Diversity of polymyxin resistance mechanisms among Acinetobacter baumannii clinical isolates

Diversity of polymyxin resistance mechanisms among Acinetobacter baumannii clinical isolates

    Diversity of Polymyxin Resistance Mechanisms among Acinetobacter baumannii Clinical Isolates Raquel Girardello, Marina Visconde, Rodr...

1MB Sizes 3 Downloads 112 Views

    Diversity of Polymyxin Resistance Mechanisms among Acinetobacter baumannii Clinical Isolates Raquel Girardello, Marina Visconde, Rodrigo Cayˆo, Regina C´elia Bressan Queiroz de Figueiredo, Marcelo Alves da Silva Mori, Nilton Lincopan, Ana Cristina Gales PII: DOI: Reference:

S0732-8893(16)30335-2 doi: 10.1016/j.diagmicrobio.2016.10.011 DMB 14218

To appear in:

Diagnostic Microbiology and Infectious Disease

Received date: Revised date: Accepted date:

20 April 2016 26 September 2016 3 October 2016

Please cite this article as: Girardello Raquel, Visconde Marina, Cayˆo Rodrigo, de Figueiredo Regina C´elia Bressan Queiroz, da Silva Mori Marcelo Alves, Lincopan Nilton, Gales Ana Cristina, Diversity of Polymyxin Resistance Mechanisms among Acinetobacter baumannii Clinical Isolates, Diagnostic Microbiology and Infectious Disease (2016), doi: 10.1016/j.diagmicrobio.2016.10.011

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Diversity of Polymyxin Resistance Mechanisms among Acinetobacter baumannii Clinical Isolates

Rodrigo Cayô

1

RI P

Marina Visconde

1*

T

Raquel Girardello

1

2

SC

Regina Célia Bressan Queiroz de Figueiredo 3

Marcelo Alves da Silva Mori 4,5

MA NU

Nilton Lincopan

Ana Cristina Gales

1

1

Laboratório Alerta, Disciplina de Infectologia, Departamento de Medicina, Universidade

Federal de São Paulo - UNIFESP, São Paulo - SP, Brazil. 2

Departamento de Microbiologia, Fundação Oswaldo Cruz, Centro de Pesquisas Aggeu

ED

Magalhães, Recife, Pernambuco, Brazil. 3

Departamento de Biofísica, Universidade Federal de São Paulo - UNIFESP, São Paulo - SP,

PT

Brazil. 4

Departamento de Microbiologia, Instituto de Ciências Biomédicas, Universidade de São Paulo

- USP, São Paulo - SP, Brazil. 5

CE

Departamento de Análises Clínicas e Toxicológicas, Faculdade de Ciências Farmacêuticas,

AC

Universidade de São Paulo - USP, São Paulo - SP, Brazil.

Keywords: A. baumannii, polymyxin resistance, virulence.

Running Title: Polymyxin Resistance in A. baumannii.

*Corresponding author: Raquel Girardello, PhD Rua Pedro de Toledo, 781 - 6th Floor São Paulo - SP, Brazil 04039-032 Phone/Fax: +55-11-55764748 E-mail: [email protected]

1

ACCEPTED MANUSCRIPT Abstract Polymyxins have become drugs of last resort for treatment of multi-drug resistant (MDR) Gramnegative infections. However, the mechanisms of resistance to this compound have not been

T

completely elucidated. In this study, we evaluated the mechanisms of resistance to this

RI P

antimicrobial in two A. baumannii clinical isolates, respectively, susceptible (A027) and resistant (A009) to polymyxin B before and after polymyxin B exposure (A027

ind

ind

and A009 ). The pmrAB

SC

and lpxACD were sequenced and their transcriptional levels were analyzed by qRT-PCR. The bacterial cell morphology was evaluated by transmission electronic microscopy (TEM) and the

MA NU

membrane potential was measured using Zeta-potential analyzer. The virulence of strains was studied using a Caenorhabditis elegans model. Both clinical isolates exhibited an elevation of ind

the polymyxin B MIC after exposure to this compound. On the other hand, A027

showed

decreased values of MIC for β-lactams, aminoglycosides, vancomycin, teicoplanin, oxacillin and erythromycin. A027 ind

harbored two mutations in pmrB and the ISAba125 disrupting the lpxA. In

strain exhibited increase of pmrB transcriptional level, after polymyxin B

ED

contrast, A009

ind

exposure, despite the absence of mutations in the pmrAB genes. The TEM images revealed a

PT

thicker and more electron-dense peptidoglycan layer for A009 than that of A027. The exposure to polymyxin B induced a strong condensation and darkening of intracellular material, mainly in ind

CE

A009 . In addition, the surface charge of A009 was significantly less negative than the one of A027. Using the C. elegans model, only A027

ind

strain showed a reduction on virulence. The

AC

diversity of polymyxin B resistance mechanisms among A. baumannii strains evaluated in this study confirms the complexity of these mechanisms, which may vary depending of the background of each strain.

2

ACCEPTED MANUSCRIPT Introduction Acinetobacter baumannii ranked as the fourth most common pathogen causing catheter related bloodstream infections in adult patients hospitalized at Brazilian intensive care units

T

(UTIs) [1]. Its ability to adapt in adverse conditions, as occurred in the hospital environment,

RI P

contribute to resistance development in this pathogen [2]. According to the latest report of the Brazilian Health Agency, 80.7% of Acinetobacter spp. from ICUs were resistant to

SC

carbapenems. Similar rates have been observed in Europe and in the USA, where 90.6% and 63.0% of Acinetobacter spp. were reported as resistant to these compounds, respectively

MA NU

[1,3,4]. This phenotype has been mainly attributed to the spread of OXA-23-producing clones [5-11]. For this reason, polymyxins have been frequently administered as empirical therapy for ICU patients diagnosed with ventilator-associated pneumonia. However, resistance to these drugs has already been reported, and the mechanisms involved in this phenotype are not fully understood [12,13]. To date, two distinct mechanisms of polymyxins resistance have been

ED

characterized in A. baumannii. The first one involves the modification of the membrane lipopolysacharide (LPS) through addition of phosphoethanolamine in the lipid A moiety, in a

PT

process mediated by PmrAB two-component system. Single nucleotide mutations and/or increased expression of pmrA or pmrB leads to up-regulation of pmrC, which, in turn, produces

