Characterization of an additional molt inhibiting hormone-like neuropeptide from the shrimp Metapenaeus ensis

Characterization of an additional molt inhibiting hormone-like neuropeptide from the shrimp Metapenaeus ensis

Peptides 23 (2002) 1875–1883 Characterization of an additional molt inhibiting hormone-like neuropeptide from the shrimp Metapenaeus ensis夽 P.-L. Gu ...

728KB Sizes 0 Downloads 53 Views

Peptides 23 (2002) 1875–1883

Characterization of an additional molt inhibiting hormone-like neuropeptide from the shrimp Metapenaeus ensis夽 P.-L. Gu a,1 , S.S. Tobe b , B.K.C. Chow a , K.H. Chu c , J.-G. He d , S.-M. Chan a,∗ a

d

Department of Zoology, The University of Hong Kong, Pokfulam Road, Hong Kong, PR China b Department of Zoology, The University of Toronto, Toronto, Canada c Department of Biology, The Chinese University of Hong Kong, Shatin, Hong Kong, PR China State Key Laboratory, School of Life Sciences, Zhongshan University, Guangzhou 510275, PR China Received 5 July 2002; accepted 3 August 2002

Abstract We have identified a second form of the type-II neuropeptide encoding a molt inhibiting hormone-like (MeeMIH-B) neuropeptide. MeeMIH-B showed only a 70% amino acid identity to the MIH-A (formerly MIH) isolated from the same species, suggesting a possible different function of the deduced neuropeptide. Like other neuropeptide members of the CHH family, the MIH-B gene consists of three exons separated by two introns. The levels of MIH-B mRNA transcript in the eyestalk decrease in the initial phase of gonad maturation and increase towards the end of maturation. The drop in MIH-B level suggests an inhibitory role for this neuropeptide in the initiation of vitellogenesis. MIH-B transcripts can also be detected in the brain, thoracic ganglion and ventral nerve cord. Together with the CHH-B peptide that we have previously described, this is the second peptide of the CHH family that can also be identified in the ventral nerve cord and in the XOSG complex. A recombinant MIH-B was produced and a polyclonal antibody against rMIH-B was subsequently generated. Specific anti-rMIH-B antiserum recognized the presence of MIH-B in the sinus gland, X-organs, as well as a giant neuron of the ventral nerve cord. Injection of rMIH-B delayed the molting cycle of the maturing female. Taken together, the results of this study suggest that a drop in MIH-B level may be required for the delay in the molting of the maturing females. © 2002 Elsevier Science Inc. All rights reserved. Keywords: Eyestalk; Molt inhibiting hormone; Gene organization; Shrimp reproduction

1. Introduction The hyperglycemic hormone (CHH), molt inhibiting hormone (MIH) and gonad inhibiting hormone (GIH) of the eyestalk constitute a unique family of neuropeptides (CHH/MIH/GIH) found mainly in crustaceans. These neuropeptides share similar amino acid sequence and conservation of six cysteine residues in the same relative positions [8,9,20]. Because of the structural similarity of these neurohormones, biological assays using these purified neuropeptides often resulted in overlapping effects. For example, in addition to hyperglycemic effect, the CHH of the lobster Homarus americanus also inhibits ecdysteroid synAbbreviations: CHH, crustacean hyperglycemic hormone; MIH, molt inhibiting hormone; GIH, gonad inhibiting hormone; Nt, nucleotide 夽 The DNA sequence of the MeeMIH-B cDNA has been submitted to the GenBank sequence database with the accession number AF294648. ∗ Corresponding author. Tel.: +852-2299-0864; fax: +852-2857-4672. E-mail address: [email protected] (S.-M. Chan). 1 Present address: Department of Cell Biology, Baylor College of Medicine, Houston TX 77030, USA.

thesis [3]. Furthermore, the CHH of lobster also displays a hyperglycemic effect on the crayfish Orconectes. The CHH/MIH/GIH neuropeptide family was further divided into two subtypes based on the slight differences in primary structure [8,20]. CHH consists of a CHH precursor like peptide and a mature peptide of 72–74 amino acids. Both MIH and GIH consist of 76–78 amino acids with an addition of a glycine residue at position 12 of the mature peptide. To date, several CHH and/or CHH-related cDNAs (type-I) have been isolated in a single species, but only a few MIH-related (type-II) cDNA have been cloned [5,17–19,30]. Although recent reports on the initial cloning of these neuropeptides have documented, the characterization of these neuropeptides is far from complete. Furthermore, because most of these studies used a different crustacean species, the cloning of these neuropeptide genes in a single species is incomplete. For example, only the cDNAs for CHHs and GIH have been isolated in the lobster H. americanus [8] and in the crab Cancer pagarus. Although a CHH-A, CHH-B and MIH have been cloned in Metapenaeus ensis [12–14], a second type-II neuropeptide has not been isolated. The

0196-9781/02/$ – see front matter © 2002 Elsevier Science Inc. All rights reserved. PII: S 0 1 9 6 - 9 7 8 1 ( 0 2 ) 0 0 1 7 8 - X

1876

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

complete cloning of the major eyestalk neuropeptide group in one species would be useful in establishing their evolutionary relationship and the elucidation of their roles in growth and reproduction. The aim of this study is to characterize a second form of the eyestalk neuropeptide belongs to the CHH/MIH/GIH family from the shrimp M. ensis.

