β-catenin signaling pathway in colon cancer

β-catenin signaling pathway in colon cancer

Biomedicine & Pharmacotherapy 101 (2018) 414–421 Contents lists available at ScienceDirect Biomedicine & Pharmacotherapy journal homepage: www.elsev...

1MB Sizes 0 Downloads 137 Views

Biomedicine & Pharmacotherapy 101 (2018) 414–421

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha

A silyl andrographolide analogue suppresses Wnt/β-catenin signaling pathway in colon cancer

T

Somrudee Reabroia, Arthit Chairoungduaa,b, Rungnapha Saeengc, Teerapich Kasemsukd, ⁎ Witchuda Saengsawanga,b, Weiming Zhue, Pawinee Piyachaturawata, a

Department of Physiology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand Excellent Center for Drug Discovery (ECDD), Mahidol University, Bangkok 10400, Thailand c Department of Chemistry and Center for Innovation in Chemistry, Faculty of Science, Burapha University, Chonburi 20131, Thailand d Department of Chemistry, Faculty of Science and Technology, Rambhai Barni Rajabhat University, Chanthaburi 22000, Thailand e Key Laboratory of Marine Drugs, Ministry of Education of China, School of Medicine and Pharmacy, Ocean University of China, Qingdao 266003, China b

A R T I C L E I N F O

A B S T R A C T

Keywords: Andrographolide analogue Anti-cancer Colorectal cancer Wnt/β-catenin GSK-3β

Hyperactivation of Wnt/β-catenin signaling implicated in oncogenesis of colorectal cancer (CRC) is a potential molecular target for chemotherapy. An andrographolide analogue, 3A.1 (19-tert-butyldiphenylsilyl-8, 17-epoxy andrographolide) has previously been reported to be potently cytotoxic toward cancer cells by unknown molecular mechanisms. The present study explored the anti-cancer activity of analogue 3A.1 on Wnt/β-catenin signaling in colon cancer cells (HT29 cells) which were more sensitive to the others (HCT116 and SW480 cells). Analogue 3A.1 inhibited viability of HT29 cells with IC50 value of 11.1 ± 1.4 μM at 24 h, which was more potent than that of the parent andrographolide. Analogue 3A.1 also suppressed the proliferation of HT29 cells and induced cell apoptosis in a dose-dependent manner. Its apoptotic activity was accompanied with increased expressions of proteins related to DNA damages; PARP-1 and γ-H2AX. In addition, analogue 3A.1 significantly inhibited T-cell factor and lymphoid enhancer factor (TCF/LEF) promoter activity of Wnt/β-catenin signaling. Accordingly, the expressions of Wnt target genes and β-catenin protein were suppressed. Moreover, analogue 3A.1 increased the activity of GSK-3β kinase, which is a negative regulator responsible for degradation of intracellular β-catenin. This mode of action was further supported by the absence of the effects after treatment with a GSK-3β inhibitor, and over-expression of a mutant β-catenin (S33Y). Our findings reveal, for the first time, an insight into the molecular mechanism of the anti-cancer activity of analogue 3A.1 through the inhibition of Wnt/β-catenin/GSK-3β pathway and provide a therapeutic potential of the andrographolide analogue 3A.1 in CRC treatment.

1. Introduction Colorectal cancer (CRC) is one of the most common deadly gastrointestinal cancers found in both men and women in the United States [1]. The pathogenesis of CRC is complicated with the involvement of multiple signaling pathways [2,3]. Inappropriate activation of a canonical Wnt/β-catenin signaling is one of the key pathways driven for initiation and progression of CRC, and this pathway has been considered as one of the attractive targets for CRC therapy [2]. The mutations of Wnt components; APC, and β-catenin, are reported in colon cancer by 85%, and 15%, respectively [4,5]. These genetic alterations cause intracellular β-catenin to escape from degradation, subsequently

enable the constitutive Wnt transcription to promote oncogenic events [6] and hence limits the treatments [7]. The key player of Wnt/β-catenin signaling pathway is β-catenin protein [8]. In the absence of Wnt ligands, β-catenin is phosphorylated at residues Ser45/Ser33/Ser37/Ser41 by the destruction complex components including adenomatous polyposis coli (APC), axin2, casein kinase 1 (CK1) and glycogen synthase kinase-3β (GSK-3β) [9]. This marks cytosolic β-catenin for ubiquitination and degradation in a proteasome to keep β-catenin in low level. Binding of Wnt ligands with its receptor Frizzed (Fz) and a co-receptor low-density lipoprotein receptor related protein 5/6 (LRP5/6) triggers the dissociation of the destruction complex [10] and subsequently causes an accumulation of non-

Abbreviations: CRC, colorectal cancer; TBDPS, tert-butyldiphenylsilyl; GSK-3β, glycogen synthase kinase-3β; TCF/LEF, T-cell factor and lymphoid enhancer factor; PARP-1, poly (ADPribose) polymerase-1 ⁎ Corresponding author: Department of Physiology, Faculty of Science, Mahidol University, Rama 6 Road, Bangkok, 10400, Thailand. E-mail address: [email protected] (P. Piyachaturawat). https://doi.org/10.1016/j.biopha.2018.02.119 Received 10 January 2018; Received in revised form 16 February 2018; Accepted 23 February 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.