CE

phosphoethanolamine transferase, responsible for modification on the lipid A. This modification reduces the negative charge of the outer bacterial membrane and, therefore, decreases the

AC

polymyxin affinity for the bacterial cell surface [14-16]. Other mechanism of polymyxin resistance described in A. baumannii is the complete loss of LPS due to single nucleotide mutations on lpxA, a component of LPS biosynthesis operon [17]. Mutations on the other genes of LPS biosynthesis pathway, such as lpxC and lpxD, have also been reported in polymyxinresistant A. baumannii laboratory derivative strains [17,18]. In addition, other mechanisms might be present among clinical strains since polymyxin-resistant strains that did not have any of the mechanisms described above have also been reported [19]. Recently, a plasmid-mediated phosphoethanolamine transferase, denominated MCR-1, was reported among Escherichia coli and Klebsiella pneumoniae isolated from humans and pigs from China [20]. Several studies described decrease in the fitness of polymyxin-resistant Acinetobacter spp. strains due to energetic cost for in vitro adaptive resistance development [21-25].

3

ACCEPTED MANUSCRIPT Acinetobacter spp. strains showing this resistance phenotype usually display a slower growth rate compared with polymyxins susceptible ones. In contrast, Durante-Mangoni et al. recently reported the emergence of colistin resistance without loss of fitness and virulence in clinical

T

extensively-multi drug resistant A. baumannii after prolonged colistin administration [26].

RI P

In this manner, this study was undertaken to evaluate the mechanism of polymyxin B resistance of two A. baumannii clinical isolates, initially identified as susceptible and resistant to

SC

polymyxins, before and after polymyxin B exposure. In addition, we also studied the fitness and

AC

CE

PT

ED

MA NU

virulence of each isolate using the Caenorhabditis elegans animal model.

4

ACCEPTED MANUSCRIPT Material and Methods Strains. Two A. baumannii clinical isolates, initially characterized as susceptible and resistant to polymyxins by the routine clinical laboratory, based on CLSI breakpoints [27], were selected for

T

this study, as described in the Table 1. The identification at the species level was confirmed by

RI P

rpoB DNA-sequencing [28]. These clinical isolates were subcultured in Luria Bertani (LB) agar supplemented with increasing concentrations of polymyxin B sulfate at 35ºC ± 2°C, for 18-24 h,

SC

for 10 consecutive days. To verify the stability of the polymyxin B resistance phenotype, the polymyxin B-resistant isolates were further subcultured into the LB agar plates without addition

MA NU

of polymyxin B for the same time (10 days). All polymyxin B-resistant isolates were stored at 70C in trypticase soy broth supplemented with 15% glycerol.

Antimicrobial Susceptibility Profile. The minimal inhibitory concentrations (MICs) for polymyxin B were initially determined in a routine clinical laboratory using BD Phoenix Automated System

ED

and confirmed by Clinical Laboratory Standards Institute (CLSI) broth microdilution [29]. Antimicrobial susceptibility profiles to penicillin, ampicillin, oxacillin, piperacillin/tazobactam,

PT

cefoxitin, ceftriaxone, ceftazidime, cefepime, aztreonam, imipenem, meropenem, amikacin,

CE

gentamicin, ciprofloxacin, levofloxacin, tigecycline, clindamycin, erythromycin, teicoplanin, vancomycin, and linezolid were also determined by CLSI broth microdilution [27]. The

AC

antimicrobials were obtained from Sigma-Aldrich (St Louis, MO, USA). E. coli ATCC 25922, P. aeruginosa ATCC 27853, Staphylococcus aureus ATCC 29213 and Enterococcus faecalis ATCC 29212 strains were used as quality controls and tested within the expected ranges. The results were interpreted according to CLSI breakpoints [27].

Typing assays. The genetic relationship of clinical isolates and their mutant pairs was analyzed by pulsed-field gel electrophoresis (PFGE) using CHEF DR III system (Bio-Rad, Hercules, California) and ApaI restriction enzyme (Roche Diagnostics, Indianapolis, IN, USA) [30]. DNA fingerprints were interpreted according to previously recommended criteria [31].

PCR and Sequencing. The detection of pmrA, pmrB, lpxA, lpxC, and lpxD genes among A. baumannii was carried out by PCR followed by DNA sequencing. All primers used in this study

5

ACCEPTED MANUSCRIPT were described in Table 2. The sequencing reactions were carried out from purified amplicons using the QIAquick Gel Extraction Kit (Qiagen, Courtaboeuf, France) according to manufacturer instructions. Sequencing reactions were prepared using the Big Dye Terminator Cycle

RI P

Genetic Analyzer (Applied Biosystems, Perkin Elmer, USA).

T

Sequencing (Applied Biosystems, Foster City, USA), and then performed on the ABI 3500

SC

Real Time PCR. A. baumannii strains were grown in 20 mL of LB broth at 37ºC under constant shaking, to reach an optical density of 0.6 at 600 nm. For mutant strains, 4 µg/mL polymyxin B

MA NU

sulfate was added to LB broth. Total RNA was obtained from A. baumannii strains using RNeasy Mini Kit (Qiagen, Hilden, Germany) with addition of RNase-free DNase (Qiagen, Hilden, Germany). Reverse transcription of the extracted RNA was performed using High Capacity cDNA Reverse Transcription Kit (Life Technologies, Carlsbad, CA, USA). The primers used were shown on Table 2. Relative quantification of the transcripts was performed in triplicate ®

ED

using SYBR Green PCR Master Mix (Life Technologies, Carlsbad, CA, USA) on the 7500 Real Time (Life Technologies, Carlsbad, CA, USA). The 16S rDNA gene was used as reference to

PT

normalize the relative amount of mRNA and ATCC 19606 was used to normalize the

CE

transcriptional level of each strain.

Transmission Electron Microscopy (TEM) assays. Overnight cultures of polymyxin B-susceptible

AC

and -resistant clinical isolates and the mutant pairs, grown in LB at 35°C ± 2°C under shaking, were used to inoculate 20 mL of fresh LB medium. Cells were grown to reach an optical density of 0.6 at 600 nm and the bacterial pellet from 1 mL of each strain suspension was harvested by centrifugation at 12.000 rpm for 10 minutes. The cell pellets were resuspended in 2.5% glutaraldehyde/4% formaldehyde in a 0.1 M sodium cacodylate buffer (pH 7.2) and incubated for 1 hour, at room temperature. The post-fixation was carried out with 2% osmium tetroxide in 0.1 M sodium cacodylate buffer (pH 7.2) for 2 hours, followed by dehydration through a graded ethanol series and propylene oxide and embedded for 48 hours at 60ºC in Epon resin. Ultrathin sections were stained with 5% uranyl acetate and lead citrate solution, and observed in Jeol 1200 EXII transmission electron microscope.