2. Materials and methods 2.1. RNA preparation and RT-PCR Various tissues were dissected from M. ensis and extracted for RNA [4] and the quality of the total RNA was monitored on a 1.5% denatured RNA gel. First strand cDNA was synthesized by reverse transcription (RT) in a buffer (50 mM Tris–HCl, 8 mM MgCl2 , 30 mM KCl, 2 mM each of dNTP, 10 mM DTT) containing 1 ␮g RNA 2 pmol of oligo (dT)17 primer, and 1 U of reverse transcriptase (Promega, USA) at 42 ◦ C for 2 h. For RT-PCR, we designed forward (M1) and reverse degenerated primers (M2) based on the known GIH and MIH nucleotide sequences from other crustaceans (M1: AACACNTGCMGVGSGGTSATGGG and M2: CCSGCGTTVARGATN CTGATCCA). The final PCR mix (30 ␮l per reaction) consisted of 10 mM Tris–HCl, pH 8.0, 1.5 mM MgCl2 , 50 mM KCl, 0.5 pmol primer M1 and M2 and 2.5 ␮l reaction mix from the reverse transcription as described above. The PCR conditions consisted of 35 cycles each of denaturing at 95 ◦ C for 1 min, annealing at 60 ◦ C for 1 min and extension at 72 ◦ C for 1 min. At the end of the last cycle, the PCR mix was incubated at 72 ◦ C for another 10 min for the completion of DNA synthesis. PCR products were analyzed on 1.5–2.0% agarose gel. Targeted DNA fragments of expected size (approximately 220 bp) were subcloned into the pBluescript cloning vector (Stratagene, USA). DNA sequence determination on both strands was performed using a T7 DNA polymerase sequencing kit (Pharmacia, Sweden). DNA and amino acid sequence derived from the results were compared and analyzed with the GenBank database using the BLAST search program. 2.2. cDNA library construction and screening The eyestalk cDNA library was constructed in the vector lambda Zap-II according to the instructions of the manufacturer (Stratagene, USA) and was screened for MIH-B using a randomly primed gene specific probe using template derived from RT-PCR. For library screening, randomly primed DNA probe was synthesized and used for screening the shrimp eyestalk cDNA library. After the third round screening, potential positive plaques were purified and the recombinant pBK-CMV phagemids were rescued from the bacteriophage clones by in vivo excision according to the instruction of the manufacturer (Stratagene, USA). DNA sequence was determined using a T7 DNA sequencing kit (Pharmacia, Sweden).

2.3. Genomic PCR Genomic DNA from a single shrimp was prepared from the tail muscle and used for the analysis of gene structure by PCR. Restriction enzyme site linked gene specific primers E4 (nt 80–100: GACGAGTCTTCGGCCTTCAGC), E5 (nt 316–339: AGGAGATCTAAGCTTACCACG CTCCACCAGGG), E6 (nt 6–24: AGAGGATCCAGGAAGTGTCTCCAAGC) and E7 (nt 608–622: ATAGAATTCAGAGAACACAAGC were used together with a E8 (nt 198–216 ATAGGATCCTGCACATGCCGTCCAGC) common primer for MIH-A and MIH-B. PCR conditions were similar to that of the RT-PCR as before. 2.4. Expression of shrimp MIH-B RNA isolated from different tissues was separated on 1.5% formaldehyde agarose gel and transferred onto a nitrocellulose membrane. The membrane contained hybridization buffer with a partial MIH-B cDNA probe. Hybridization was performed at 42 ◦ C overnight with a buffer containing 50% formamide [22]. For the detection of M. ensis MIH-B, the PCR amplified cDNA probe was used. In both cases, high stringency washes were performed at 65 ◦ C in a buffer (0.1× SSC and 0.1% SDS) to eliminate cross hybridization. To analyze the expression of MIH-B transcripts in maturing females, semi-quantitative RT-PCR was used. Eyestalk total RNA from individual animals were subjected to RT-PCR for MIH-B transcript detection. For ␤-actin RT-PCR, only 18 cycles were performed to ensure linear amplification of ␤-actin transcripts. The optical intensity of the DNA stained by ethidium bromide was used as an indication of the DNA concentration and RNA transcript level. The relative concentration of the MIH-B at the corresponding GSI sample was obtained after normalizing with the transcript level from the expression of ␤-actin. 2.5. Production of recombinant shrimp MIH-B antibody M. ensis MIH-B cDNA corresponding to nucleotides 80–339 was amplified by PCR using designed primers E4 and E5 and subcloned into a pRSET C (Invitrogen, USA). The expression construct with correct reading frame and orientation was transformed into E. coli BL21(DE3). Bacterial cultures were grown at 37 ◦ C in LB medium containing 100 ␮g/ml ampicillin until it reached an optical density of 0.5 (at 595 nm). The expression of protein was induced by adding of isopropyl thio-␤-d-galactoside (IPTG) to 1 mM and grown for a further 2 h at 30 ◦ C before harvesting. For large scale (250 ml) production of rMIH-B, the cell pellet was resuspended in a buffer (50 mM Tris–HCl, pH 7.9, 2 mM EDTA, 100 mM NaCl, 1 mM PMSF and 1 mM dithiothreitol) and sonicated to lyse the cells. The cell pellet was collected by centrifugation at 12,000 × g for 20 min at 4 ◦ C and re-suspended in the same buffer plus Triton-X100 to a final concentration of 0.1%. The soluble protein

