Androgenetic alopecia in heterozygous carriers of a mutation in the human hairless gene

Androgenetic alopecia in heterozygous carriers of a mutation in the human hairless gene

Androgenetic alopecia in heterozygous carriers of a mutation in the human hairless gene Eli Sprecher, MD, PhD,a,b Adel Shalata, MD,a,c Kamal Dabhah, M...

199KB Sizes 1 Downloads 232 Views

Androgenetic alopecia in heterozygous carriers of a mutation in the human hairless gene Eli Sprecher, MD, PhD,a,b Adel Shalata, MD,a,c Kamal Dabhah, MD,d Boris Futerman,e Shai Lin, MD,e Raymonde Szargel, MSc,a Reuven Bergman, MD,b Rachel Friedman-Birnbaum, MD,b and Nadine Cohen, PhDa Haifa and Deir El Assad, Israel Background: Androgenetic alopecia is considered to be genetically determined. Recently, a rare autosomal recessive form of hereditary alopecia, termed atrichia with papular lesions (APL), was found to result from mutations in the human hairless gene. Objective: Our aim was to assess the pattern of androgenetic alopecia in heterozygous carriers of a deleterious mutation in the human hairless gene. Methods: Healthy male second-degree relatives (n = 31) of patients affected with APL and belonging to a large consanguineous kindred were interviewed and given a Hamilton score of baldness. DNA was obtained from each subject and analyzed for the presence of a mutation in the human hairless gene known to affect this family. The age at onset and extent of baldness were compared in healthy homozygotes and heterozygous carriers of the mutation. Results: Statistical analysis of the results revealed no differences in age at onset and extent of androgenetic alopecia between the two groups of subjects. Conclusion: The present study reports the first attempt to characterize the phenotype of heterozygous carriers of a mutation in the human hairless gene. It indicates that the presence of a deleterious mutation in one allele of the hairless gene does not affect the pattern of androgenetic hair loss. (J Am Acad Dermatol 2000;42:978-82.)

A

lthough mostly vestigial, human hair is known to be tremendously important in the perception and maintenance of self-image. Hair loss is therefore experienced by many as a detrimental event of great social and personal consequences.1,2 The most common form of baldness, androgenetic alopecia (AGA), is thought to result from the activation of a developmental program controlled From the Department of Genetics, Tamkin Human Molecular Genetics Research Facility, Technion-Israel Institute of Technology, Bruce Rappaport Faculty of Medicine, Haifaa; the Departments of Dermatology,b Pediatric Surgery,c and Epidemiology,e Rambam Medical Center, and Technion-Israel Institute of Technology, Bruce Rappaport Faculty of Medicine, Haifa; and Kupat Holim Klalit, Deir El Assad.d Supported by a grant from the Technion Research and Development Foundation (to N. C.). Accepted for publication Oct 14, 1999. Reprint requests: Nadine Cohen, PhD, Department of Genetics, Tamkin Human Molecular Genetics Research Facility, TechnionIsrael Institute of Technology, Bruce Rappaport Faculty of Medicine, POB 9649, Haifa 31096, Israel. Copyright © 2000 by the American Academy of Dermatology, Inc. 0190-9622/2000/$12.00 + 0 16/1/103628 doi:10.1067/mjd.2000.103628

978

either by a number of genes or by a single gene inherited in an autosomal dominant fashion with variable penetrance.3 In addition, hormonal and environmental factors are likely to be involved in determining the time of onset and extent of this form of alopecia.1-3 AGA results from the transformation of terminal hair follicles into vellus hair follicles with successive hair cycles producing hair of shorter length and smaller diameter. Androgens are thought to induce the miniaturization of the pigmented terminal hairs on the scalp into nonpigmented vellus hairs. Genetic factors predispose an individual to the effects of androgenic hormones.1-3 A genetic analysis of the 5-α reductase genes in bald subjects did not, however, reveal any association with AGA.4 Atrichia with papular lesions (APL) (OMIM 209500) is a rare form of inherited alopecia, characterized by hair loss a few months after birth and the development, years later, of a diffuse papular rash covering most parts of the body.5-12 We recently described a large consanguineous kindred affected by APL.12 We mapped the gene associated with APL to the short arm of chromosome 8 in this kindred12

J AM ACAD DERMATOL VOLUME 42, NUMBER 6

Sprecher et al 979

Fig 1. PCR-RFLP of the hairless gene exon 18. DNA samples obtained from patient affected with APL (lane 1) and 3 of his relatives were amplified with a primer pair encompassing exon 18.13 Amplified fragments were digested with BsaI and analyzed on agarose gel. Healthy homozygotes (lanes 3, 4) demonstrate two fragments of 158 bp and 247 bp. A heterozygous carrier of the 3434delC mutation displays both these fragments and an undigested 405 bp fragment (lane 2).