Biomedicine & Pharmacotherapy 101 (2018) 414–421

S. Reabroi et al.

phosphorylated β-catenin, which in turn translocate into the nucleus. The formation of the translocated β-catenin and TCF/LEF transcription factors inside the nucleus leads to transactivation of Wnt-responsive genes, including c-myc, cyclin D1, survivin, and MMP-7 that participate in promoting cancer proliferation, survival, and metastasis [11–14]. In addition to TCF4 in the nucleus, a cross-link of Wnt signaling to the expression of topoisomerase IIα (Topo-IIα) has been reported, and the overexpression of Topo-IIα enhances TCF/LEF transcription of Wnt signaling [15]. Topo-IIα is a nuclear enzyme that catalyzes topological conversion of DNA double strands, facilitating proper DNA replication and transcription [16,17]. High expression of Topo-IIα in colon tumor has been correlated to resistant to therapy with Topo-IIα inhibitors [18], suggesting that multiple targets of an anti-cancer agent rather than a single one is required for improving therapeutic effectiveness. As a complexity of colon tumorigenesis involves multiple pathways, it is, therefore, crucial to find more molecular targets for anti-cancer agents to effectively improve the responsiveness of patients to therapy. Andrographolide is a major diterpenoid isolated from Andrographis paniculata which has been widely studied because of its intrinsic cytotoxic property to cancer cells [19,20,21]. One of the mechanisms underlying apoptotic-promoting effect of andrographolide has been reported to mediate through induction of endoplasmic reticulum (ER) stress by increasing ROS levels [22] which then activates the activity of IRE-1, a proximal sensor related to unfolded protein response (UPR) of ER [23]. The accumulation of unfolded proteins caused by andrographolide-induced ER stress activates different signaling cascades and cellular responses such as caspase-mediated apoptosis, induction of cell cycle arrest, and inhibition of cell survival [22,23]. Based on accumulating evidence in anticancer activity of andrographolide, it is considered as a promising chemotherapeutic agent. Unfortunately, its potential use in clinic is limited by low potency and poor oral availability [24,25]. Structural modifications of andrographolide to improve the potency and efficacy for anti-cancer activities have received much interest. Recently, we have demonstrated that an andrographolide analogue 3A.1 (19-tert-butyldiphenylsilyl-8,17-epoxy andrographolide) was highly cytotoxic to a panel of mammalian cancer cell lines (CHO, HepG2, UISO-BCA1, Hela) including cholangiocarcinoma by inhibiting the activity of Topo-IIα [26,27,28]. However, other intracellular anticancer mechanisms of analogue 3A.1 on gastrointestinal cancer cells are largely unknown. As Wnt/β-catenin signaling is a critical pathway in regulating CRC proliferation, the present study investigated more specific molecular effects of analogue 3A.1 in HT29 (colorectal cancer) cells by targeting on Wnt/β-catenin signaling pathway. Herein, we demonstrated for the first time that the anti-cancer effect of analogue 3A.1 was associated with inhibition of Wnt/β-catenin signaling in HT29 cells and was essentially dependent on the kinase function of GSK-3β, a Wnt negative regulator.

2.2. Reagents and antibodies Andrographolide and the analogue 3A.1 were prepared by Asst. Prof. Dr. Rungnapha Saeeng as previously described [26]. The following reagents were used: Lipofectamine 2000 and TRIzol reagent (Invitrogen); Doxorubicin (Guanyu Bio-tech, Xi’an, China); 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and lithium chloride (Sigma); Annexin V-FITC apoptosis detection kit (BD Biosciences, SanJose, CA, USA); iScriptTM select cDNA synthesis kit (Bio-Rad, Hercules, CA, USA); SYBR Green kit (Applied Biosystem, Carlsbad, CA, USA); BCA protein assay kit, protease inhibitor cocktail, RIPA buffer, Super Signal West Pico Chemiluminescent Substrate (Thermo Scientific, Cramlington, UK), and phosphatase inhibitor cocktail (Millipore, Darmstadt, Germany). Andrographolide, analogue 3A.1, and doxorubicin were dissolved in DMSO as stock solutions at concentration 100 mM and stored in aliquots at −20 °C until use. The final concentration of DMSO (Sigma) in all treatments was less than 0.1%. The following antibodies were used: anti-β-catenin (Santa Cruz Biotechnology, CA, USA); anti-active-β-catenin (Millipore, Darmstadt, Germany); anti-phospho-GSK-3β (Ser9) and anti-GSK-3β (Cell Signaling Technology, Danvers, MA, USA); anti-β-actin (Sigma). The TCF/ LEF reporter plasmids (TOPflash, FOPflash), β-catenin-FLAG and mutant βcatenin S33Y plasmids were described previously [29]. 2.3. Cell viability assay Cells were plated into 96-well plates (1 × 104 cells/well) and treated with various concentrations of tested compounds for 24, 48 and 72 h. At the indicated periods, cell viability was assessed using MTT assay. The medium was removed and replaced with a serum-free medium containing MTT working solution and incubated for 4 h. Formazan product was dissolved with DMSO and the optical density was measured at 540 nm using a Multiskan™ GO Microplate Spectrophotometer (Thermo Scientific, Cramlington, UK) 2.4. Cell proliferation assay To investigate the effect on cell proliferation, BrdU incorporation assay was used. Cells were plated into 96-well plates (1 × 104 cells/ well) for 24 h, and treated with various concentrations of tested compounds for 24 h. After incubation, cells were added with BrdU labeling solution, fixed, and incubated with anti-BrdU peroxidase conjugated antibody using the cell proliferation ELISA BrdU kit (Roche, Mannheim, Germany) according to the manufacturer’s instructions. The reaction was stopped by 1 M H2SO4 and the absorbance was measured at a wavelength of 450 nm (reference wavelength: 690 nm) using the Multiskan™ GO Microplate Spectrophotometer (Thermo Scientific). 2.5. Flow cytometry analysis

2. Materials and methods For apoptosis analysis, cells were treated with tested compounds for 24 h. Then, cells were harvested by trypsinization, centrifuged and washed twice with PBS. Cell pellets were re-suspended in Annexin VFITC and PI (BD Biosciences) containing solution for 15 min in darkness. The different stages of cell death were analyzed by a BD FACS Calibur™ flow cytometer using BD FACS Diva software version 6.1.1 (BD Bioscience) for data analysis.

