJ, Iacomini M. 2002. The free reducing oligosaccharides of gum arabic: aids for structural assignments in the polysaccharide. Carbohyd Polym. 47:151-158.

SC

van Loon LC, Rep M, Pieterse CMJ. 2006. Significance of inducible defense-related proteins in infected plants. Ann Rev Phytopathol. 135-162.

M AN U

Viccini G, Martinelli TR, Raimundo Cognialli RC, de Faria RO, Carbonero ER, Sassaki GL, Mitchell DA. 2009. Exopolysaccharide from surface-liquid culture of Clonostachys rosea originates from autolysis of the biomass. Arch Microbiol. 191:369-378. Zhao S, Fernald RD. 2005. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comp Biol. 12:1047-1064.

EP

Figure legends

TE D

Zhong L, Niu B, Tang L, Chen F, Zhao G, Zhao J. 2016. Effects of polysaccharide elicitors from endophytic Fusarium oxysporum Fat9 on the growth, flavonoid accumulation and antioxidant property of Fagopyrum tataricum sprout cultures. Molecules 21, 1590.

AC C

Figure 1. Characterization of Cladosporium herbarum pGM by SDS-PAGE. Lane 1: Coomassie-stained molecular weight marker; Lane 2: Silver-stained pGM; Lane 3: Silverstained trypsin; Lane 4: Silver-stained pGM treated with trypsin; Lane 5: pGM stained for sugars (Schiff's reagent). * indicates pGM bands.

Figure 2. Normalised and superimposed partial 2D HSQC NMR spectra of the anomeric region of pGM. Red cross peaks, partially hydrolysed pGM. Black cross peaks, native pGM. The 1H/13C chemical shift map was determined based on previous studies (Calixto et al. 2010)

ACCEPTED MANUSCRIPT and the methylation data.

Figure 3. Analyse of Nicotiana tabacum BY-2 cells viability (A) and recovery (B) after incubation with C. herbarum pGM. BY-2 cells were pre-treated with pGM (0, 200, 400 and

RI PT

600 µg/ml) for 24, 48, 72, 96 and 120 h. After each incubation period, cell viability was evaluated using trypan blue (3A) and the cell recovery ability evaluated by callus formation (3B) in solid medium. Callus length was measured 20 days after the inoculation. *The

SC

differences in expression were statistically significant as evaluated by ANOVA and the

M AN U

Bonferroni post-test (p <0.05). The results are from three independent assays.

Figura 4. Removal of 5-O-linked Galf side chains by partial acid hydrolysis abolished the pGM-induced cell death in the BY-2 cells. Cell viability was evaluated at 3, 6, 12, 24, 48 and 120 h after incubation with 400µg.mL-1 of an acid hydrolyzed pGM were the

TE D

galactofuranose was partially removed using trypan blue. Native pGM incubation at the same concentration was evaluated at the same times. After staining, cells were observed under an optical microscope at 40x magnification. (A) Percentage of viable cells between 3 and 120 h

EP

after incubation. Experiments were realized in duplicate, the mean as well the standard deviation are shown. (B) BY-2 cells stained with trypan blue were observed under optical

AC C

microscope after 3-120 h of incubation with pGM or pGM Galf- or without pGM (control).

Figura 5. C. herbarum native pGM contact with Nicotiana tabacum leaves. Fifty microliters of C. herbarum pGM at concentrations from 50-600 µg.ml-1 was dropped by into small scratches made with a needle in Nicotiana tabacum SR1 leaves. The same concentrations of pGM were infiltrated using a syringe without needle in (B and C) leaves. Inoculated sites 48 h after contact are shown. Negative controls were: isotonic solution (SI)

ACCEPTED MANUSCRIPT and water. As positives control, bovine serum albumin diluted in water (BSA + H2O) or isotonic solution (BSA + SI) were used.

Figure 6. DAB precipitation after C. herbarum conidia interaction with N. tabacum

RI PT

roots. Roots of in vitro growing tobacco plantlets were transferred to MS (Murashige and Skoog, 1962) medium containing 107 C. herbarum conidia for 10 s After 10s, roots were water washed and transferred to fresh liquid medium. After 24, 48, 72 and 96 h, roots were

SC

incubated with DAB and DAB precipitation analyzed at visible light under microscope at 10x magnification (left panel). White arrow indicates bubble production. The media were the roots

M AN U

were growing was checked to detect the presence of oxide nitric at 0-96 h pos root x conidia contact (right panel).

Figure 7. C. herbarum pGM incubation induced defence-related tobacco genes

TE D

expression in the BY-2 cells. BY-2 cells were incubated with isotonic buffer alone (control/black) or 400 μg ml-1 of partially hydrolysed pGM (pGM Galf-/red) or the native pGM (pGM/blue) for 3, 6, 12, 24, 48, 72 and 120 h. A RT-qPCR was performed using

EP

specific primers for LOX1, NtPrxN1, NtPAL, PR-1a, PR-2, PR-3, PR-5, PP2A and Nt-ACT9.

