Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: Identification and expression in response to water accommodated fractions (WAFs)

Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: Identification and expression in response to water accommodated fractions (WAFs)

Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15 Contents lists available at ScienceDirect Comparative Biochemistry and Physiology, P...

860KB Sizes 0 Downloads 20 Views

Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C journal homepage: www.elsevier.com/locate/cbpc

Ecdysone receptor (EcR) and ultraspiracle (USP) genes from the cyclopoid copepod Paracyclopina nana: Identification and expression in response to water accommodated fractions (WAFs) Jayesh Puthumana 1, Min-Chul Lee 1, Jeonghoon Han, Hui-Su Kim, Dae-Sik Hwang, Jae-Seong Lee ⁎ Department of Biological Science, College of Science, Sungkyunkwan University, Suwon 16419, South Korea

a r t i c l e

i n f o

Article history: Received 5 October 2016 Received in revised form 9 November 2016 Accepted 22 November 2016 Available online 24 November 2016 Keywords: Copepod Paracyclopina nana Ecdysone receptor (EcR) Ultraspiracle (USP)

a b s t r a c t Ecdysteroid hormones are pivotal in the development, growth, and molting of arthropods, and the hormone pathway is triggered by binding ecdysteroid to a heterodimer of the two nuclear receptors; ecdysone receptors (EcR) and ultraspiracle (USP). We have characterized EcR and USP genes, and their 5′-untranslated region (5′UTR) from the copepod Paracyclopina nana, and studied mRNA transcription levels in post-embryonic stages and in response to water accommodated fractions (WAFs) of crude oil. The open reading frames (ORF) of EcR and USP were 1470 and 1287 bp that encoded 490 and 429 amino acids with molecular weight of 121.18 and 105.03 kDa, respectively. Also, a well conserved DNA-binding domain (DBD) and ligand-binding domain (LBD) were identified which confirmed by phylogenetic analysis. Messenger RNA transcriptional levels of EcR and USP were developmental stage-specific in early post-embryonic stages (N3-4). However, an evoked expression of USP was observed throughout copepodid stage and in adult females. WAFs (40 and 80%) were acted as an ecdysone agonist in P. nana, and elicited the mRNA transcription levels in adults. Developmental stage-specific transcriptional activation of EcR and USP in response to WAFs was observed. USP gene was down-regulated in the nauplius in response to WAF, whereas up-regulation of USP was observed in the adults. This study represents the first data of molecular elucidation of EcR and USP genes and their regulatory elements from P. nana and the developmental stage specific expression in response to WAFs, which can be used as potential biomarkers for environmental stressors with ecotoxicological evaluations in copepods. © 2016 Elsevier Inc. All rights reserved.

1. Introduction Ecdysteroids are invertebrate specific steroid hormones that play a pivotal role in the development, growth, and molting of arthropods (Kato et al., 2007; Tan and Palli, 2008; Hwang et al., 2010a). Molecular elucidation of the ecdysteroid, 20-hydroxyecdysone (20E), has led to the identification of the ecdysone receptor (EcR) as a heterodimer of two nuclear receptors (NRs) - EcR (NR1) and ultraspiracle (USP) protein (NR2) (Koelle et al., 1991; Yao et al., 1993; Nakagawa and Henrich, 2009; Mane-Padros et al., 2012). EcR is a ligand-dependent transcription factor which activates the target genes by forming a heterodimer with USP (Kato et al., 2007). Heterodimer formation of these NR family genes is essential for gene activation in arthropods (Yao et al., 1993; Hwang et al., 2010a; Kato et al., 2007). EcR/USP heterodimer binds to a number of ecdysone response elements and sequence motifs in the promoter of various ecdysteroid-responsive genes (Nakagawa and Henrich, 2009). The USP, an invertebrate homolog of the retinoid X ⁎ Corresponding author. E-mail address: [email protected] (J.-S. Lee). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.cbpc.2016.11.002 1532-0456/© 2016 Elsevier Inc. All rights reserved.

receptor (RXR), stimulates weak binding of 20E and EcR (Yao et al., 1993; Billas et al., 2001; Hwang et al., 2016). Thus, EcR/USP complex induces transcriptional activation of early genes in moulting process (Fig. 1), which triggers the downstream genes of the ecdysteroidregulated signalling pathways in arthropods (King-Jones and Thummel, 2005). As EcR/USP complexes tightly control the regulatory mechanism of signal transduction, the modulation of EcR and USP genes will provide a better understanding of ecdysteroid pathways in arthropods. The expression of EcR and USP genes and its potential roles during embryogenesis and molting have been extensively investigated in arthropods (Kato et al., 2007; Bortolin et al., 2011). For example, the function of EcR and USP in the regulation of reproduction and embryogenesis in the fly Drosophila melanogaster (Oro et al., 1992), the red flour beetle Tribolium castaneum (Xu et al., 2010), and the mosquito Aedes aegypti (Martin et al., 2001) was well studied. Besides, EcR/ USP has proven to be an effective target for insecticides and other chemicals/environmental stressors (e.g. BDE-47) (Nakagawa and Henrich, 2009; Hwang et al., 2016). The ligand-dependent activation of EcR and USP genes by chemicals (e.g. tebufenozide and Ponasterone A [PoA]) was studied in the water flea Daphnia magna and D. melanogaster (Kato et al., 2007). Also, the adverse effects of a number