6

ACCEPTED MANUSCRIPT Zeta potential measurement. Bacterial colonies were grown overnight at 37ºC, in 5 mL LB broth under constant shaking. The mutant pair strains were grown in LB broth plus 4 μg/mL of polymyxin B sulfate, at the same conditions. The bacterial cell suspensions were harvested by

T

centrifugation at 3000 rpm, for 5 minutes, and washed twice with ultra-pure water. The cells 8

RI P

were resuspended in a 1 mM NaCl solution to reach bacterial suspensions containing 1.5 x10

cfu/mL. The zeta potential of bacterial cells was measured in Zeta Plus-Zeta Potential Analyzer

SC

(Brookhaven Instruments Corporation, Holtsville, NY). The measurements were performed in

MA NU

triplicate in distinct occasions.

Growth assay. In order to evaluate differences in bacterial fitness of polymyxin B-susceptible and -resistant strains, we evaluated the ability of strain growth until reach the stationary phase of growth. The strains were cultured in the presence or absence of polymyxin B 4 µg/mL in LB broth, under constant shaking, for 18 hours, at 37°C. One milliliter of each culture was diluted in

ED

149 mL of fresh LB broth and incubated, under constant shaking, at 37°C, for 12 hours. Every

660 nm wavelength.

PT

hour, 1 mL of the culture was removed and the turbidity was measured at spectrophotometer at

CE

In vivo virulence evaluation by the C. elegans model. The bacterial virulence was evaluated using C. elegans lethality model [32]. Overnight cultures of the A. baumannii strains and the

AC

control strain E. coli OP50 were subcultured in Nematode Growth Media (NGM) at 37ºC for 12 hours. The adult C. elegans was inoculated in the NGM containing the bacterial strains cultures and the plates were again incubated at 25ºC. The dead worms were counted daily using a stereomicroscope. The experiments were performed in two different days. Chi-square test was applied for statistical analysis.

7

ACCEPTED MANUSCRIPT Results Each pair of Acinetobacter strains was confirmed to be genetically identical by PFGE. The mutant strains recovered after polymyxin B exposure were genetically identical to their

T

respective parental isolates. The Table 3 describes the antimicrobial susceptibility profile of A.

RI P

baumannii clinical isolates and their mutants. A027 strain was initially susceptible only to polymyxin B (MIC, 0.25 µg/mL) and tigecycline (MIC, 1 µg/mL). After polymyxin B exposure, the had an elevation of the polymyxin B MIC (MIC, >64 µg/mL), and a decreased MICs for

β-lactams and aminoglycosides. Furthermore, A027

ind

SC

ind

A027

also showed a reduction in the

MA NU

vancomycin, teicoplanin, oxacillin and erythromycin MICs after polymyxin B exposure. No modification of MICs for fluoroquinolones was noticed. The clinical isolate A009 was initially resistant to polymyxin B (MIC, 16 µg/mL) but susceptible to all other antimicrobial agents tested. ind

After polymyxin B exposure, the A009

strain had an increase of 2 dilutions in the polymyxin B

MIC (64 µg/mL) without alteration in the MICs for the remaining antimicrobials. After

ED

subculturing in the absence of polymyxin B, A009

ind

strain showed a decrease in the MIC from

64 µg/mL to 16 µg/mL. In contrast, no reduction of polymyxin B MIC to prior levels was ind

PT

observed for A027 , suggesting that the acquisition of this resistance phenotype was stable in this strain.

CE

The pmrA sequences of all strains were identical to those of the ATCC17978 ind

(GeneBank, accession number CP000521.1). Compared to A027 strain, the A027

showed a

AC

Tre-28 deletion and a Glu-45 insertion in pmrB. In contrast, no pmrB mutations were found in ind

A009 and A009 , as displayed in Table 4. The A027

ind

showed a slight increase in the ind

transcriptional levels of pmrA (0.67-fold) compared to that of A027. For A009 , pmrB transcriptional level was 2.05-fold higher compared to the one of A009 strain (Figure 1). The lpxA, lpxC and lpxD sequences of A027 clinical isolate were identical to those of ATCC 17978 (GeneBank, accession number CP000521.1). After polymyxin B exposure, A027

ind

strain

showed an insertion of ISAba125 disrupting the lpxA gene. In contrast, the lpxC and lpxD sequences of A009 strain showed diverse point mutations compared to those of ATCC 17978, resulting in several amino acid modifications, as described in Table 4. However, no additional mutations on lpxACD were acquired by A009

ind

after polymyxin B exposure. Both A027 and

A009 strains showed lower relative transcriptional levels for lpxA, lpxC, and lpxD genes

8

ACCEPTED MANUSCRIPT ind

comparing with those of ATCC 19606 strain (Figure 2, A). After polymyxin B exposure, A027 mutant had a decrease of lpxA transcription level (0.875-fold) compared to that of A027. In

contrast, no significant modifications on lpxC and lpxD transcriptional levels was observed for (Figure 2, B). The A009

ind

strain showed only a slight increase of lpxC transcription

T

ind

A027

RI P

(0.323-fold) compared to A009 strain (Figure 2, C).

To verify morphological differences between polymyxin B-susceptible and -resistant

SC

strains, we evaluated the bacterial morphology cells by TEM. Polymyxin B-resistant A009 strain showed thicker and more electron-dense peptidoglycan layer as compared to polymyxin B-

MA NU

susceptible A027 strain. Both clinical isolates presented an even cytoplasm and well-preserved cell wall (Figures 3, A and B). The exposure to polymyxin B induced a strong condensation and darkening of intracellular material associated to the inner layer of cytoplasmic membrane with ind

the appearance of clear zones in the cytoplasm, more pronounced in A009

(Figures 3C and

3D). Some cells presenting a discontinuous cell wall were also observed (Figure 3D). Due to

ED

differences observed in the morphology of cell wall of A. baumannii clinical isolates, we evaluated the resistance to osmotic pressure by growing the Acinetobacter strains in hypotonic ind

mutant strain was not able to growth at this condition (data not shown).