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

fraction containing rMIH-B was collected by centrifugation at 12,000 × g for 30 min at 4 ◦ C. The supernatant was dialyzed against the Ni2+ starting buffer (20 mM Tris–HCl, pH 7.9, 5 mM imidazole and 0.5 M NaCl). The dialyzed solution was purified using HiTrap chelating column (Pharmacia, Sweden). The protein was eluted in an elution buffer (20 mM Tris–HCl, pH 7.9, 1 M imidazole and 0.5 M NaCl) and stored at −80 ◦ C. To produce anti-MIH-B polyclonal antibody, New Zealand rabbits were immunized with rMIH-B according to a standard procedure [16]. 2.6. Immunodetection of MIH-B Eyestalks were dissected, fixed in Bouin’s fixative overnight and processed for paraffin sectioning. Serial sections of 6–7 ␮m were prepared for immunohistochemical detection of MIH-B using anti-rMIH-B antisera. For immunohistochemical detection of MIH-B in the ventral nerve

1877

cord, cross-sections of paraffin-embedded shrimp were used. The preparations were dehydrated, counter-stained with hematoxylin-eosin (HE) and mounted in Permount (Sigma, USA). 2.7. Bioassay of rMIH-B for molting activity Single shrimp (0.8–0.9 cm carapace length) were placed in a compartment (9.5 cm × 13.5 cm) submerged in a water table with running sea-water at salinity 35‰. Individual shrimp were allowed to molt once before hormone injection and the molt stage were monitored by setogenesis. Recombinant MIH-B was dissolved in PBS and 1 ␮g/50 ␮l PBS was injected into the shrimp through the arthropodal membrane of the fifth walking leg. Shrimp were inspected for mortality and molting daily. The duration of the molt cycle was recorded. Statistical analysis of the data was performed using analysis of variance (ANOVA).

Fig. 1. (a) Nucleotide and deduced amino acid sequence of the prepro-MIH-B cDNA of the shrimp M. ensis. The putative polyadenylation signal (AATAAA) is in bold letters. The position of primers used in the initial RT-PCR is underlined. Numbers on the left and right margins represent amino acid and nucleotide positions, respectively. (b) Amino acid sequence alignment and comparison of the shrimp MIH-B peptides with other crustacean MIH/GIH subtypes. The sequences compared included the MIH of the shrimp [12], M. ensis, MeMIH-B (this study) and MIH of P. japonicus (this study), the lobster H. americanus [20], the MIH of the crab Carcinus maenas [27], the GIH of the lobster H. americanus and isopod A. vulgare [11]. The mandibular organ inhibiting hormone (MO-IH) [28]. Identical amino acid residues are shaded in darker color and similar amino acids are shaded in light gray color. Insets (- - -) have been added to maximize sequence identity. The percentage of identity indicates the overall amino acid identity for the mature peptide.

1878

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

Fig. 2. Genomic PCR identification of MIH-B gene: (a) agarose gel analysis of PCR amplification of genomic DNA with E5/E6 (lane 1), E6/E8 (lane 2); E4/E5 (lane 3) and E4/E7 (lane 4); (b) schematic diagram of the shrimp MIH gene. E4–E8 indicates the position and direction (arrows) of primers used in PCR. Open boxes indicate the introns and 3 -untranslated region, the black boxes indicate coding region and the gray box shows the 5 -promoter region of the MIH-B gene; the table below shows the sizes of the introns and estimated size of the genomic and cDNA fragments amplified from different combination of primers used in the PCR.