and thereafter identified a frameshift mutation in the human hairless gene that was found to segregate with the disease trait throughout the affected family.13 This mutation, termed 3434delC, was localized in exon 18 of the gene and predicted to result in the premature termination of the hairless protein. All heterozygous carriers of the mutation were found to lack the clinical features of APL.12 However, some of them displayed a characteristic pattern of AGA (unpublished data). Mutations in the hairless gene were also found in families affected by a related form of alopecia, named alopecia universalis congenita (OMIM 203655), in which the peculiar papular rash of APL is absent.14,15 As summarized elsewhere,16 each of these two forms of congenital alopecia was found to be associated with a different type of mutation: the papular phenotype was found to result from frameshift/nonsense mutations in the hairless gene, whereas the nonpapular phenotype was shown to be associated with missense mutations. The existence of phenotypic heterogeneity among inherited atrichias associated with mutations at the hairless locus suggests that this gene product may be involved in other more common forms of baldness. Because the hairless gene was shown to play a major role in the control of hair growth,17 we sought to assess the effect of carrying a deleterious mutation in the human hairless gene on the development of AGA in healthy members of a consanguineous APL kindred previously described.12

MATERIAL AND METHODS Subjects We identified 51 male, adult, healthy seconddegree relatives of patients affected with APL in a large consanguineous kindred previously described.12 A total of 31 subjects gave informed consent for blood sampling according to a protocol reviewed and approved by the local Helsinki committee. All subjects were interviewed at the time of blood sampling. They were asked for personal data, medical history, current medications, nutritional habits, and age at onset of AGA. They subsequently underwent a general and dermatologic examination and were given a baldness score according to the Hamilton-Norwood scale.18 PCR-RFLP in exon 18 DNA was prepared by standard methods.19 To detect the 3434delC mutation, DNA was amplified with primers INT17F1-5´CTCTCCAGCAGTTCTGAGTC3´and INT18R1-5´GATCTGCTATGTCCACTGC3´, using Taq DNA polymerase (Promega). Polymerase chain reaction conditions were as follows: denaturation at 94° for 2 minutes; 35 subsequent amplification cycles performed at 94° for 30 seconds, at 55° for 30 seconds and at 72° for 30 seconds; 1 final step at 72° for 7 minutes. The resulting 405 bp DNA fragment, encompassing exon 18, was then digested with BsaI (New England Biolabs). DNA fragments were analyzed by electrophoresis on 2% agarose gels as previously described.13 Because the 3434delC mutation abolishes a BsaI site in the ampli-

980 Sprecher et al

J AM ACAD DERMATOL JUNE 2000

Fig 2. Scatter plot of age at onset of AGA in healthy homozygotes and heterozygous carriers of 3434delC mutation (solid line: mean age at onset in homozygotes; dotted line: mean age at onset in heterozygotes).

fied fragment, heterozygotes display an undigested 405 bp fragment and two smaller fragments of 247 bp and 158 bp. In contrast, in healthy homozygotes, only the two smaller fragments are found (Fig 1). Statistical analysis Using the screening data, two subgroups were compared: healthy heterozygotes (cases) and healthy homozygotes (controls). All statistical analyses were performed by means of the SPSS 8.0 software.20 The parameters collected in the questionnaire and in the physical examination were analyzed as dependent variables for the occurrence of alopecia. Differences in age at onset of AGA and AGA score were analyzed by means of the Mann-Whitney test. In addition, to control for age, Hamilton scores were corrected according to: [(Score-1)/(Age-Age at onset)] × 10. Kaplan-Meier curves were used to compare the age at onset of AGA in the groups.20

RESULTS A total of 31 DNA samples were collected. Among those samples, 9 subjects were found to carry the mutation in a heterozygous state and 22 were found to be healthy homozygotes. Those numbers reflect

the expected incidence of heterozygous subjects among a population affected by a recessive disorder. No significant demographic differences were found between the two groups. The mean age of the heterozygous group was 39.9 ± 18.5 (years ± SD) and the mean age of the homozygous group was 35.0 ± 12.8 (years ± SD) (P>.05). When the age at onset of baldness was compared between the two groups, no significant differences were found (Fig 2). The mean age at onset in the heterozygous group was 28.4 ± 8.1 (years ± SD) and the mean age at onset in the homozygous group was 29.4 ± 8.7 (years ± SD) (P>.05). Using KaplanMeier curves, no differences were found in the age at onset of AGA between the two groups (P>.05). Hamilton scores were not significantly different between the two groups. The mean score in the heterozygous group was 3.7 ± 2.1 (score ± SD) and the mean score in the homozygous group was 2.8 ± 1.9 (score ± SD) (P>.05). After the values were corrected for age, no significant differences were found: the mean corrected score in the heterozygous group was 3.0 ± 3.2 (score ± SD) and the mean corrected score in the homozygous group was 3.3 ± 3.4 (score ± SD) (P>.05) (Fig 3). No other physical abnormal-

J AM ACAD DERMATOL VOLUME 42, NUMBER 6

Sprecher et al 981

Fig 3. Scatter plot of age-adjusted Hamilton score in healthy homozygotes and heterozygous carriers of the 3434delC mutation. Hamilton scores were corrected for age as indicated in “Material and Methods” (solid line: mean score in homozygotes; dotted line: mean score in heterozygotes).

ities were identified in any of the subjects of this study.