2.1. Cell culture Colorectal cancer (CRC); HT29, HCT116, and SW480, HEK293T (human embryonic kidney), and Chang liver (human normal liver) cells were obtained from the American Type Culture Collection (ATCC, USA). HT29 cells were maintained in Dulbecco’s modified Eagle’s medium: Nutrient Mix F-12 (DMEM/F12) (Sigma, St. Louis, MO, USA). HCT116 and SW480 cells were maintained in Dulbecco's modified Eagle’s medium (DMEM) (Invitrogen, Carlsbad, CA, USA). HEK293T and Chang liver cells were maintained in Minimum Essential Media (MEM) (Invitrogen, Carlsbad, CA, USA). All growth media were supplemented with 10% fetal bovine serum (FBS) (Hyclone, Perbio, UT, USA), 100 μg/ml penicillin, and 100 μg/ml streptomycin (Invitrogen). All cells were cultured at 37 °C in a humidified incubator with 5% CO2.

2.6. Luciferase reporter assay HEK293T cells were plated into 96-well plates (1 × 104 cells/well) for 18 h. Then, cells were transiently co-transfected with 0.1 μg pcDNA3.1 or β-catenin-FLAG or S33Y plasmid, 0.05 μg TOPflash or FOPflash reporter plasmid and 0.05 μg Renilla luciferase reporter plasmid for 24 h by using lipofectamine 2000 reagent according to the manufacturer’s instructions. Then, analogue 3A.1 at various 415

Biomedicine & Pharmacotherapy 101 (2018) 414–421

S. Reabroi et al.

Table 1 Lists of primer sequences used for real-time PCR. Gene

c-myc cyclin D1 survivin MMP-7 GAPDH

Sequences (5′-3′) Forward

Reverse

GCAGCGACTCTGAGGAGGAA GATCAAGTGTGACCCGGACTG TGAGAACGAGCCAGACTTGG TGGGAACAGGCTCAGGACTA ATGCCCCCATGTTCGTCATG

GGCCTCCAGCAGGCAGCACA CCTTGGGGTCCATGTTCTGC TGTTCCTCTATGGGGTCGTCA TGCATCTCCTTGAGTTTGGCT GCAGGAGGCATTGCTGAT

concentrations was added. After 24 h, cells were lysed and subjected for measuring a firefly luciferase activity using the Dual Luciferase Assay kit (Promega, Madison, WI, USA). The firefly luciferase activity in each treatment was normalized with Renilla luciferase activity as an internal control. 2.7. RNA extraction and real-time polymerase chain reaction Total RNA was isolated using the TRIzol reagent (Invitrogen). The purity of the extracted RNA was determined using NanoDrop 2000C (Thermo Scientific). cDNAs were synthesized by using iScript™ cDNA synthesis kit (Bio-Rad) according to the manufacturer’s protocol and stored at −20 °C until use. Real-time PCR of c-myc, cyclin D1, survivin, and MMP-7 were performed with SYBR Green kit and analyzed with ABI PRISM7500 sequence detection system and software provided (Applied Biosystems). A panel of PCR primer sequences were designed using NCBI/Primer-Blast as shown in Table 1. Samples were analyzed in triplicate and the gene expression was normalized with GAPDH. 2.8. Western blot Treated cells were harvested and lysed by using RIPA buffer supplemented with proteinase inhibitors and phosphatase inhibitor cocktail. Proteins were separated by 10% SDS-PAGE gel and transferred onto PVDF membranes (EMD Millipore, MA, USA). Blots were blocked with 5% nonfat dry milk for 1 h and probed overnight at 4 °C with primary antibody. The membranes were then incubated with specific secondary antibody for 1 h. The detection of the bands was developed using ECL reagent and imaged with Amersham HyperfilmTM (GE Healthcare). The densitometry analysis was performed by using ImageJ software. 2.9. Statistical analysis Fig. 1. Effects of analogue 3A.1 on the suppression of viability and proliferation of HT29 cells. (A) The chemical structures of andrographolide and analogue 3A.1. (B) Dose- and time-dependent inhibition of HT29 cell viability. Cells were treated with analogue 3A.1, a parent andrographolide, or doxorubicin for 24 h. Cell viability was assessed by using MTT assay. IC50 value is the concentration that inhibits 50% of cell proliferation. Each value is mean ± S.E.M from three independent experiments compared to vehicle control (0.1% DMSO). (C) The anti-proliferative effect on HT29 cells determined by BrdU incorporation after treatment with analogue 3A.1 for 24 h. Each value is mean ± S.E.M from at least three independent experiments and presented as % of control. **P < 0.05, **P < 0.01 significantly different from the vehicle control.

Data in each group were analyzed by using one-way ANOVA with Tukey’s post-hoc test. All statistical analyses were performed by using GraphPad Prism (version 5.01; GraphPad software). P-values < 0.05 and < 0.01 were considered statistically significant. 3. Results 3.1. Suppression of cell viability and proliferation Cytotoxicity of analogue 3A.1 was investigated in three colon cancer cell lines which are HT29, HCT116, and SW480 by using MTT viability assay. HT29 was found to be the most sensitive cell line to analogue 3A.1 with an IC50 value of 11.1 ± 1.4 μM at 24 h of treatment, whereas those of HCT116, and SW480 cells were at 16.1 ± 2.1 μM and 18.2 ± 2.9 μM, respectively. IC50 value of analogue 3A.1 on Chang liver cells (human normal liver cells) was 16.4 ± 1.5 μM. This indicates a higher selectivity of analogue 3A.1 to HT29 colon cancer cells, and it was used for further mechanistic study. Analogue 3A.1 decreased viability of HT29 colorectal cells in concentration- and time-dependent manners. IC50 values for HT29 cells at