8

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

Y-organ

Ecdysone (E)

20-hydroxyecdysone (20E)

CYP315 / CYP314

EcR USP

Molting process

Fig. 1. Illustration of ecdysteroid signalling pathways in the copepod P. nana and the involvement of EcR and USP genes (modified from Hwang et al., 2016).

of ecdysteroid - agonist or antagonists (testosterone, tebufenozide, and polychlorinated biphenyls) on EcR and USP were reported from invertebrates (Zou and Fingerman, 1997; LeBlanc et al., 2000; Dinan et al., 2001; Mu et al., 2005; Planello et al., 2008). Recently, the persistent organic pollutant BDE-47 has also tested on the copepod Tigriopus japonicus and confirmed the adverse effect as developmental retardation by interacting with EcR and USP genes (Hwang et al., 2016). As hormonal systems of aquatic animals are the target for many environmental stressors (e.g. endocrine disruptors [EDs]) (Kato et al., 2007; Hwang et al., 2010a), the modulation of EcR and USP genes is critical to understanding the mechanistic toxicology. However, the major studies were focused only on decapods and insects, and little is known about the EcR and USP genes in copepods and their interaction with environmental stressors. Thus, information on EcR and USP genes in copepods, which are considered as promising marine model organisms, is vital to study endocrine systems and to understand the adverse effects of environmental stressors on organisms (Ara et al., 2002; Raisuddin et al., 2007; Hwang et al., 2010a; Dahms et al., 2016). Copepods play a major role in the marine ecosystem as a link between producers (phytoplankton) and high trophic consumers (fish) (Raisuddin et al., 2007). Particularly, the cyclopoid copepod Paracyclopina nana has been recognised as an aquatic model organism, considering the small size (~ 600 μm), short life cycle (2 weeks), ease of maintenance in the laboratory, and high sensitivity to the environmental conditions and stressors (Lee et al., 2012; Kim et al., 2016; Dahms et al., 2016). As a platform for ecotoxicological and environmental genomics studies, P. nana has been extensively used to test wide variety of environmental stressors (e.g., crude oil, UV, and gamma radiations) (Won et al., 2014; Won and Lee, 2014; Han et al., 2015; Dahms et al., 2016). Despite the various biological markers identified, RNA-seq based whole transcriptome data on xenobiotics metabolism is an advantage to using this species in environmental toxicology

research (Won and Lee, 2014; Lee et al., 2015; Dahms et al., 2016). Recently, biomarkers for the evaluation of adverse effects of carbon nanotubes (CNTs) were identified from P. nana (Kim et al., 2016). However, to date, no information is available on the effects of water accommodated fractions (WAFs) of crude oil on ecdysteroid signalling pathways, especially the interaction with EcR and USP proteins of P. nana. Thus, this species is a suitable model species for increasing our understanding of the effects of environmental stressors on signal transduction of ecdysteroid hormone pathways in arthropods. In this study, we focus on the molecular characterization of EcR and USP genes and their 5′ untranslated regions (UTRs) to understand the domain structure and regulatory motifs in P. nana. Also, the potential function of EcR and USP in regulation of metamorphosis was examined with the differential effects of WAFs on ECR/USP of the nauplii and adult P. nana. This study will provide a better understanding of how environmental stressors affect endocrine system of marine copepods by interacting with EcR and USP genes. 2. Materials and methods 2.1. Culture and maintenance of Paracyclopina nana The cyclopoid copepod P. nana was maintained in filtered artificial seawater (ASW) (TetraMarine Salt Pro, Tetra™, Cincinnati, OH, USA) under standard laboratory conditions of 15 practical salinity unit (psu) salinity, 12:12 h (light:dark) photoperiod at 25 °C in a micro-sensor controlled environmental chamber (MIR-553, Sanyo; Gunma, Japan). Green microalgae Tetraselmis suecica (~6 × 104 cells/ml) were given as live feed for every 24 h. The density of animals in the culture medium was monitored every 48 h and was sub-cultured during the exponential growth phase (Kim et al., 2016). Morphometric analysis followed by molecular characterization of cytochrome oxidase 1 (CO1) DNA of the