PT

medium. Only A027

The Figure 4 depicted the membrane Zeta Potential observed in polymyxin B-

CE

susceptible and -resistant A. baumannii clinical isolates, and their respective mutants. All tested strains showed negative Zeta Potential; however, A009 strain, originally resistant to polymyxin

AC

B, had the surface charge significantly less negative than that of A027 strain, which was originally susceptible to polymyxin B (-3.51 ±0.4 mV versus -31.15 ±0.42 mV, respectively). The ind

A027

had an increase in the membrane negative charge, from -31.15 mV (±0.42) to -49.4 mV

(±0.68), when compared with that of A027. In contrast, A009

ind

showed a slight decrease (-3.51

mV ± 0.4 to -2.02 mV ± 0.14) of negative charge versus that of A009 strain (Figure 4). The duplication time for the A027 and A009 strains was approximately 1 hour, while their mutants had a duplication time of, approximately, 2 hours each. All strains started the growth curve from an OD 0.05 inoculum. However, after reaching the logarithmic phase of growth, no differences in the growth rate were observed in the polymyxin-resistant A009 and ind

A009

(Figure 5).

9

ACCEPTED MANUSCRIPT Initially, both polymyxin B-susceptible A027 and -resistant A009 isolates showed similar survival rates (worm survival mean, 19.5 days and 19 days, respectively, Figure 6). After polymyxin B exposure, A027

ind

had a significant decrease of virulence comparing to that of

T

A027 (worm survival mean, 24.0 days and 19.5 days, respectively; p<0.0001, Figure 6). No ind

RI P

significant alteration in the time of worm survival was observed for A009 , when compared to

AC

CE

PT

ED

MA NU

SC

A009 (worm survival mean, 16 days and 19 days, respectively; p = 0.0011, Figure 6).

10

ACCEPTED MANUSCRIPT Discussion Resistance to carbapenems has drastically increased over decades worldwide. For instance, the imipenem resistance rates among A. baumannii clinical isolates increased from

T

12.6% to 71.4% between 1997-1998 and 2008-2010 periods in some Brazilian medical centers

RI P

[33]. Although novel antimicrobials have been recently approved by the Food and Drug Administration (FDA) for the treatment of Gram-negative infections, none of them are active

SC

against carbapenem-resistant A. baumannii, due to carbapenem-hydrolyzing class D βlactamases (CHDLs) or metallo-β-lactamase production [34]. In this manner, polymyxins remain

MA NU

the main therapeutic options available for treatment of serious carbapenem-resistant A. baumannii infections.

Mutations in pmrA and pmrB or lpxA, lpxC and lpxD genes, leading to the addition of phosphoethanolamine on lipid A or complete loss of LPS, respectively, are the main mechanisms of polymyxin resistance reported to date among Acinetobacter spp. [14,15,17].

ED

However, it has been hypothesized that additional mechanisms of polymyxin resistance might be present in clinical isolates, considering that reports of isolates without known resistance

PT

mechanism have also been documented [19]. Our results showed that the mechanisms of resistance to polymyxin B varied significantly among A. baumannii clinical isolates. In contrast ind

CE

to previously reported data, the A027

strain acquired simultaneously mutations in both pmrB

and lpxA genes after polymyxin B exposure, resulting in a decrease of the lpxA transcription

AC

rate. Concomitant mutations in the pmrB and lpxA genes are uncommon, probably because the production of two different resistance mechanisms may not be advantageous for the microorganism due to additional energetic cost. More studies are necessary to determine the real contribution of each mutated gene for polymyxin B resistance phenotype. At the same time, when the resistance to polymyxin B had developed after exposure to this drug, the A027

ind

strain became susceptible to carbapenems, aminoglycosides, and cephalosporins. In addition, drugs that usually do not exhibit activity against A. baumannii, like vancomycin, teicoplanin, ind

oxacillin, and erythromycin passed to show in vitro activity against A027 . These modifications on antimicrobial susceptibility profile were previously described, and may be justified by LPS modifications [35-37].

11

ACCEPTED MANUSCRIPT The polymyxin-resistant A009 strain had many mutations in lpxC and lpxD, but not in pmrAB genes. Interestingly, this strain showed a less negative charge of cell surface, when compared with polymyxin-susceptible A027 strain. Mutations in LPS biosynthesis pathway

T

genes could explain this finding. After exposed to polymyxin B, no modifications in the

RI P

antimicrobial susceptibility profile, as well as in any genes evaluated in this study, were ind

observed in A009 .

SC

After polymyxin B exposure, both A. baumannii clinical isolates exhibited a strong condensation and darkening of intracellular material with the appearance of clear zones in the

observed. However, only A027

ind

MA NU

cytoplasm in TEM images. In addition, some cells presenting a discontinuous cell wall were was not able to resist to osmotic pressure (data not shown).

Morphological changes have been described in gram-negative strains exposed to polymyxins over decades. Studies with P. aeruginosa and E. coli showed numerous membrane projections and blebs production after exposure to polymyxins, respectively [38-43]. However, the role of

ED

these morphological changes in the polymyxins resistance phenotype needs to be better understood. According to Voget et al., the reduction of cytoplasmatic electron density may be

PT

due to loss of barrier function [42]. In our study, the peptidoglycan layer was thicker and more electron-dense in the polymyxin-resistant A009 isolate than in the -susceptible A027 isolate. It

CE

could be one of the reasons why the growth of A009 was not affected in the hypotonic medium, considering that a thicker peptidoglycan layer could represent a protective mechanism against

AC

the osmotic imbalance [44].

ind

The polymyxin-resistant A009 and its mutant A009

showed higher growth rates when ind

compared with polymyxin-susceptible A027 and its resistant mutant A027 . Such finding indicates that there was no loss of bacterial fitness in the A. baumannii initially screened as resistant to polymyxin by the routine laboratory. After exposure to polymyxin B, A027

ind

strain

had a significant reduction of growth, suggesting a decrease on its fitness. In addition, A027 was initially more virulent when compared to A009 by C. elegans assays; however, after exposed to polymyxin B, A027 observed in the A009

ind

ind

had a significant decrease of virulence, which was not

strain. Several studies have demonstrated that the exposure to colistin

reduced the bacterial fitness and virulence of A. baumannii ATCC 19606 strain [21-23,25,45]. However, Durante-Mangoni et al. have recently reported the emergence of colistin resistance

12

ACCEPTED MANUSCRIPT without loss of fitness and virulence in clinical extensively-multi drug resistant A. baumannii after prolonged colistin administration [26]. The fitness cost caused by acquisition of polymyxin resistance may explain the lower percentage of Acinetobacter spp. and Pseudomonas spp.