24, 48, and 72 h were 11.1 ± 1.4, 4.7 ± 0.7, and 3.2 ± 0.3 μM, respectively. At 24 h, analogue 3A.1 exhibited greater cytotoxicity compared to its parent compound, andrographolide, and doxorubicin, of which IC50 were 46.1 ± 2.9, and 26.2 ± 1.2 μM, respectively (Fig. 1B). The effect of analogue 3A.1 on cell proliferation was further evaluated by using BrdU incorporation assay. As shown in Fig. 1C, analogue 3A.1 dose-dependently inhibited HT29 cell proliferation. The positive BrdU-incorporated cells were significantly decreased to 83.9 + 2.9%, 70.6 + 3.3%, and 51.5 + 7.4% in HT29-treated cells at 2.5, 5, and 416

Biomedicine & Pharmacotherapy 101 (2018) 414–421

S. Reabroi et al.

Fig. 2. Effect of analogue 3A.1 on the induction of apoptotic cell death and related proteins. (A) Representative flow cytometry analysis showing apoptosis in HT29 cells after treatment with analogue 3A.1 (5–10 μM) or doxorubicin (10 μM) for 24 h. After double-staining with Annexin V-FITC and PI, cells were subjected to flow cytometry. (B) Western blot representing the increased expressions of cleaved PARP-1 and γ-H2AX (Ser139) proteins in HT29 cells after treatment with analogue 3A.1 or doxorubicin (10 μM) for 24 h. β-actin serves as a loading control. (C-D) Bar graphs representing normalized band intensities of cleaved PARP-1 and γH2AX. Each value is mean ± S.E.M compared with the vehicle control (n = 3) (**P < 0.01).

10 μM, respectively. Of note, andrographolide at a concentration of 10 μM did not affect the numbers of BrdU-incorporated cells. These results indicate that analogue 3A.1 suppressed HT29 cell viability partly by inhibition of cell proliferation.

3.4. Inhibition of the expression of Wnt/β-catenin proteins As aberrant expression of intracellular β-catenin of Wnt is critical for CRC development, the effect of analogue 3A.1 on the expression of endogenous β-catenin protein was then examined. The results showed that, after 24 h of treatment, analogue 3A.1 markedly inhibited the expressions of β-catenin, both total and active forms (Fig. 4). This suggests that analogue 3A.1 has significant effects on downregulation of β-catenin phosphorylation and its expression. Taken together, the results further demonstrate that analogue 3A.1 exerts the inhibitory effect on Wnt/β-catenin signaling pathway by attenuating β-catenin activity and protein expression.

3.2. Induction of apoptotic cell death and the related proteins In addition to suppression of cell proliferation, whether the cytotoxicity of analogue 3A.1 is also involved with induction of apoptotic cell death and changes in the related proteins were further evaluated. Indeed, treatment with analogue 3A.1 for 24 h increased number apoptotic cells in both early and late phases. However, the significant effect was found at the concentration of 10 μM, which was less than that of doxorubicin, a positive control, at the same concentration. Proteins that are activated for repairing DNA strand breaks upon the cellular apoptosis were measured. A nuclear enzyme poly (ADP-ribose) polymerase-1 or PARP-1, which catalyzes repairing of single-strand DNA breaks [30] was examined. Analogue 3A.1 (2.5–10 μM) induced dose-dependent increases of cleaved PARP-1 (Fig. 2B and C). Moreover, a phosphorylation of DNA damage of a histone variant H2AX at ser139 (γ-H2AX) by protein kinases, which promotes the recruitment of DNA repairing proteins [31], was also up-regulated by analogue 3A.1 at 24 h of post-treatment (Fig. 2B, D). Altogether, the results strongly indicate that analogue 3A.1 essentially induced apoptotic cell death with profound increases in the markers of DNA damage and repairing proteins in HT29 cells.

3.5. Suppression of Wnt/β-catenin signaling through a GSK-3β-dependent mechanism The stability of β-catenin protein is a crucial determinant of the degree of Wnt activation. Phosphorylation of GSK-3β at serine 9 by kinases causes GSK-3β inactivation and leads to the stabilization of βcatenin. To investigate the underlying mechanism of analogue 3A.1mediated reduction of β-catenin protein, the effects on the activity and expression of GSK-3β were determined. After incubation for 24 h, analogue 3A.1 decreased the expression of phosphorylated GSK-3β (Ser9) whereas it did not affect total GSK-3β protein expression (Fig. 5A and B), suggesting that the inhibitory effect of analogue 3A.1 is on the kinase activity of GSK-3β. As N-terminal phosphorylation of β-catenin at Ser33/37/Thr41 that marks β-catenin for degradation is catalyzed by GSK-3β, such an effect of analogue 3A.1 was further confirmed by treatment with lithium chloride (LiCl), a GSK-3β inhibitor. As shown in Fig. 5C, LiCl induced an increase in active β-catenin compared with untreated HT29 cells. In addition, LiCl abolished the suppressive effect of analogue 3A.1 on the expression of active β-catenin. Since a mutant β-catenin (S33Y) is a constitutively active β-catenin, which is resistant to GSK-3β-mediated phosphorylation, the suppressive effect of analogue 3A.1 on transcriptional activity of S33Y compared with wild-type β-catenin was examined. As depicted in Fig. 5D, S33Y-transfected cells exhibited higher luciferase activity than that of the wild-type β-catenin. However, analogue 3A.1 failed to decrease the transcriptional activity of β-catenin in the S33Y-overexpressing HEK293T cells. Taken together, these data suggest that an induction of β-catenin degradation by analogue 3A.1 occurs via GSK-3β-dependent pathway.