AC C

The relative expression levels (R.E.L.) were estimated using the protein phosphatase 2A (PP2A) and actin (Nt-ACT9) genes as reference genes. Values are the means of two biologically independent experiments and technical triplicates ± standard deviations. The bar with * represents a statistical difference from the control using the t test (p-value ≤ 0.1), ** P<0,001 and *** - P<0,0001).

Figure 8: pGM and partially hydrolyzed pGM induction of plant defense. Plant cells may recognize C. herbarum pGM as a virulence effector and activate effector-triggered immunity

ACCEPTED MANUSCRIPT (panel left part). Interaction between pGM and/or C. herbarum conidia with specific R/NBLRR proteins induces plant defense responses as NO and ROS accumulation, in a HR. The presence of the fungus or its pGM, may trigger SA accumulation and the induction of the expression of pathogen related PR1, PR2 and PR3 and peroxidase (PRxN1), lipoxygenase

RI PT

(LOX) and phenylalanine ammonia-lyase (PAL) genes 12-24h after contact. pGM after removal of its (1→5) β- galactofuranosyl side chains may interact with a plant PRR and activates a PTI (panel right part). JA response activation is triggered resulting in an earlier cell

SC

defense response and the induction of high levels of PR1, PAL and LOX transcript since the

M AN U

first 6h after contact.

Supplemental Figure 1A. pGM induced morphological alterations and cell death in the BY-2 cells. The trypan blue stain represents unviable cells. (1A), (1B) and (1C) show the BY2 cells in the absence of pGM. (2A), (2B), (2C) and (3A), (3B) and (3C) show the BY-2 cells

TE D

in the presence of pGM at 200 and 400 µg ml-1, respectively, after pGM contact. B and C represent a higher magnification. Bars = 10 µm. Note that the trypan blue-stained cells in the

EP

presence of pGM show an abnormal size and membrane alterations.

AC C

Supplemental Figure 1B. Effect of BY-2 cells pre-treatment with pGM in the callus formation. (1A, 1B) show the BY-2 cells in the absence of pGM, and (2A, 2B) and (3A, 3B) show the cells in the presence of 200 and 400 µg.ml-1 of pGM, respectively.

Supplemental Figure 2. Evaluation of the optimal reference genes for the present experimental conditions. The expression stability values of the protein phosphatase 2A (PP2A), ubiquitin-conjugating enzyme (E2) (Ntubc2), elongation factor 1α (EF-1α) and actin (Nt-ACT9) candidate reference genes obtained using distinct algorithms. Gene stability

ACCEPTED MANUSCRIPT was determined using (A) Genorm, (B) the Delta CT method, (C) NormFinder, and (D) BestKeeper. All of the analyses were performed using RefFinder from the Cotton EST

M AN U

SC

RI PT

Database (http://www.leonxie.com).

Table 1. GC-MS analysis of O-methylalditol acetates derived from methylation analysis of galactomannans of C. herbarum Retention time (min)

a

9.0 9.1 9.3 11.6 12.6 12.8 13.0 16,5 18,5

EP

2,3,4,6-Me4-Man 2,3,4,6-Me4-Gal 2,3,5,6-Me4-Gal 3,4,6-Me3-Man 2,3,6-Me3-Gal 2,3,4-Me3-Man 2,3,6-Me3-Glc 3,6-Me2-Man 3,4-Me2-Man

Glycosidic linkage

Manp-(1→ Galp-(1→ Galf-(1→ →2)-Manp-(1→ →5)-Galf-(1→ →6)-Manp-(1→ →4)-Glcp-(1→ →2,4)-Manp-(1→ →2,6)-Manp-(1→

TE D

O-Methylalditol acetatea

Mole % 6,6 2,2 6,1 16,6 34,8 13,5 6,9 2,1 11,2

AC C

O-Methylalditol acetates obtained on successive methylation, hydrolysis, reduction, and acetylation, analyzed by GC-MS (DB-225 column).

ACCEPTED MANUSCRIPT

Supplemental Table 1. Primers, amplicon size, accession number and references of

EF-1α Nt-ACT9 PR-1a PR-2 PR-3 PR-5 NtPrxN1 LOX1 NtPAL

Accession Number

Reference

121

X97913.1

This work

119

AB026056.1

This work

51

AF120093.1

280 138

SC

Ntubc2

Amplicon size (bp)*

EU938079.1

AC C

EP

* in cDNA sample.