3. Results 3.1. Cloning and characterization of shrimp MIH-B cDNA During the cloning of MIH partial cDNA by RT-PCR using primers M1 and M2 and eyestalk RNA of a single shrimp

[12], additional partial cDNA fragments encoding a different neuropeptide were produced. The deduced amino acid showed 70% amino acid sequence identity to the MIH-like cDNA [12]. This partial cDNA was used as a probe to screen the shrimp eyestalk library. Three clones were obtained after the third round screening. DNA sequence determination confirmed that these clones carry a nucleotide sequence

Fig. 3. Northern blot analysis of the shrimp MIH-B expression: (a) tissue distribution of MeMIH-B. Lanes are Es (eyestalk), Ep (epidermis), Ht (heart), Hp (hepatopancreas), Gi (gill), Gu (gut), Ms (muscle), Te (testis), Ne (nerve cord) and Ov (ovary). The MeMIH-B probe was derived from the original RT-PCR clone; (b) RT-PCR detection of MIH-B transcripts in different parts of the ventral nerve cord. RNA from the eyestalks (Es), brain (Br), thoracic ganglion (Tg) and the posterior ventral nerve cord (Nc) of a single shrimp were used in the RT-PCR; the control is a RT-PCR amplification of the shrimp actin gene [14]; (c) RT-PCR detection of shrimp MIH-B transcripts in the eyestalk of juveniles and adult females. M1, M2, F1 and F2 are samples from different individuals; (d) semi-quantitative RT-PCR detection of MIH-B expression in eyestalk of females at different reproduction stages represented by gonadal somatic index (GSI). GSI = 0.7–12 indicate shrimp at early vitellogenic to late vitellogenic stage. The last lane indicates eyestalk sample from a post-spawn shrimp with a GSI of 1.5. For ␤-actin RT-PCR, only 18 cycles was performed to ensure linear amplification of ␤-actin transcripts and for RT-PCR of MIH-B, 35 cycles were used. The histogram shows result from one typical RT-PCR analysis. The optical intensity of the DNA stained by ethidium bromide was used as an indicated of the DNA concentration and RNA transcript level. The relative concentration of the MIH-B at the corresponding GSI sample was obtained after normalizing with the transcript level from the expression of ␤-actin [6].

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

identical to the probe (Fig. 1). The largest cDNA clone was 852 bp including a poly(A) tail. This clone was designated as MIH-B while the MIH isolated earlier by our group [12] was referred as MIH-A. MIH-B cDNA was preceded by a 25 bp 5 -flanking sequence and a long 3 -untranslated region of 518 bp. A polyadenylion signal (AATAAA) was also located at 12 bp upstream from the poly(A) tail. The longest ORF encodes a protein of 102 amino acids. In a hydrophobicity analysis, the first 28 amino acids are highly hydrophobic (data not shown), suggesting that this represents the signal peptide (SP) of MIH-B. The mature peptide (78 aa) was similar to the MIH/GIH neuropeptide subgroup of other crustaceans (Fig. 1b). For example, the cysteine residues are also conserved in the MeeMIH-B. However, MeeMIH-B showed

1879

only 70% overall amino acid identity to the MeeMIH-A (Fig. 1b). When compared to other crustaceans, MeeMIH-B is most similar to the GIH of the lobster Homarus americanus (46% identity). To further demonstrate the occurrence of a similar neuropeptide in other penaeid shrimp, we used a similar RT-PCR approach to amplify cDNA from eyestalk of the shrimp Penaeus japonicus. A cDNA fragment was amplified and DNA sequencing revealed that this partial cDNA is homologous to the MeeMIH-B. The deduced amino acid sequence of this partial cDNA showed a 75% identity as compared to that of the MeeMIH-B (Fig. 1b). For PejMIH-B, only a sequence of 56 amino acid was compared to MeeMIH-B since amino acid sequence of the C- and N-terminal of the mature peptide could not be

Fig. 4. Bacterial expression of recombinant MIH-B (rMIH-B). (a) Top: SDS–PAGE analysis and Coomassie blue staining of the bacteria protein extract. Lanes are M: high molecular protein marker (kDa), lane 1: BL21 cells alone; lanes 2–3; pRSET-C in BL21 cell extract from 3 and 6 h; lanes 4–8: pRSET-C/rMIH-B protein extract at 0, 2–4 and 6 h after IPTG induction. Bottom: Western blot analysis of fusion protein with anti-histidine antibody. (b) Analysis of Ni-NTA agarose column purification of recombinant protein. M: molecular weight marker, lanes 1–6: bacteria cell lysate in extraction buffers; lanes 7–9: elution of proteins from fractions 1–3 with 300 mM imidazole buffer.