T

clinical isolates exhibiting this resistance phenotype [13,22]. However, the accumulation of

RI P

compensatory mutations may counterweigh the loss of bacterial fitness with the emergence of resistant and virulent strains [13,45].

SC

In summary, our results suggest that the resistance to polymyxins in A. baumannii isolates can be due to different mechanisms acting alone or in association, and varied

MA NU

according to each strain. Since we have observed distinct responses of clinical isolates after the polymyxin exposure, laboratory experiments testing control strains (ATCCs) and standard laboratory conditions may not represent the real life scenario, and might not lead to a complete

AC

CE

PT

ED

understanding of the mechanisms leading to polymyxin resistance.

13

ACCEPTED MANUSCRIPT Acknowledgments We would like to thank the National Council for Science and Technological Development (CNPq), Ministry of Science and Technology (Brazil), for providing a research

T

grant to A.C.G. (305535/2014-5) and the Fundação de Amparo à Pesquisa do Estado de São

RI P

Paulo (FAPESP) for financially supporting this study (2010/12891-9) and granting the PostDoctoral scholar fellowship to R.G. (2012/15458-0) and to R.C. (2012/15459-6).

SC

We also thank the Electron Microscopy Center - UNIFESP, especially to Prof. Edna Haapalainen, André Aguilera and Marcia Tanakai for their technical assistance with the

MA NU

transmission electron microscopy experiments.

Transparency Declarations

A.C.G. has received research funding and/or consultation fees from Astra-Zeneca, MSD, and Novartis. Other authors have nothing to declare. This study has not been financially added by

ED

any Diagnostic/Pharmaceutical company. This work was presented in part as a poster (C1th

1080) at the 53 Interscience Conference of Antimicrobial Agents and Chemotherapy - ICAAC in

AC

CE

PT

Denver, 2013.

14

ACCEPTED MANUSCRIPT References 1. Brazilian Health Surveillance Agency (ANVISA). Boletim Informativo: Segurança e qualidade em serviço de saúde n° 9: Relatório da resistência microbiana em infecções

T

primárias de corrente sanguínea confirmadas laboratorialmente relacionadas ao uso de

RI P

cateter venoso central em unidades de terapia intensiva. Accessed on 20 janeiro 2016. Available at: http://portal.anvisa.gov.br/wps/content/Anvisa+Portal/Anvisa/

SC

Inicio/Servicos+de+Saude/Assunto+de+Interesse/Boletim+Seguranca+do+ Paciente/Seguranca+e+qualidade+em+servico+de+saude+n+9, 2013.

MA NU

2. Vila J, Martí S, Sánchez-Céspedes J. Porins, efflux pumps and multidrug resistance in Acinetobacter baumannii. J Antimic Chemother 2007;59:1210-1215. 3. CDC. Antibiotic Resistance Threats in the United States. cdar-threats-2013-508, 2013. 4. European Centre for Disease Prevention and Control. Antimicrobial resistance surveillance in Europe 2013. Annual Report of the European Antimicrobial Resistance

ED

Surveillance Network (EARS-Net). Stockholm: ECDC; 2014. 5. Grosso F, Carvalho KR, Quinteira S, Ramos A, Carvalho-Assef AP, Asensi MD, Peixe

PT

L. OXA-23-producing Acinetobacter baumannii: a new hot spot of diversity in Rio de Janeiro? J Antimicrob Chemother. 2011;66(1):62-5.

CE

6. Werneck JS, Picão RC, Girardello R, Cayô R, Marguti V, Dalla-Costa L, Gales AC, Antonio CS, Neves PR, Medeiros M, Mamizuka EM, Elmor de Araújo MR, Lincopan N.

AC

Low prevalence of blaOXA-143 in private hospitals in Brazil. Antimicrob Agents Chemother. 2011;55(9):4494-5; author reply 4495. 7. Chagas TP, Carvalho KR, de Oliveira Santos IC, Carvalho-Assef AP, Asensi MD. Characterization of carbapenem-resistant Acinetobacter baumannii in Brazil (20082011): countrywide spread of OXA-23-producing clones (CC15 and CC79). Diagn Microbiol Infect Dis. 2014;79(4):468-72. 8. Merino M, Poza M, Roca I, Barba MJ, Sousa MD, Vila J, Bou G. Nosocomial outbreak of a multiresistant Acinetobacter baumannii expressing OXA-23 carbapenemase in Spain. Microb Drug Resist 2014;20:259-263. 9. Gheorghe I, Novais Â, Grosso F, Rodrigues C, Chifiriuc MC, Lazar V, Peixe L. Snapshot on carbapenemase-producing Pseudomonas aeruginosa and Acinetobacter

15

ACCEPTED MANUSCRIPT baumannii in Bucharest hospitals reveals unusual clones and novel genetic surroundings for blaOXA-23. J Antimicrob Chemother 2015;70:1016-1020. 10. Vasconcelos AT, Barth AL, Zavascki AP, Gales AC, Levin AS, Lucarevschi BR, Cabral

T

BG, Brasiliense DM, Rossi F, Furtado GH, Carneiro IC, da Silva JO, Ribeiro J, Lima KV,

RI P

Correa L, Britto MH, Silva MT, da Conceição ML, Moreira M, Martino MD, de Freitas MR, Oliveira MS, Dalben MF, Guzman RD, Cayô R, Morais R, Santos SA, Martins WM.

SC

The changing epidemiology of Acinetobacter spp. producing OXA carbapenemases causing bloodstream infections in Brazil: a BrasNet report. Diagn Microbiol Infect Dis

MA NU

2015;83:382-385.