3.3. Inhibition of TCF/LEF reporter activity and expression of downstream target genes of Wnt/β-catenin signaling pathway The effect of analogue 3A.1 on the transcriptional activity and expression of downstream target genes of Wnt signaling were determined. To investigate TCF/LEF promoter activity of β-catenin, the TOPflash luciferase reporter gene assay was used. As illustrated in Fig. 3A, the TOPflash luciferase activity in the β-catenin-overexpressing HEK293T cells was significantly inhibited by analogue 3A.1 compared with control, whilst the luciferase activity of FOPflash, a mutant of TCF/LEF binding site for β-catenin, was not affected. This indicates the suppressive function of analogue 3A.1 on Wnt transcriptional activity. In addition, the expression of Wnt target genes; c-myc, cyclin D1, survivin, and MMP-7, which play the important role in CRC progression, were dose-related decreased in analogue 3A.1-treated HT29 cells (Fig. 3B and E). Together, these findings suggest that the inhibitory action of analogue 3A.1 in Wnt/β signaling pathway is at the transcriptional level.

4. Discussion The present study demonstrated that an andrographolide analogue 3A.1 exhibited an anti-cancer activity in HT29 cells, which was associated with the inhibition of Wnt/β-catenin signaling pathway. It reduced the transcriptional activity of β-catenin, expressions of Wnt 417

Biomedicine & Pharmacotherapy 101 (2018) 414–421

S. Reabroi et al.

Fig. 3. Inhibitory effects of analogue 3A.1 on TCF/ LEF reporter activity and expression of downstream target genes of Wnt/β-catenin signaling pathway. (A) HEK293T cells were transiently transfected with βcatenin-FLAG or pcDNA3.1, and TOPflash or FOPflash, and Renilla luciferase reporter plasmids. After transfection, cells were incubated with analogue 3A.1 for 24 h. The relative firefly luciferase activity units (RLUs) were then measured and normalized corresponding to Renilla luciferase activity. Results are expressed as the fold change compared with β-catenin-transfected cells and represented as mean ± S.E.M (n = 3) (**P < 0.01). Quantitative real-time PCR showing the concentration-dependent reduction in mRNA expression of Wnt target genes: (B) c-myc, (C) cyclin D1, (D) survivin, and (E) MMP7 in HT29 cells after treatment with analogue 3A.1 for 24 h. The relative mRNA expression was quantified and normalized with GAPDH. Data are mean ± S.E.M compared with the vehicle control (n = 3) (*P < 0.05, **P < 0.01).

target genes, and the accumulation of β-catenin protein. The underlying mechanism was likely mediated by activation of kinase function of GSK3β that eventually led to the degradation of β-catenin inside the cells. As analogue 3A.1 possesses an inhibitory activity on DNA Topo-IIα [27,28], a transcription co-factor of the β-catenin/T-cell factor-4 (TCF4) nuclear complex [15], the inhibition on both Topo-IIα and β-catenin by this compound would provide more therapeutic effectiveness on colon cancer with aberrant Wnt/β-catenin activity. To our knowledge, this is the first report on the inhibition of a silyl andrographolide

analogue on Wnt/β-catenin signaling. Previously we have reported that andrographolide analogue 3A.1 inhibited DNA Topo-IIα expression and induced apoptotic cell death in CHO cells and cholangiocarcinoma [27,28]. Interestingly, viability of CHO cells, which is insensitive to etoposide treatment, a Topo-IIα inhibitor, was markedly suppressed by analogue 3A.1 [27]. Of note, a number of studies on the anti-cancer andrographolide and its analogues mostly reported their activities through the induction of cell cycle arrest and caspase-mediated cell death mechanisms [32,33,34]. Importantly,

Fig. 4. Inhibition of the expression of Wnt/β-catenin proteins by analogue 3A.1. (A) Western blot representing the expressions of total and active forms of β-catenin protein in HT29 cells after treatment with analogue 3A.1 for 24 h. β-actin serves as a loading control. (B-C) Bar graphs representing the normalized band intensities of total and the active forms of β-catenin to β-actin. Data are mean ± S.E.M compared with the vehicle control (n = 3) (**P < 0.01).

418

Biomedicine & Pharmacotherapy 101 (2018) 414–421

S. Reabroi et al.

Fig. 5. Suppression of Wnt/β-catenin signaling through a GSK-3β-dependent mechanism by analogue 3A.1. (A) Western blot representing the decrease in expression of phosphorylated GSK-3β (Ser9) protein in HT29 cells after treatment with analogue 3A.1 for 24 h. β-actin serves as a loading control. (B) Bar graph representing normalized band intensity of the phosphorylated GSK-3β to β-actin. Data are mean ± S.E.M compared with the vehicle control (n = 3) (**P < 0.01). (C) Western blot representing expressions of total and the active forms of β-catenin in HT29 cells after pretreatment with 30 mM LiCl for 15 h, followed by treatment with analogue 3A.1 for another 24 h. β-actin serves as a loading control. (D) HEK293T cells were transiently transfected with a plasmid of wild-type β-catenin (β-catenin-FLAG) or a constitutively active β-catenin mutant (S33Y), TOPflash, and Renilla luciferase reporter plasmids. After transfection, cells were incubated with analogue 3A.1 for 24 h. The relative firefly luciferase activity units (RLUs) were then measured and normalized corresponding to Renilla luciferase activity. Data are expressed as the fold change compared with pcDNA3.1-transfected cells and represented as mean ± S.E.M (n = 3).