1880

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

determined with the degenerate primer. MeeMIH-B shows only 39–43% amino acid identity to the MIH (or MOIH) of crabs and crayfish (Fig. 1b). A PCR approach was used to determine the structure and organization of the MIH-B gene. Different sets of primers were designed from the MeeMIH-B cDNA. PCR was performed using genomic DNA derived from a single shrimp (Fig. 2). The sizes of amplified gnomic DNA fragments were compared to the sizes of the cDNA fragments amplified by the same primer. With primers E5 and E6, a 1.2 kb genomic DNA fragment was amplified. This suggested that at least one intron (830 bp) was present. With primers E6

and E8, a 584 bp genomic DNA was amplified. The results suggest that the E5/E6 amplified genomic DNA fragment contains at least two introns. DNA sequence determination of E5/E6 amplified genomic DNA fragment confirm the presence of an intron of 350 bp. Furthermore, the location of the intron–exon junction also corresponds to that of the MIH-A and CHH-A and CHH-B genes (13, 14). Thus, it can be deduced that the genomic DNA fragment amplified by primers E5 and E6 consist of two introns. With primers E4 and E7, genomic PCR produced a 1041 bp DNA fragment. DNA sequencing determination using E5 confirm the presence of an intron-II only. To summarize, it is predicted

Fig. 5. Immunohistochemical detection of MIH-B in neurons of eyestalk XOSG complex: (a) immunodetection of MIH-B in SG, AX and XO of eyestalk LS section; (b) detection of MIH-B in sinus gland and axon (AX) of nearby section similar to (a); (c) enlarged magnification of showing positive staining of few neuronal cell of a X-organ cluster located in MT; (d) enlarged magnification of showing positive staining of few neuronal cell of a X-organ cluster located in different region of MT; (e) magnification of the sinus gland storage of MIH-B; (f) HE staining of the cross section of anterior CNS containing the brain; arrow points to a giant neurosecretory cell; (g) positive detection of the GIH in a large neuron of the ventral nerve cord; (h) scattered staining of MeeMIH-B in dendrite processes (arrows) of the neuronal cell. AT: axonal tract; MT: medulla terminalis; XO: X-organ; SG: sinus gland; NSC: neurosecretory cell.

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

1881

that the gene structure for MeeMIH-B is similar to that of the CHH-A and CHH-B of the same shrimp. 3.2. Expression of shrimp MIH-B MIH-B mRNA transcripts can be detected in the eyestalk and in the ventral nerve cord of a single shrimp. Other tissues including the epidermis, gill, hepatopancreas, ovary and testis contain no MIH-B transcripts (Fig. 3a). By RT-PCR, MeeMIH-B RNA can be detected from the anterior, middle and posterior region of the ventral nerve cord of the same shrimp (Fig. 3b). However, RT-PCR failed to demonstrate the presence of other neuropeptides (i.e. CHH-A and MIH-A) in the ventral nervous system. MIH-B also expresses in the juveniles and adults of both sexes (Fig. 3c). In female shrimp undergoing initial gonad maturation, a lower level of MIH-B transcripts was also detected. The study of the MIH-B expression pattern has been repeated several times and the results (Fig. 3d) show a typical expression profile for one group of shrimp. As gonad maturation progressed, the level of MIH-B increased steadily to reach a maximum at the final stage of maturation. However, the levels decrease again in post-spawned females (Fig. 3d). 3.3. Recombinant MIH-B (rMIH-B) Because the ligation of the EcoR I and Hind III restricted PCR product to linearized pRSET-C (cut by the EcoR I and Hind III) resulted in the production of plasmid with the addition of coding sequence from the vector, bacteria containing the DNA construct (pRSET-C/MIH) expressed a fusion protein (i.e. rMIH-B) with the size close to the estimated 14.5 kDa (Fig. 4a and b). Expression of rMIH-B could be detected within 1 h of induction and there was no dramatic increase in the amount of rMIH-B expression at different time intervals thereafter (Fig. 4a). The control contained only the pRSET-C vector, but, showed no expression of a recombinant protein (Fig. 4a: lanes 2 and 3). Large amounts of rMIH-B were prepared after purification with a Ni2+ column (Fig. 4b). The final yield was estimated to be 3 mg/l of culture. 3.4. Immunohistochemical detection of the MIH-B in shrimp Longitudinal sections of the eyestalk revealed the presence of MIH-B in several neurons of the X-organs/sinus gland and the axonal tract leading to the sinus gland (Fig. 5a–e). As a comparison, the amount of immuno-positive signal in the sinus gland and the axonal tract was much higher than X-organ (Fig. 5a–e) suggesting that MIH-B may be transported to the sinus gland rapidly. Since the ventral nerve cord also expresses MeeMIH-B, we also detected the presence of MIH-B in a large neuron of the ventral nerve cord and the dendritic processes of the ventral nerve cord (Fig. 5g and h). We also used an anti-rMIH and an

Fig. 6. Extension of the shrimp molt cycle duration after injection of rMIH-A and rMIH-B as compared to the PBS injected control. The duration was expressed as days ± S.D. N indicates the sample size. Statistical analysis was performed by one way analysis of variance (ANOVA). The significance was indicated at <0.01 (∗∗ ) and <0.05 (∗ ) level.