11. Cardoso JP, Cayô R, Girardello R, Gales AC. Diversity of mechanisms conferring resistance to β-lactams among OXA-23-producing Acinetobacter baumannii clones. Diagn Microbiol Infect Dis 2016 [Epud ahead of print] 12. Marchaim D, Chopra T, Pogue JM, Perez F, Hujer AM, Rudin S, Endimiani A, Navon-

ED

Venezia S, Hothi J, Slim J, Blunden C, Shango M, Lephart PR, Salimnia H, Reid D, Moshos J, Hafeez W, Bheemreddy S, Chen TY, Dhar S, Bonomo RA, Kaye KS.

PT

Outbreak of colistin-resistant, carbapenem-resistant Klebsiella pneumoniae in metropolitan Detroit, Michigan. Antimicrob Agents Chemother 2011;55:593-599.

CE

13. Snitkin ES, Zelazny AM, Gupta J; NISC Comparative Sequencing Program, Palmore TN, Murray PR, Segre JA. Genomic insights into the fate of colistin resistance and

AC

Acinetobacter baumannii during patient treatment. Genome Res 2013;23:1155-1162. 14. Adams MD, Nickel GC, Bajaksouzian S, Lavender H, Murthy AR, Jacobs MR, Bonomo RA. Resistance to colistin in Acinetobacter baumannii associated with mutations in the PmrAB two-component system. Antimicrob Agents Chemother 2009;53:3628-3634. 15. Beceiro A, Llobet E, Aranda J, Bengoechea JA, Doumith M, Hornsey M, Dhanji H, Chart H, Bou G, Livermore DM, Woodford N. Phosphoethanolamine modification of lipid A in colistin-resistant variants of Acinetobacter baumannii mediated by the pmrAB twocomponent regulatory system. Antimicrob Agents Chemother 2011;55:3370-3379. 16. Park YK, Choi JY, Shin D, Ko KS. Correlation between overexpression and amino acid substitution of the PmrAB locus and colistin resistance in Acinetobacter baumannii. Int Antimicrob Agents 2011;37:525-530.

16

ACCEPTED MANUSCRIPT 17. Moffatt JH, Harper M, Harrison P, Hale JD, Vinogradov E, Seemann T, Henry R, Crane B, St Michael F, Cox AD, Adler B, Nation RL, Li J, Boyce JD. Colistin resistance in Acinetobacter baumannii is mediated by complete loss of lipopolysaccharide

T

production. Antimicrob Agents Chemother 2010;54:4971-4977.

RI P

18. Wand ME, Bock LJ, Bonney LC, Sutton JM. Retention of virulence following adaptation to colistin in Acinetobacter baumannii reflects the mechanism of resistance. J

SC

Antimicrob Chemother 2015;70:2209-2216.

19. Lee JY, Choi MJ, Choi HJ, Ko KS. Preservation of acquired colistin resistance in gram-

MA NU

negative bacteria. Antimicrob Agents Chemother 2015; 60:609-612. 20. Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, Yu LF, Gu D, Ren H, Chen X, Lv L, He D, Zhou H, Liang Z, Liu JH, Shen J. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect

ED

Dis. 2016;16(2):161-8.

21. Fernández-Reyes M, Rodríguez-Falcón M, Chiva C, Pachón J, Andreu D, Rivas L. The

PT

cost of resistance to colistin in Acinetobacter baumannii: a proteomic perspective. Proteomics 2009;9:1632-1645.

CE

22. López-Rojas R, Domínguez-Herrera J, McConnell MJ, Docobo-Peréz F, Smani Y, Fernández-Reyes M, Rivas L, Pachón J. Impaired virulence and in vivo fitness of

AC

colistin-resistant Acinetobacter baumannii. J Infect Dis 2011;203:545-548. 23. Hraiech S, Roch A, Lepidi H, Atieh T, Audoly G, Rolain JM, Raoult D, Brunel JM, Papazian L, Brégeon F. Impaired virulence and fitness of a colistin-resistant clinical isolate of Acinetobacter baumannii in a rat model of pneumonia. Antimicrob Agents Chemother. 2013;57:5120-5121. 24. López-Rojas R, McConnell MJ, Jiménez-Mejías ME, Domínguez-Herrera J, FernándezCuenca F, Pachón J. Colistin resistance in a clinical Acinetobacter baumannii strain appearing after colistin treatment: effect on virulence and bacterial fitness. Antimicrob Agents Chemother 2013;57:4587-589.

17

ACCEPTED MANUSCRIPT 25. Beceiro A, Moreno A, Fernández N, Vallejo JA, Aranda J, Adler B, Harper M, Boyce JD, Bou G. Biological cost of different mechanisms of colistin resistance and their impact on virulence in Acinetobacter baumannii. Antimicrob Agents Chemother 2014;58:518-526.

T

26. Durante-Mangoni E, Del Franco M, Andini R, Bernardo M, Giannouli M, Zarrilli R.

RI P

Emergence of colistin resistance without loss of fitness and virulence after prolonged colistin administration in a patient with extensively drug-resistant Acinetobacter

SC

baumannii. Diagn Microbiol Infect Dis 2015;82:222-226.

27. CLSI. Clinical Laboratory Standard Institute. Performance standards for antimicrobial

MA NU

susceptibility testing; Twenty-fourth Informational Supplement. Document M100-S25, Wayne, Pa. 2015.

28. La Scola B, Gundi VA, Khamis A, Raoult D. Sequencing of the rpoB gene and flanking spacers for molecular identification of Acinetobacter species. J Clin Microbiol 2006;44:827-832.

ED

29. CLSI. Clinical Laboratory Standard Institute Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard - Ninth

PT

Edition. Document M07-A9. Wayne, Pa. 2012. 30. Seifert H, Dolzani L, Bressan R, van der Reijden T, van Strijen B, Stefanik D et al.

CE

Standardization and inter-laboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J Clin Microbiol

AC

2005; 43:4328-4335. 31. Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233-2239. 32. Brenner S. The genetics of Caenorhabditis elegans. Genetics 1974;77:71-94. 33. Gales AC, Castanheira M, Jones RN, Sader HS. Antimicrobial resistance among Gramnegative bacilli isolated from Latin America: results from SENTRY Antimicrobial Surveillance Program (Latin America, 2008-2010). Diagn Microbiol Infect Dis 2012;73:354-360.