analogue 3A.1 abrogates Wnt/β-catenin signaling by increasing GSK-3β activity as one of its potential molecular targets. Our results are in agreement with the earlier studies on other anti-cancers that attenuated Wnt signaling through the activation of Wnt destruction complex and promoting β-catenin degradation [38,39]. The decreased intracellular β-catenin caused by analogue 3A.1 coincided with the reduction of TCF/LEF activity and down regulations of Wnt target genes, which are responsible for cell cycle progression (c-myc, cyclin D1) and tumorigenesis (survivin and MMP-7). All of these results strongly support our notion that the anti-cancer activity of analogue 3A.1 in HT29 cells occurs via an inhibition of Wnt signaling. This analogue may be applicable for the treatment of most colon cancer cells carrying APC mutation, which are resistant to therapy with chemotherapeutic agents. An essential hallmark of colon cancer development is the acquisition of a proliferative phenotype which is associated with dysregulated Wnt signaling. We have shown in this study that analogue 3A.1 is able to cause decreases in cell viability and proliferation, and an increased apoptotic cell death. Further, the induction of DNA damage, which is a characteristic of apoptosis, was accompanied by the increased expressions of PARP-1 and γ-H2AX, two important proteins that are recruited at the sites of DNA strand breaks to facilitate the repairing process. Structurally, the cytotoxicity of andrographolide is associated with its α-alkylidene γ-butyrolactone moiety, which acts as a Michael acceptor and is capable of reacting with biomolecules of the cells such as DNA and proteins [40]. The introductions of a silicon-base functional group tert-butyldiphenylsilyl (TBDPS) at C-19 and epoxidation at C-8 and C-17 of analogue 3A.1 are essential to augment cytotoxicity of andrographolide [26]. LogP value, which indicates lipophilicity of analogue 3A.1, was increased approximately 5-folds over the parent andrographolide (the Molinspiration online property calculation toolkit available at http://www.molinspiration.com). This might improve the penetrating ability across phospholipid of plasma membrane to

there has been no report in colon cancer cells to define the cellular targets and related molecular mechanisms, in spite of the well-defined notion that aberrant Wnt/β signaling is associated with oncogenicity of CRC [5]. This pathway is, therefore, of interest in the present study. Recently, the functional interactions between Wnt components, β-catenin and TCF4, and Topo-IIα have been reported in colon cancer. For examples, an inhibition of Topo-IIα decreased β-catenin transcription activity and metastatic phenotypes of cancer cells [15,35]. The expression of nuclear β-catenin and DNA Topo-IIα were found to be colocalized in patients with colon cancer. In addition, the catalytic activity of Topo-IIα is augmented by overexpression of β-catenin [15]. Based on these functional relationships, our finding on the inhibition of multiple targets of both Wnt/β signaling and Topo-IIα activity [27,28] would provide a superior approach for treatment of tumors with the complicated signaling network, including CRC. One of the important functions of Topo-IIα is unwinding supercoiled DNA and providing the binding sites for transcription factors to activate gene transcription [36]. Although analogue 3A.1 suppresses transcriptional activities and protein expression of Wnt signaling, it is not clear whether this was resulted from the inhibition of Topo-IIα activity or the alteration in protein-protein interactions between Topo-IIα and Wnt components. Given that genetic mutations of Wnt signaling lead to the accumulation of β-catenin and development of colon cancer [37], an inhibition of signal transduction in this pathway is considerably attractive for developing anti-cancer agents. In canonical Wnt signaling, the degradation of intracellular β-catenin is caused by the ultimate activation of GSK-3β, a Wnt negative regulator [9]. One prominent finding in the present study is the activation of kinase activity of GSK-3β induced by analogue 3A.1 (Fig. 5). The reduction of phosphorylation of GSK-3β (Ser9), which indicates GSK-3β inactivation, without affecting total GSK-3β expression was observed after treatment with analogue 3A.1 in HT29 cells that have a mutation in APC. This result suggests that 419

Biomedicine & Pharmacotherapy 101 (2018) 414–421

S. Reabroi et al.

effectively kill cancer cells [28]. As it has previously been reported that the apoptotic activity of andrographolide is associated with the production of ROS and induction of ER stress [22,23], the extent to which analogue 3A.1 induces ER stress is not clear in the present study. The detail molecular mechanisms of analogue 3A.1 in inducing ER stress and how it interacts with its target of Wnt/β-catenin signaling, TCF-4 and Topo IIα await further study.