DISCUSSION In the past years, there have been marked advances in our understanding of hair growth regulation. Multiple hormones and growth factors are thought to be involved in the regulation of specific phases of hair follicle growth.3,21-24 The hairless gene product seems to be critical in the transition from the catagen to the anagen phase of the hair growth cycle.17,25 Indeed several observations in men13-15,26,27 and mice25 indicate that disruption of the hairless gene product prevents the hair follicle from initiating a new anagen cycle after the initial catagen phase during the first weeks of life. This most probably results from the loss of contact between the follicular epithelium and the dermal papilla.17,25 AGA is thought to be genetically determined.3 Several attempts to identify genes involved in the pathogenesis of AGA have been described in recent years. Those efforts have been mainly directed at trying to determine the role of gene products mediating

androgen activity.4,28,29 In the present study, we sought to assess the importance of the human hairless gene in the pathogenesis of this common form of alopecia. Although the study group was small, it was highly informative because it consisted of an extremely homogeneous population. Indeed, the kindred whose healthy members were examined in the present report has lived for centuries in the same village, all members of this family have been exposed to the same environmental (including nutritional) influences and are characterized by a very similar genetic background as shown in a previous study of their haplotypes.12 Thus, in the absence of common confounding factors, any effect of carrying a deleterious mutation at the hairless locus on the predisposition to develop AGA was expected to be easily identifiable in this unique population. Since the original description of a cDNA for the human hairless gene30 a year ago, the possibility that this gene product may be involved in the pathophysiology of AGA has been considered. The present results show that carriers of a deleterious mutation in the human hairless gene are not more likely than

982 Sprecher et al

their healthy homozygous relatives to experience AGA earlier in life or to a more severe extent. The fact that AGA is thought to result from altered anagen growth3 whereas the hairless gene is probably involved in the regulation of the catagen phase17 suggests that this gene is not involved in the pathogenesis of AGA. Although the present results are in line with this assumption, a formal linkage analysis of common polymorphisms in the general population will be needed to confirm this hypothesis. In summary, the present study reports the first attempt to characterize the phenotype of heterozygous carriers of a mutation in the human hairless gene. Although a growing body of evidence indicates that heterozygous carriers of mutations involved in recessive disorders may show abnormal (although generally mild) phenotypes,31-33 this report demonstrates that heterozygous relatives of patients affected with APL display a normal pattern of androgenetic hair loss. The collaboration of the family is gratefully acknowledged. REFERENCES 1. Tosti A, Praccini BM. Androgenetic alopecia. Int J Dermatol 1999;38:1s-7s. 2. Whiting DA. Male pattern hair loss: current understanding. Int J Dermatol 1998;37:561-6. 3. Sinclair R. Male pattern androgenetic alopecia. Br Med J 1998;317:865-9. 4. Ellis JA, Stebbing M, Harrap SB. Genetic analysis of male pattern baldness and the 5 alpha reductase genes. J Invest Dermatol 1998;110:849-53. 5. Damste J, Prakken JR. Atrichia with papular lesions: a variant of congenital ectodermal dysplasia. Dermatologica 1954;108:11421. 6. Czarnecki N, Stingl G. Congenital atrichia associated with keratin cysts: variant of partial ectodermal dysplasia. Z Hautkr 1980;55:210-7. 7. Del Castillo V, Ruiz Maldonado R, Carvevale A. Atrichia with papular lesion and mental retardation in two sisters. Int J Dermatol 1974;13:261-5. 8. Delprat A, Bonafe JL, Lugardon Y. Atrichie congenitale avec kystes. Ann Dermatol Venereol 1994;121:802-4. 9. Kanzler MH, Rasmussen JE. Atrichia with papular lesions. Arch Dermatol 1986;122:565-7. 10. Loewenthal LJA, Prakken JR. Atrichia with papular lesions. Dermatologica 1961;122:85-9. 11. Misciali C, Tosti A, Fanti PA, Borrelo P, Piraccini BM. Atrichia and papular lesions: report of a case. Dermatology 1992;185:284-8. 12. Sprecher E, Bergman R, Szargel R, Raz T, Labay V, Ramon M, et al. Atrichia with papular lesions maps to 8p in the region containing the human hairless gene. Am J Med Genet 1998;80:546-50. 13. Sprecher E, Bergman R, Szargel R, Friedman-Birnbaum R, Cohen N. Identification of a genetic defect in the hairless gene in atrichia with papular lesions: evidence for phenotypic heterogeneity among inherited atrichias. Am J Hum Genet 1999;64:1323-9. 14. Ahmad W, Irvine AD, Lam H, Buckley C, Bingham EA, Panteleyev AA, et al. A missense mutation in the zinc-finger domain of the human hairless gene underlies congenital atrichia in a family of Irish Travellers. Am J Hum Genet 1998;63:984-91.