18

ACCEPTED MANUSCRIPT 34. Liscio JL, Mahoney MV, Hirsch EB. Ceftolozane/tazobactam and ceftazidime/avibactam: two novel β-lactam/β-lactamase inhibitor combination agents for the treatment of resistant Gram-negative bacterial infections. Int J Antimicrob Agents

T

2015;46:266-271.

RI P

35. Li J, Nation RL, Owen RJ, Wong S, Spelman D, Franklin C. Antibiograms of multidrugresistant clinical Acinetobacter baumannii: promising therapeutic options for treatment

SC

of infection with colistin-resistant strains. Clin Infect Dis 2007;45:594-598. 36. López-Rojas R, Jiménez-Mejías ME, Lepe JA, Pachón J. Acinetobacter baumannii

MA NU

resistant to colistin alters its antibiotic resistance profile: a case report from Spain. J Infect Dis 2011;204:1147-1148.

37. García-Quintanilla M, Carretero-Ledesma M, Moreno-Martínez P, Martín-Peña R, Pachón J, McConnell MJ. Lipopolysaccharide loss produces partial colistin dependence and collateral sensitivity to azithromycin, rifampicin and vancomycin in Acinetobacter

ED

baumannii. Int J Antimicrob Agents 2015;46:696-702. 38. Koike M, Iida K, Matsuo T. Electron microscopic studies on mode of action of

PT

polymyxin. J Bacteriol. 1969;97(1):448-52. 39. FEW AV. Electron microscopy of disrupted bacteria treated with polymyxin E. J Gen

CE

Microbiol. 1954;10(2):304-8. 40. Greenwood D. The activity of polymyxins against dense populations of Escherichia coli.

AC

J Gen Microbiol. 1975;91(1):110-8. 41. Alhanout K, Malesinki S, Vidal N, Peyrot V, Rolain JM, Brunel JM. New insights into the antibacterial mechanism of action of squalamine. J Antimicrob Chemother. 2010;65(8):1688-93. 42. Voget M, Lorenz D, Lieber-Tenorio E, Hauck R, Meyer M, Cieslicki M. Is transmission electron microscopy (TEM) a promising approach for qualitative and quantitative investigations of polymyxin B and miconazole interactions with cellular and subcellular structures of Staphylococcus pseudintermedius, Escherichia coli, Pseudomonas aeruginosa and Malassezia pachydermatis? VetMicrobiol. 2015;181(3-4):261-70.

19

ACCEPTED MANUSCRIPT 43. Mohamed YF, Abou-Shleib HM, Khalil AM, El-Guink NM, El-Nakeeb MA. Membrane permeabilization of colistin toward pan-drug resistant Gram-negative isolates. Braz J Microbiol. 2016;47(2):381-8.

T

44. Dimech GS, Soares LA, Ferreira MA, de Oliveira AG, Carvalho Mda C, Ximenes EA.

RI P

Phytochemical and antibacterial investigations of the extracts and fractions from the stem bark of Hymenaea stigonocarpa Mart. ex Hayne and effect on ultrastructure of

SC

Staphylococcus aureus induced by hydro alcoholic extract. Scientific World Journal 2013;2013:862763.

MA NU

45. Andersson DI, Hughes D. Antibiotic resistance and its cost: is it possible to reverse

AC

CE

PT

ED

resistance? Nat Rev Microbiol 2010;8:260-271.

20

ACCEPTED MANUSCRIPT Legend of Figures

Figure 1. Quantification of relative transcriptional levels of pmrAB genes in A. baumannii clinical

ind

mutant pair versus A027

mutant pair versus A009 parental strain.

RI P

parental strain. B. Relative transcription of A009

ind

T

isolates and their mutant pairs. A. Relative transcription of A027

Figure 2. Quantification of relative transcriptional levels of lpxACD genes in A. baumannii

SC

clinical isolates and their mutant pairs. A. Relative transcription of A027 and A009 clinical isolates versus A. baumannii ATCC 19606 strain. B. Relative transcription of A027 ind

mutant

mutant pair versus A009

MA NU

pair versus A027 parental strain. C. Relative transcription of A009

ind

parental strain.

Figure 3. TEM macrographs of A. baumannii clinical isolates cultured in the absence (A-B) or presence of polymyxin B (C-D). A, A027 polymyxin B susceptible clinical isolate; A1, High magnification detail of bacterium cell wall showing a smooth peptidoglycan layer (double arrow);

ED

B, A009 polymyxin B resistant clinical isolate; B1, Detail of cell wall showing a thicker and ind

electrondense polypeptidoglycan layer (double arrow); C, A027

laboratory derivative strain

PT

showing an electrondense deposit in the cytoplasm (); C1, High magnification of bacterium ind

showing a preserved cell wall and electron lucent area in the cytoplasm (); D, A009

mutant

CE

strain showing condensation of cytoplasmic material (). Note de presence of cells presenting a discontinuous cell wall (arrow); and D1, High magnification detail of A009

ind

laboratory

AC

derivative strain. Bars: left column (0.5 µm), right column (100 µm). Figure 4. Zeta potential measurement of cell surface of A. baumannii clinical isolates and their mutant pairs.

Figure 5. In vitro growth rate of A. baumannii clinical isolates and the polymyxin B-resistant mutant strains. Figure 6. Evaluation of virulence of A. baumannii strains using C. elegans lethality model. Number of days in which the worm was able to survival in contact with A. baumannii strains.

21

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA NU

SC

RI P

T

Figure 1

22

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA NU

SC

RI P

T

Figure 2

23

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA NU

SC

RI P

T

Figure 3

24

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA NU

SC

RI P

T

Figure 4

25

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA NU

SC

RI P

T

Figure 5

26

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA NU

SC

RI P

T

Figure 6

27

ACCEPTED MANUSCRIPT Table 1. A. baumannii clinical isolates and their mutant pairs evaluated in this study. PFGE profile

Polymyxin B MIC

Body Site of

(µg/mL)

Infection

A

a

0,25 (Susceptible)

Lower respiratory

16 (Resistant)

SC

A027

26/07/2007

B

Lower respiratory

MA NU

b

blaOXA-23, blaOXA-51, blaTEM-1

tract

A009

β-lactamase content

RI P

/(Susceptibility category)

Date

T

Strains

30/06/2007

blaOXA-51

-

blaOXA-23, blaOXA-51,

tract

>128 (Resistant)

B

64 (Resistant)

Mutant Pair

Mutant Pair

blaTEM-1 -

Susceptibility category according to CLSI (2015).

b.