anti-rCHH-A antiserum to determine the specificity with similar serial sections of the eyestalk [18]. 3.5. Molt inhibiting function of MIH-B A total of 50 shrimp were eyestalk ablated at the beginning of the experiment and 45 shrimp remained after completion of the first molting cycle. Thus, eyestalk ablation did not cause a significant mortality in the shrimp. Subsequently, three groups of 15 shrimp were selected and used in the injection experiment. Injection of rMIH-A, rMIH-B did not cause toxic effects as there is only nine shrimp remain for the control group at the end of the experiment. Shrimp injected with rMIH-B showed a reduction of the molt cycle duration as compared to PBS injected control. We also injected shrimp with recombinant protein from MIH-A [14]. However, the molt delaying function of rMIH-B was not as effective as that of MIH-A (Fig. 6).

4. Discussion A combination of PCR and library screening was used to clone the shrimp MIH-B cDNA. This is the first report of the identification of additional cDNA belonging to the MIH/GIH subgroup of neuropeptides in Penaeidae. To date, we have isolated four neuropeptide cDNAs from the shrimp eyestalk cDNA library. Two cDNAs show characteristics of the CHH subgroup and two cDNAs show characteristics of the MIH/GIH eyestalk neuropeptide subtypes. We speculate that this additional form of type II MIH-like peptide may also be found in other penaeids as we have demonstrated that a cDNA homologous to the MIH subgroup occurs in the shrimp P. japonicus. Unlike the isoforms described in other crustaceans, MeeMIH-B shows only 68% amino acid identity with the MeeMIH-A suggesting that the two MIHs may have different functions. With the exception of GIH between the American lobster and the Norwegian lobster [28], most

1882

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

of the eyestalk neuropeptides shared less than 80% amino acid identity within the same group of decapoda. For example, the MIH of crab Charybdis feriatus and Carcinus maenas share only 75% sequence identity. Similarly, the MIH of M. ensis and P. japonicus share only 78% amino acid sequence identity [12]. Between neuropeptides of different crustaceans, the identity drops significantly. For example, the lobster HoaGIH shares only 37% amino acid identity as compared to the Arv-VIH of the isopod Armadillidium vulgare [11]. Although there are reports of the presence of a mandibular organ inhibiting hormone in crustaceans [21], results from sequence comparison indicate that the shrimp MeeMIH-B is more closely related to GIH than the MOIH. To date, we have not identified a third form of the MIH-like nor a MOIH-like neuropeptide from the same shrimp. In our study of the biosynthetic pathway of methylfarneosate (MF) in shrimp, we could only detect very low levels of farnesoate methyltransferase activity in the MO [26,27], suggesting that the amount of MF synthesized by MO is low in shrimp. Consequently, the regulation of MF synthesis by MOIH may be slight in shrimp. However, we cannot exclude the possibility that that the shrimp MIH-B, together with the CHH-A can also influence the mandibular organ and affect MF synthesis. The signal peptide (SP) of the shrimp MIH-B is shorter than the SP of the lobster GIH and the crab MIHs. For example, there are 35 amino acids residues in the SP from all other crabs reported and only 28 amino acids for the SP of MIH in the shrimps, MeeMIH-B and Pej-SGP-IV. Unlike the lobster HoaGIH and the crab ChfMIH, the mature peptide of MeeMIH-B consists of 79 amino acids and is the largest neuropeptide identified to date in the Penaeidae (Fig. 1). To study the gene structure for MIH-B, we initially used, without success, a forward-coding primer spanning the first codon (ATG) in the signal peptide and the last codon (TGA) of the mature peptide. This lack of success can be attributed to the presence of an intron located in the coding sequence after the first ATG. At present, we have no sequence information on the promoter region of the MIH-B gene. However, some generalizations can be made on the neuropeptide gene structure based on our PCR studies. The organization of the shrimp MIH-B gene is similar to that of the MIH-A and CHH-A genes of the same shrimp [1,12–14] and the locust [23]. With the exception of a P. monodon CHH-like gene [31], similar gene organization for the CHH-family member has been reported in the crabs, Charybdis feriatus and Cancer pagarus [29]. This suggests that the organization of this neuropeptide gene family is highly conserved. Since the MIH/GIH subgroup of neuropeptides is derived from the CHH gene and CHH is encoded by multiple copies of genes [13,14], additional genes belonging to the MIH/GIH subgroup of neuropeptides may also be present in other crustaceans. It is widely accepted that CHH/MIH/GIH neuropeptides are expressed in the neurons of X-organ in decapod crustaceans. Recent studies have also reported the presence of