Schmidt and Delaney, 2010 Rivière et al. 2008

D90196.1

This work

89

AF141654.1

This work

91

AF088885.1

This work

123

AF154636.1

This work

142

AB027753.1

This work

135

AB233415.1

This work

141

X78269.1

This work

M AN U

PP2A

Forward//reverse primers sequences (5’-3’) GGGGAAGTTTGCTGCTACTG// AGCACAGCCCTCAACAGCTA CGCTGATGGAAGTATTTGCT// CTGGCGAGTTAGGATTTGGA TGAGATGCACCACGAAGCTC// CCAACATTGTCACCAGGAAGTG AGGGTTTGCTGGAGATGATG// CGGGTTAAGAGGTGCTTCAG ATGCGCAAAATTATGCTTCC// TCTCATCGACCCACATCTCA ATTAGCAGCATCAGGGTTGC// TAGCTTTGGGTGGGTAGGTG GGTTTTGCTGCATTCCAAAT// TGCCGCTTTGATCTTCTTCT TCAGGAATGCTGCAAGAATG// GCTTGTTCTGGCTCTCATCC CGTAGAGATGGGCGAGTTTC// TAGTGTGCGCACCAGTAAGG GGATGTTGGTGCTTCTTTCC// TCCAAGAATGCTGGTTTTCC AGTCGTGGACAGGGAATACG// ATTGAGCTGTTCGCGTTCTT

TE D

Gene

RI PT

Nicotiana tabacum EST

ACCEPTED MANUSCRIPT

Supplemental Table 2. Additional information of primers from Nicotiana tabacum genes Putative exon for forward primer

Putative exon for reverse primer

R2

Efficiency ± SD*

Temperature of annealing

Arabidopsis putative ortologue

1.01 ± 0.008

60°C

At3g25800

0.98 ± 0.006

60°C

At2g02760

60°C

At1g07930

60°C

At3g12110

60°C

At2g19990

60°C

At3g57260

60°C

At1g65790

62°C

At5g15200

60°C

At5g39580

60°C

At1g55020

62°C

At2g37040

PP2A

1º Exon

2º Exon

0.99081

Ntubc2

4º Exon

5º Exon

0.99939

EF-1α

2º Exon

2º Exon

0.99988

Actin

Nt-ACT9

2º Exon

2º Exon

0.99826

Pathogenesisrelated 1a

PR-1a

Unique Exon

Unique Exon

0.97413

β-1,3-glucanases

PR-2

2º Exon

2º Exon

0.99001

Chitinase class I

PR-3

1º Exon

Thaumatin-like protein

PR-5

2º Exon

Peroxidase

NtPrxN1

2º Exon

Lipoxygenase

LOX1

1º Exon

Phenylalanine ammonia-lyase

NtPAL

2º Exon

M AN U 2º Exon

0.99486

2º Exon

0.99638

2º Exon

0.99251

2º Exon

0.92755

2º Exon

0.99577

TE D



1.06 ± 0.007 1.00 ± 0.011 1.01 ± 0.009 1.03 ± 0.012 1.03 ± 0.036 1.00 ± 0.021 1.02 ± 0.007 0.97 ± 0.064 1.02 ± 0.016

SC

Protein Phosphatase 2A Ubiquitinconjugating enzyme (E2) Elongation factor 1α

RI PT

Gene Name

Gene Symbol

Efficiency ± standard deviation (SD) generated by the Miner software. The correlation coefficient (R2) was calculated for each pair of primers using five 5-

AC C

triplicates.

EP

fold serial dilutions of the cDNA synthesised from one specific treatment in technical

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

RI PT

ACCEPTED MANUSCRIPT

ACCEPTED MANUSCRIPT Highlights Structural characterization of the peptidogalactomannan from Cladosporium herbarum by a combination of chemical and spectroscopic methods, including one and two-dimensional nuclear magnetic resonance (1D and 2D NMR) spectroscopic analysis, was performed.

RI PT

Tobacco BY-2 cells were used as a model system to address the question of the role of C.herbarum pGM in cell viability and induction of the expression of plant defenserelated genes. The biological relevance of the galactofuranose chains of C. herbarum pGM in the induction of the plant defense response was evaluated.

AC C

EP

TE D

M AN U

SC

Contact of intact pGM with N. tabacum leaves as well of C. herbarum conidia with N. tabacum roots were able to induce HR responses.

ACCEPTED MANUSCRIPT

AC C

EP

TE D

M AN U

SC

Conceptualization: BBM, CM, MFSV and EB-B. Formal analysis: BBM, CM, ER, TFS. Funding acquisition: MFSV and EB-B. Investigation: BBM, CM, ER, TFS, RB-B, FS-T, LMS, GLS. Methodology: BBM, CM, ER, TFS, RB-B, FS-T, LMS, GLS . Project administration: MFSV and EB-B. Resources: MFSV and EB-B. Supervision: MFSV and EB-B. Writing – original draft: BBM, MFSV and EB-B. Writing – review & editing: CM, ER, TFS, MFSV and EB-B.

RI PT

Author Contributions