[12] M. Shtutman, J. Zhurinsky, I. Simcha, C. Albanese, M. D’Amico, R. Pestell, A. BenZe’ev, The cyclin D1 gene is a target of the β-catenin/LEF-1 pathway, Proc. Natl. Acad. Sci. U. S. A. 96 (10) (1999) 5522–5527. [13] H.C. Crawford, B.M. Fingleton, L.A. Rudolph-Owen, K.J.H. Goss, B. Rubinfeld, P. Polakis, L.M. Matrisian, The metalloproteinase matrilysin is a target of β-catenin transactivation in intestinal tumors, Oncogene 18 (1999) 2883–2891. [14] T. Zhang, T. Otevrel, Z. Gao, Z. Gao, S.M. Ehrlich, J.Z. Fields, B.M. Boman, Evidence that APC regulates survivin expression, Cancer Res 61 (24) (2001) 8664–8667. [15] L. Huang, M. Shitashige, R. Satow, K. Honda, M. Ono, J. Yun, A. Tomida, T. Tsuruo, S. Hirohashi, T. Yamada, Functional interaction of DNA topoisomerase IIα with the β-catenin and T-cell factor-4 complex, Gastroenterology 133 (2007) 1569–1578. [16] J.L. Nitiss, Targeting DNA topoisomerase II in cancer chemotherapy, Nat. Rev. Cancer 9 (5) (2009) 338–350. [17] S.M.V. de Almeida, A.G. Ribeiro, G.C. de Lima Silva, J.E. Ferreira Alves, E.I.C. Beltrao, J.F. de Oliveira, L.B.J. de Carvalho, M.D.C. Alves de Lima, DNA binding and topoisomerase inhibition: how can these mechanisms be explored to design more specific anticancer agents, Biomed. Pharmacother. 96 (2017) 1538–1556. [18] N. Tsavaris, A. Lazaris, C. Kosmas, P. Gouveris, N. Kavantzas, P. Kopterides, T. Papathomas, G. Arapogiannis, H. Zorzos, V. Kyriakou, E. Patsouris, Topoisomerase I and IIα protein expression in primary colorectal cancer and recurrences following 5-fluorouracil-based adjuvant chemotherapy, Cancer Chemother. Pharmacol. 64 (2009) 391–398. [19] S. Nanduri, V.K. Nyavanandi, S.S. Thunuguntla, S. Kasu, M.K. Pallerla, P.S. Ram, S. Rajagopal, R.A. Kumar, R. Ramanujam, J.M. Babu, K. Vyas, A.S. Devi, G.O. Reddy, V. Akella, Synthesis and structure-activity relationships of andrographolide analogues as novel cytotoxic agents, Bioorg. Med. Chem. Lett. 14 (18) (2004) 4711–4717. [20] S.R. Jada, G.S. Subur, C. Matthews, A.S. Hamzah, N.H. Lajis, M.S. Saad, M.F. Stevens, J. Stanslas, Semisynthesis and in vitro anticancer activities of andrographolide analogues, Phytochemistry 68 (6) (2007) 904–912. [21] J.C. Lim, T.K. Chan, D.S. Ng, S.R. Sagineedu, J. Stanslas, W.S. Wong, Andrographolide and its analogues: versatile bioactive molecules for combating inflammation and cancer, Clin. Exp. Pharmacol. Physiol. 39 (3) (2012) 300–310. [22] A. Banerjee, V. Banerjee, S. Czinn, T. Blanchard, Increased reactive oxygen species levels cause ER stress and cytotoxicity in andrographolide treated colon cancer cells, Oncotarget 8 (16) (2017) 26142–26153. [23] A. Banerjee, H. Ahmed, P. Yang, S.J. Czinn, T.G. Blanchard, Endoplasmic reticulum stress and IRE-1 signaling cause apoptosis in colon cancer cells in response to andrographolide treatment, Oncotarget 7 (27) (2016) 41432–41444. [24] A. Panossian, A. Hovhannisyan, G. Mamikonyan, H. Abrahamian, E. Hambardzumyan, E. Gabrielian, G. Goukasova, G. Wikman, H. Wagner, Pharmacokinetic and oral bioavailability of andrographolide from Andrographis paniculata fixed combination Kan Jang in rats and human, Phytomedicine 7 (5) (2000) 351–364. [25] L. Ye, T. Wang, L. Tang, W. Liu, Z. Yang, J. Zhou, Z. Zheng, Z. Cai, M. Hu, Z. Liu, Poor oral bioavailability of a promising anticancer agent andrographolide is due to extensive metabolism and efflux by P-glycoprotein, J. Pharm. Sci. 100 (11) (2011) 5007–5017. [26] U. Sirion, S. Kasemsook, K. Suksen, P. Piyachaturawat, A. Suksamrarn, R. Saeeng, New substituted C-19-andrographolide analogues with potent cytotoxic activities, Bioorg. Med. Chem. Lett. 22 (1) (2012) 49–52. [27] J. Nateewattana, R. Saeeng, S. Kasemsook, K. Suksen, S. Dutta, S. Jariyawat, A. Chairoungdua, A. Suksamrarn, P. Piyachaturawat, Inhibition of topoisomerase II alpha activity and induction of apoptosis in mammalian cells by semi-synthetic andrographolide analogues, Invest. New Drugs 31 (2) (2013) 320–332. [28] J. Nateewattana, S. Dutta, S. Reabroi, R. Saeeng, S. Kasemsook, A. Chairoungdua, J. Weerachayaphorn, S. Wongkham, P. Piyachaturawat, Induction of apoptosis in cholangiocarcinoma by an andrographolide analogue is mediated through topoisomerase II alpha inhibition, Eur. J. Pharmacol. 723 (2014) 148–155. [29] K. Bhukhai, K. Suksen, N. Bhummaphan, K. Janjorn, N. Thongon, D. Tantikanlayaporn, P. Piyachaturawat, A. Suksamrarn, A. Chairoungdua, A phytoestrogen diarylheptanoid mediates ER/Akt/GSK-3β protein-dependent activation of the Wnt/β-catenin signaling pathway, J. Biol. Chem. 287 (43) (2012) 36168–36178. [30] M. Rouleau, A. Patel, M.J. Hendzel, S.H. Kaufmann, G.G. Poirier, PARP inhibition: PARP1 and beyond, Nat. Rev. Cancer 10 (2010) 293–301. [31] J. Yuan, R. Adamski, J. Chen, Focus on histone variant H2AX: to be or not to be, FEBS Lett. 584 (17) (2010) 3717–3724. [32] S.R. Jada, C. Matthews, M.S. Saad, A.S. Hamzah, N.H. Lajis, M.F.G. Stevens, J. Stanslas, Benzylidene derivatives of andrographolide inhibit growth of breast and colon cancer cells in vitro by inducing G1 arrest and apoptosis, Br. J. Pharmacol. 155 (5) (2008) 641–654. [33] B. Das, C. Chowdhury, D. Kumar, R. Sen, R. Roy, P. Das, M. Chatterjee, Synthesis, cytotoxicity, and structure-activity relationship (SAR) studies of andrographolide analogues as anti-cancer agent, Bioorg. Med. Chem. Lett. 20 (23) (2010) 6947–6950. [34] H.C. Wong, C.C. Wong, S.R. Sagineedu, S.C. Loke, N.H. Lajis, J. Stanslas, SRJ23, a new semisynthetic andrographolide derivative: in vitro growth inhibition and mechanisms of cell cycle arrest and apoptosis in prostate cancer cells, Cell Biol. Toxicol. 30 (5) (2014) 269–288. [35] Q. Zhou, A.D. Abraham, L. Li, A. Babalmorad, S. Bagby, J.J. Arcaroli, R.J. Hansen, F.A. Valeriote, D.L. Gustafson, J. Schaack, W.A. Messersmith, D.V. LaBarbera, Topoisomerase II alpha mediates TCF-dependent epithelial-mesenchymal transition in colon cancer, Oncogene 35 (38) (2016) 4990–4999. [36] S.M. Vos, E.M. Tretter, B.H. Schmidt, J.M. Berger, All tangled up: how cells direct,