these neuropeptides in other parts of the CNS [2,10,14]. These neuropeptides have also been implicated to play a role in reproduction of the crustaceans. Together with our identification of the CHH-B [14], this is the first demonstration of two different neuropeptides of the CHH/MIH/GIH family in the CNS other than in the eyestalk. Bacterially expressed MeeCHH-A and MeeCHH-B show hyperglycemic activity and both MeeMIH and MeeMIH-B show molt inhibiting activity [14,15]. The spatial expression of MeeCHH-B and MeeMIH-B may be important in female maturation [14]. As there is a slight decrease in MIH-B expression in adult females at the onset of maturation, we speculate that the relative concentration MeeCHH-B and MeeMIH-B may have an important physiological function in the regulation of female reproduction in shrimp. Because of the structural similarity of these eyestalk neuropeptides, the existence of cross bioactivities, difficulties in staging, and the lack of knowledge on crustacean physiology, inconsistent results were obtained from many bioassay experiments. For example, the lobster CHH and GIH have been shown to possess MIH activity. Recently, recombinant fusion proteins for some of these neuropeptides have been produced and found to be bioactive [13–15,27]. Thus, like other eyestalk recombinant neuropeptides, a small fraction of the bacterial expressed rMIH-B may fold correctly with respect to the disulfide bondings and resulted in the native MIH-B that is biologically active. Gonad maturation and vitellogenesis in crustaceans is inhibited by the eyestalk factor GIH [20,24]. Gonad maturation involves the accumulation of yolk protein by the developing oocytes and it usually occurs from the intermolt to premolt stage when the hemolymph titer of MIH is reduced [25]. It is possible that a lower level of MeeMIH-B is required to initiate vitellogenesis and the level returns to its maximal level before spawning. As shown in the bioassay experiment, rMIH-B also delays the molting process of juvenile shrimp. Thus, MIH-B may have a dual role in the control of both molting and reproduction in the adult female. Under favorable conditions, a slight drop in MIH-B level could stimulate secondary vitellogenesis whereas an increase in MIH-B during the later stages could suppress molting in the late gonad maturation phase. In lobster, GIH has been suggested to be an important modulator of synthesis and release of hormones involved in molting as well as in the reproductive process [7]. Thus, this pattern of regulation in M. ensis is similar to that described in the lobster [7]. In summary, this study reports the cloning and characterization of a shrimp cDNA encoding a neuropeptide that has characteristics of both molt inhibiting hormone and gonad inhibiting hormone. The recent increases in the reports of amino acid and nucleotide sequences of crustacean neurohormones provide more information on this unique subgroup of neuropeptides. Because of the structural similarity and cross-reactivity, systematic analysis of structure/function and evolutionary relationships of this group of neuropeptides in crustaceans can only be achieved

P.-L. Gu et al. / Peptides 23 (2002) 1875–1883

following the cloning of these cDNA or genes of these neuropeptides. Acknowledgments The work is supported by a grant from the Research Grant Council of the Hong Kong Special Administration Region (HKU 7227/00M) and a Hong Kong University institutional grant (CRCG) awarded to SMC, and grants from the Research Committee, The Chinese University of Hong Kong, awarded to KHC. References [1] Chan S-M, Chen X-G, Gu P-L. PCR cloning and expression of the molt-inhibiting hormone gene for the crab (Charybdis feriatus). Gene 1998;224:23–33. [2] Chang ES, Chang SA, Beltz BS, Kravitz EA. Crustacean hyperglycemic hormone in the lobster nervous system: localization and release from cells in the subesophageal ganglion and thoracic second roots. J Comp Neurol 1999;414:50–6. [3] Chang ES, Prestwich GD, Bruce MJ. Amino acid sequence of a peptide with both molt-inhibiting and hyperglycemic activities in the lobster, Homarus americanus. Biochem Biophys Res Commun 1990;171:818–26. [4] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem 1987;162:156–9. [5] Chung JS, Wilkinson MC, Webster SG. Determination of the amino acid sequence of the moult-inhibiting hormone from the edible crab, Cancer pagurus. Neuropeptides 1996;30:95–101. [6] Chow JFC, Chan K-M. Isolation of two actin gene fragments from Chlorella vugaris. J Mar Biotech 1997;5:58–72. [7] De Kleijn DVP, Janssen KPC, Waddy SL, Hegemann R, Lai WY, Martens GJM, et al. Expression of the crustacean hyperglycaemic hormones and the gonad-inhibiting hormone during the reproductive cycle of the female American lobster Homarus americanus. J Endocrinol 1998;156:291–8. [8] De Kleijn DP, Van Herp F. Molecular biology of neurohormone precursors in the eyestalk of Crustacea. Comp Biochem Physiol B 1995;112:573–9. [9] De Kleijn DPV, Janssen KPC, Martens GJM, Van Herp F. Cloning and expression of two crustacean hyperglycemic-hormone mRNAs in the eyestalk of the crayfish Orconectes limosus. Eur J Biochem 1994;224:623–9. [10] Edomi P, Azzoni E, Mettulio R, Pandolfelli N, Ferrero EA, Giulianini PG. Gonad-inhibiting hormone of the Norway lobster (Nephrops norvegicus): cDNA cloning, expression, recombinant protein production, and immunolocalization. Gene 2002;6(284):93–102. [11] Greve P, Sorokine O, Berges T, Lacombe CM, Van Dorsselaer A, Martin A. Isolation and amino acid sequence of a peptide with vitellogenesis inhibiting activity from the terrestrial isopod Armadillidium vulgare (Crustacea). Gen Comp Endo 1999;115:406–14. [12] Gu P-L, Chan S-M. Cloning of a cDNA encoding a putative molt-inhibiting hormone from the eyestalk of the sand shrimp Metapenaeus ensis. Mol Mar Biol Biotechnol 1998;7:14–22. [13] Gu P-L, Chan S-M. The shrimp hyperglycemic hormone-like neuropeptide is encoded by multiple copies of genes arranged in a cluster. FEBS Lett 1998;441:397–403.