Polymyxin B-resistant clinical isolate to, without polymyxins exposure.

PT

ED

a.

blaOXA-51

CE

ind

A009

A

AC

ind

A027

28

ACCEPTED MANUSCRIPT Table 2. Primers sequences used for PCR, sequencing and qRT-PCR. Fragment

PCR

Size (pb)

conditions

Sequence (5’-3’)

Primer

Reference

GGCGAAATGGCDGARAACCAC

95°C,

RI P

rpoB_F

T

PCR and Sequencing [24]

10’

900 GARTCYTCGAAGTTGTAACC

95°C,

MA NU

SC

rpoB_R

ED

PT

TGTGGTTCTCTGAAAGTTGGAA

pmrB_F

60°C, 35x 30” 72°C, 1’ 72°C,

95°C,

This study

10’ 1060

GGGTGCTCAGCTGTTCTTTC

95°C,

This study

30”

AC

pmrA_R

30”

10’

CE

pmrA_F

[24]

55°C, 35x 30”

AAATCGTGAATGGGCAATCT

72°C,

This study

1’30” 1914 pmrB_R

CTGCCCTTGGAATATGGTTC

72°C,

This study

10’

lpxA_F

TGAAGCATTAGCTCAAGTTT

95°C,

[13]

10’ 1179 lpxA_R

GTCAGCAAATCAATACAAGA

95°C,

[13] 35x

30”

29

ACCEPTED MANUSCRIPT lpxC_F

TGAAGATGACGTTCCTGCAA

50°C,

[13]

30” 1502 lpxC_R

TGGTGAAAATCAGGCAATGA

72°C,

[13]

CAAAGTATGAATACAACTTTTGAG

72°C,

1164 GTCAATGGCACATCTGCTAAT

qRT_PCR pmrA_F

GATGGTTTGGCTCAATTGGCG

SC

lpxD_R

RI P

lpxD_F

T

1’30” [13]

10’

[13]

This study

MA NU

227

pmrA_R

CGGGCAAGCAACTCATCAAAC

pmrB_F

GCAGCCATTATTCGTCGTGG

This study This study

229

pmrB_R

GTGCAGTCACAGGTGTTCGT

16S_F

CAGCTCGTGTCGTGAGATGT

This study [11]

150 [11]

CE

PT

ED

CGTAAGGGCCATGATGACTT

AC

16S_R

30

ACCEPTED MANUSCRIPT Table 3. Antimicrobial susceptibility profile of A. baumannii clinical isolates and their respective polymyxin B resistant mutants. a

MIC - µg/mL (Susceptibility category )

Polymyxin B

ind

A027

0,25 (S)

>128 (R)

Penicillin

>8

>8

Ampicillin

>8

>8

Oxacillin

>2

Piperacillin/Tazobactam

A009

RI P

A027

T

Antimicrobials

16 (R)

b

ind

A009

64 (R) >8

8

8

≤0.25

>2

>2

>64 (R)

8 (S)

≤2 (S)

4 (S)

Cefoxitin

>16 (R)

16 (S)

>16 (R)

>16 (R)

Ceftriaxone

>32 (R)

4 (S)

8 (S)

8 (S)

Ceftazidime

>16 (R)

8 (S)

2 (S)

2 (S)

Cefepime

>16 (R)

4 (S)

0.5 (S)

1 (S)

Aztreonam

>16 (R)

4 (S)

8 (S)

16 (S)

Imipenem

>8 (R)

2 (S)

0.12 (S)

0.25 (S)

Meropenem

>8 (R)

1 (S)

0.12 (S)

0.25 (S)

>32 (R)

≤4 (S)

≤4 (S)

8 (S)

>8 (R)

>8 (R)

4 (R)

4 (R)

>2 (R)

>2 (R)

≤0.25 (S)

≤0.25 (S)

>4 (R)

>4 (R)

≤0.5 (S)

≤0.5 (S)

1

0.5

0.25

0.12

>2

>2

>2

>2

>4

≤0.5

>4

>4

>16

≤2

>16

>16

Vancomycin

>16

≤0.5

>16

>16

Linezolid

>4

>4

>4

>4

MA NU

ED

Amikacin Gentamicin

PT

Ciprofloxacin Levofloxacin

Erythromycin

AC

Teicoplanin

CE

Tigecycline Clindamycin

SC

>8

a. Susceptibility category according to CLSI [18] breakpoints. S: susceptible; R: resistant b.

Polymyxin B-resistant clinical isolate, without polymyxin B exposure.

31

ACCEPTED MANUSCRIPT Table 4. DNA sequence analysis of pmrAB and lpxACD genes of A. baumannii clinical isolates and their corresponding polymyxin-resistant mutants. Strain

pmrB

lpxA

lpxC

lpxD

WT

WT

WT

WT

WT

WT

Tre28- and

ISAba125

WT

WT

Asn8Ser,

Ind

A027

WT

WT

PT

WT

WT

Tyr6Phe, Glu47Asp, His49Tyr,

Asp45Asn,

Asp51His, Val55Ala, Tyr61Phe,

Lys130Arg,

Ala66Thr, Ile98Leu, Ser99Thr,

Ser147Arg and

Thr101Lys, Thr118Ala, Val138Ile,

Asp287Asn

Asn148Asp, Arg170Gly, Ile175Val andSer178Asn

Identical to its

Identical to its parental strain

parental strain

CE

WT

WT

AC

Ind

A009

ED

MA NU

A009

SC

-45Glu

RI P

T

A027

pmrA

32

ACCEPTED MANUSCRIPT Highlights

Our results showed that the mechanisms of resistance to polymyxin B varied

T



data, the A027

ind

RI P

significantly between A. baumannii clinical isolates. In contrast to previously reported strain had acquired simultaneously mutations in both pmrB and lpxA

genes after polymyxin B exposure.

By transmission electronic microscopy, the exposure to polymyxin B induced a strong

SC



condensation and darkening of intracellular material of A. baumannii isolates.

MA NU

The C. elegans assays showed that the A027 strain, which was initially susceptible to polymyxin B, was more virulent than polymixin-resistant A009 strain. However, after polymyxin B exposure, A027

ind

strain displayed a significant decrease of virulence, ind

strain.

CE

PT

ED

which was not observed in the A009

AC



33