J AM ACAD DERMATOL JUNE 2000

15. Cichon S, Anker M, Vogt IR, Rohleder H, Putzstuck M, Hillmer A, et al. Cloning, genomic organization, alternative transcripts and mutational analysis of the gene responsible for autosomal recessive universal congenital alopecia. Hum Mol Genet 1998; 7:1671-9. 16. Sprecher E, Lestringant GG, Szargel R, Bergman R, Labay V, Frossard P, et al. Atrichia with papular lesions resulting from a nonsense mutation within the human hairless gene. J Invest Dermatol 1999;113:687-90. 17. Panteleyev AA, Botchkareva NV, Sundberg JP, Christiano AM, Paus R.The role of the hairless gene in the regulation of hair follicle catagen transformation. Am J Pathol 1999;155:159-71. 18. Hamilton JB. Patterned loss of hair in man. Ann N Y Acad Sci 1951;53:708-28. 19. Sambrock J, Fritsch E, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989. p. 9.16-9.23. 20. Norusis MJ. Guide to data analysis. Upper Saddle River (NJ): Prentice-Hall; 1998. 21. Guo L, Degenstein L, Fuchs E. Keratinocyte growth factor is required for hair development but not for wound healing. Genes Dev 1996;10:165-75. 22. Hebert JM, Rosenquist T, Goetz J, Martin GR. FGF 5 as a regulator of the hair growth cycle: evidence from targeted and spontaneous mutations. Cell 1994;78:1017-25. 23. Philpott MP, Sanders DA, Bowen J, Kealy T. Effects of interleukins, colony-stimulating factors, and tumor necrosis factor on human hair follicle growth in vitro: a possible role for interleukin-1 and tumor necrosis factor-α in alopecia areata. Br J Dermatol 1993;135:942-8. 24. Shilli MB, Swapna R, Paus R, Obi-Tabot E, Holick MF. Control of hair growth with parathyroid hormone (7-34). J Invest Dermatol 1997;108:928-32. 25. Panteleyev AA, Paus R, Ahmad W, Sundberg JP, Christiano AM. Molecular and functional aspects of the hairless gene in laboratory rodents and humans. Exp Dermatol 1998;7:249-67. 26. Ahmed W, Zlotogorski A, Panteleyev AA, Lam H, Ahmad M, Faiyaz ul Haque M, et al. Genomic organization of the human hairless gene and identification of a mutation underlying congenital atrichia in an Arab Palestinian family. Genomics 1999;56:141-8. 27. Zlotogorski A, Ahmed W, Christiano AM. Congenital atrichia in five Arab Palestinian families resulting from a deletion in the human hairless gene. Hum Genet 1998;103:400-4. 28. Sawaya ME, Shalita AR. Androgen receptor polymorphisms (CAG repeat lengths) in androgenetic alopecia, hirsutism and acne. J Cutan Med Surg 1998;3:9-15. 29. Carey AH, Waterworth D, Patel K, White D, Little J, Novelli P, et al. Polycystic ovaries and premature male pattern baldness are associated with one allele of the steroid metabolism gene CYP17. Hum Mol Genet 1994;3:1873-6. 30. Ahmad W, Faiyaz ul Haque M, Brancolini V, Tsou HC, ul Haque S, HaMut L, et al. Alopecia universalis associated with a mutation in the human hairless gene. Science 1998;279:720-4. 31. Sharer N, Schwartz M, Malone G, Howarth A, Painter J, Super M, et al. Mutations of the cystic fibrosis gene in patients with chronic pancreatitis. N Engl J Med 1998;339:645-52. 32. Panditta TK, Hittelman WN. Increased initial levels of chromosome damage and heterogenous chromosome repair in ataxia telangiectasia heterozygote cells. Mut Res 1994;310:1-13. 33. Gaudet D, Vohl MC, Julien P, Tremblay P, Perron P, Gagne C, et al. Relative contribution of LDL receptor and lipoprotein lipase gene mutations to angiographically assessed coronary artery disease among French Canadians. Am J Cardiol 1998;82:299305.