1883

[14] Gu P-L, Yu KL, Chan S-M. Molecular characterization of an additional shrimp hyperglycemic hormone: cDNA cloning, gene organization, expression and biological assay of recombinant proteins. FEBS Lett 2000;472:122–8. [15] Gu P-L, Chu KH, Chan S-M. Bacterial expression of the shrimp molt-inhibiting hormone (MIH): antibody production, immunocytochemical study and biology assay. Cell Tissue Res 2001;303:129– 36. [16] Harlow E, Lan D. Antibodies: a laboratory manual. New York, USA: Cold Spring Harbour Press; 1988. [17] Huberman A, Aguilar MB, Brew K, Shabanowitz J, Hunt DF. Primary structure of the major isomorph of the crustacean hyperglycemic hormone (CHH-I) from the sinus gland of the Mexican crayfish Procambarus bouvieri (Ortmann): interspecies comparison. Peptides 1993;14:7–16. [18] Kegel G, Reichwein B, Tensen CP, Keller R. Amino acid sequence of crustacean hyperglycemic hormone (CHH) from the crayfish, Orconectes limosus: emergence of a novel neuropeptide family. Peptides 1991;12:909–13. [19] Kegel G, Reichwein B, Weese S, Graus G, Peter-Katalinie J, Keller R. Amino acid sequence of the crustacean hyperglycemic hormone (CHH) from the shore crab, Carcinus maenas. FEBS Lett 1989;255:10–4. [20] Keller R. Crustacean neuropeptides: structures, functions and comparative aspects. Experientia 1992;48:439–48. [21] Lu W, Wainwright G, Webster SG, Rees HH, Turner PC. Clustering of mandibular organ-inhibiting hormone and moult-inhibiting hormone genes in the crab, Cancer pagurus, and implications for regulation of expression. Gene 2000;253:197–207. [22] Maniatis T, Sambrook J, Fritsch EF. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, New York: CSH Press; 1989. [23] Meredith J, Ring M, Macins A, Marschall J, Cheng NN, Theilmann D, et al. Locust ion transport peptide (ITP): primary structure, cDNA and expression in a baculovirus system. J Exp Biol 1996;199:1053– 61. [24] Meusy JJ. Vitellogenin, the extraovarian precursor of the protein yolk in Crustacea: a review. Reprod Nutr Dev 1980;20:1–21. [25] Quakenbush LS. Crustacean endocrinology, a review. Can J Fish Aquat Sci 1986;43:2271–82. [26] Silva Gunawardene YIN, Chow BKC, He JG, Chan S-M. The shrimp FAMeT cDNA is encoded for a putative enzyme involved in the methylfarnesoate (MF) biosynthetic pathway and is temporally expressed in the eyestalk of different sexes. Insect Biochem Mol Biol 2001;31:1115–24. [27] Silva Gunawardene YIN, Tobe SS, Chow BKC, Yagi KJ, Bendena W, Chan S-M. Biochemical characterization and cellular distribution of Farnesoic acid O-methyltransferase involved in the methyl farnesoate biosynthetic pathway from the shrimp, Metapenaeus ensis. Eur J Biochem 2002;269:3587–95. [28] Tang C, Lu W, Wainwright G, Webster SG, Rees HH, Turner PC. Molecular characterization and expression of mandibular organ-inhibiting hormone, a recently discovered neuropeptide involved in the regulation of growth and reproduction in the crab Cancer pagurus. Biochem J 1999;343:355–60. [29] Udomkit A, Chooluck S, Sonthayanon B, Panyim SJ. Exp Mar Biol Ecol 2000;244:145–56. [30] Umphrey HR, Lee KJ, Watson RD, Spaziani E. Molecular cloning of a cDNA encoding molt-inhibiting hormone of the crab, Cancer magister. Mol Cell Endocrinol 1998;136:145–9. [31] Yang WJ, Rao KR. Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii. Biochem Biophys Res Commun 2001;289:407–13.