5. Conclusion In summary, our results reveal insights into the anti-cancer activity of andrographolide analogue 3A.1 in HT29 colon cancer cells. The compound inhibited Wnt/β-catenin signaling through GSK-3β-dependent pathway and suppressed the expressions of Wnt target genes responsible for cell cycle progression and tumorigenesis resulting in inhibition of cell viability and proliferation, and subsequently apoptosis. In view of the multiple molecular targets of the analogue 3A.1 on colon cancer cells, this compound provides a promising approach for future development of chemotherapeutic agents for tumors with hyperactivated Wnt signaling. Conflict of interest The authors declare no conflict of interest in this work. Additional information This work has no competing financial interests. Acknowledgements This research project was supported by the Thailand Research Fund (TRF) through the Royal Golden Jubilee Ph.D. Program (PHD/0193/ 2553 to PP and SR), the research grants through the International Research Network (IRN-58W0004), National Natural Science Foundation of China (NSFC) project no. 81561148012, and Mahidol University. We are grateful to Dr. Chumpol Pholpramool for his critical comment on the manuscript. References [1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, CA Cancer J. Clin. 67 (1) (2017) 7–30. [2] J.N. Anastas, R.T. Moon, Wnt signalling pathways as therapeutic targets in cancer, Nat. Rev. Cancer 13 (2012) 11–26. [3] V. Das, J. Kalita, M. Pal, Predictive and prognostic biomarkers in colorectal cancer: a systematic review of recent advances and challenges, Biomed. Pharmacother. 87 (2017) 8–19. [4] P.J. Morin, A.B. Sparks, V. Korinek, N. Barker, H. Clevers, B. Vogelstein, K.W. Kinzler, Activation of β-catenin-Tcf signaling in colon cancer by mutations in β-catenin or APC, Science 275 (1997) 1787–1790. [5] P. Polakis, Wnt signaling in cancer, Cold Spring Harb. Perspect. Biol. 4 (5) (2012) 1–13. [6] H. Clevers, R. Nusse, Wnt/β-catenin signaling and disease, Cell 149 (6) (2012) 1192–1205. [7] S.P. Tenbaum, P. Ordonez-Moran, I. Puig, I. Chicote, O. Arques, S. Landolfi, Y. Fernandez, J.R. Herance, J.D. Gispert, L. Mendizabal, S. Aguilar, S. Ramon y Cajal, S. Schwartz Jr., A. Vivancos, E. Espin, S. Rojas, J. Baselga, J. Tabernero, A. Munoz, H.G. Palmer, β-catenin confers resistance to PI3K and AKT inhibitors and subverts FOXO3a to promote metastasis in colon cancer, Nat. Med. 18 (2012) 892–901. [8] A. Klaus, W. Birchmeier, Wnt signalling and its impact on development and cancer, Nat. Rev. Cancer 8 (5) (2008) 387–398. [9] J.R. Miller, A.M. Hocking, J.D. Brown, R.T. Moon, Mechanism and function of signal transduction by the Wnt/β-catenin and Wnt/Ca2+ pathways, Oncogene 18 (55) (1999) 7860–7872. [10] X. Zeng, H. Huang, K. Tamai, X. Zhang, Y. Harada, C. Yokota, K. Almeida, J. Wang, B. Doble, J. Woodgett, A. Wynshaw-Boris, J.C. Hsieh, X. He, Initiation of Wnt signaling: control of Wnt coreceptor Lrp6 phosphorylation/activation via frizzled, dishevelled and axin functions, Development 135 (2) (2008) 367–375. [11] T.C. He, A.B. Sparks, C. Rago, H. Hermeking, L. Zawel, L.T. da Costa, P.J. Morin, B. Vogelstein, K.W. Kinzler, Identification of c-myc as a target of the APC pathway, Science 281 (5382) (1998) 1509.

420

Biomedicine & Pharmacotherapy 101 (2018) 414–421

S. Reabroi et al.

J.A. Porter, A. Bauer, F. Cong, Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling, Nature 461 (2009) 614. [39] N. Boonmuen, N. Thongon, A. Chairoungdua, K. Suksen, W. Pompimon, P. Tuchinda, V. Reutrakul, P. Piyachaturawat, 5-Acetyl goniothalamin suppresses proliferation of breast cancer cells via Wnt/β-catenin signaling, Eur. J. Pharmacol. 791 (2016) 455–464. [40] M. Gersch, J. Kreuzer, S.A. Sieber, Electrophilic natural products and their biological targets, Nat. Prod. Rep. 29 (6) (2012) 659–682.

manage and exploit topoisomerase function, Nat. Rev. Mol. Cell Biol. 12 (12) (2011) 827–841. [37] K.W. Kinzler, B. Vogelstein, Lessons from hereditary colorectal cancer, Cell 87 (2) (1996) 159–170. [38] S.M.A. Huang, Y.M. Mishina, S. Liu, A. Cheung, F. Stegmeier, G.A. Michaud, O. Charlat, E. Wiellette, Y. Zhang, S. Wiessner, M. Hild, X. Shi, C.J. Wilson, C. Mickanin, V. Myer, A. Fazal, R. Tomlinson, F. Serluca, W. Shao, H. Cheng, M. Shultz, C. Rau, M. Schirle, J. Schlegl, S. Ghidelli, S. Fawell, C. Lu, D. Curtis, M.W. Kirschner, C. Lengauer, P.M. Finan, J.A. Tallarico, T. Bouwmeester,

421