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

mitochondrial genome (Ki et al., 2009) was performed to confirm the species identity. 2.2. Cloning of P. nana EcR and USP genes and analysis of the promoter region The sequences of EcR and USP genes were identified in the P. nana RNA-seq (Lee et al., 2015) and genome database (unpublished data) using the similar gene sequences from the copepod T. japonicus (Hwang et al., 2010a). The EcR and USP coding sequences were subjected to BLAST analysis in the GenBank non-redundant (nr) amino acid sequence database to confirm the sequence similarities. Conserved domains of EcR and USP genes such as the DNA binding domain (DBD) and ligand binding domain (LBD) were analyzed through Pfam hidden Markov model (HMM) search (http://pfam.sanger.ac.uk), Motif Scan (http://myhits.isb-sib.ch/cgi-bin/motif_scan), and web-based NCBI's conserved domain database (CDD) (Marchler-Bauer et al., 2011; Jeong et al., 2015). The amplicons were sequenced in ABI PRISM 3700 DNA analyser and the putative transcription factor-binding sites were screened using Genetyx version 7.0 (Genetyx, Tokyo, Japan). 2.3. Phylogenetic analysis To examine the phylogenetic position of EcR and USP protein, multiple alignments of deduced amino acid sequences of EcR and USP protein were performed using Clustal X 1.83 software (Thompson et al., 1997) with those of other species. Sequences were retrieved from GenBank/ DDBJ/EMBL databases, and the DBD and LBD of the sequences were aligned. The sequence gaps and missing data matrices were excluded from the phylogenetic analysis. For the analysis, the pairwise alignment parameter settings were; 10 for gap opening, 0.1 for gap extension and multiple alignment parameters of 10 for gap opening and 0.2 for gap extension. The aligned DBD and LBD data matrix were converted to nexus format and was analysed using Mr Bayes program (v3.1.2) (Huelsenbeck and Ronquist, 2001) with the general time-reversible (GTR) model the Jones, Taylor and Thornton (JTT) amino acid substitution matrix. Total of 1 × 106 generations were conducted using four parallel Monte Carlo Markov Chains (MCMCs) to approximate the posterior probabilities, and the sampling frequency was assigned at every 100 generations. After analysis, the first 1 × 104 generations were deleted as the burn-in process, and the consensus tree was constructed and then visualised with the PHYLIP tree view software. Each branch node indicated a Bayesian posterior probability of N0.50. 2.4. Transcriptional activation of EcR and USP at different developmental stages Modulation of EcR and USP mRNA transcripts were analysed at different developmental stages, including three nauplius stages (N1, N2–5, and N6), three copepodid stages (C2, C4, and C5), and adult males and females (Hwang et al., 2010a). The 2 μg of total RNA was extracted from ~ 200 adults and used for reverse transcription to cDNA using SuperScript™ III reverse transcriptase (Invitrogen) in a total reaction volume of 20 μl. Real-time quantitative RT-PCR (qRT-PCR) was performed to assess the gene modulation.

9

To examine the effects of WAF on the development of P. nana, 12 h post-hatched nauplii were used. For each experiment, ten nauplii were transferred to 12-well cell culture plate (30012, SPL Life Science Co. Ltd.; Seoul, South Korea) containing different concentrations of WAFs (20, 40, and 80%) prepared in ASW (15 psu) in triplicates. Animals were fed with 100 μg/l of T. suecica (~ 6 × 104 cells/ml) every 24 h throughout the experiment. Developmental stages were observed once every 24 h under a stereomicroscope (SZX-ILLK200, Olympus, Tokyo, Japan) for 20 days. WAFs-induced impacts on the development were calculated by compared with that of control. 2.6. Modulation of EcR and USP genes in response to WAFs To examine the effects of WAFs exposure on EcR and USP mRNA transcripts, the adult copepods (~200) were exposed to WAFs (40 and 80%) for 96 h in triplicate. After exposure to WAFs, total RNA was extracted and the modulation of EcR and USP mRNA transcripts were measured by quantitative real-time PCR (qRT-PCR). Total mRNA from ~500 adult copepods was isolated with TRIzol® reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) with a sterile tissue grinder and stored at −80 °C until use. 2.7. Real-time quantitative RT-PCR To examine the mRNA transcripts pattern of EcR and USP genes, realtime qRT-PCR was performed in CFX96™ RT-PCR (Bio-Rad, Hercules, CA, USA), as per manufacturer's direction. Amplifications were performed in the presence of SYBR® Green (Molecular Probes Inc., Invitrogen, Waltham, MA, USA) using 1 μl cDNA and 0.2 μM gene specific primers (Table 2). The thermal profile for qRT-PCR was 94 °C/4 min; 35 cycles of 94 °C/30 s, 55 °C/30 s, 72 °C/30s. Melting curve analyses were also monitored to check any non-specific amplification with a thermal profile of 95 °C/1 min; 55 °C/1 min; 80 cycles of 55 °C/10 s with 0.5 °C increase per cycle. All the experiments were performed in triplicate. The threshold cycle (Ct) between the samples was normalised by P. nana 18S rRNA gene as an endogenous control. The fold change analysis of relative gene expression was determined using the comparative threshold cycle 2−ΔΔCt method (Livak and Schmittgen, 2001). To compare transcriptional levels, normalised fold difference (relative) were presented as a heat map in developmental stage-specific expressions, whereas bar diagrams were used for representing environmental stressors induced changes. 2.8. Statistical analysis The data of all the experiments were expressed as the mean value with standard error (mean ± SE). Tukey's test was used to verify the normal distribution and homogeneity of variances of the observed data among the developmental stages specific gene expression study. Significant differences between observations of control and the test groups in WAF exposure study were analysed using Student's paired t-test (P b 0.05). All the statistical analyses were performed using SPSS® version 21 software (SPSS Inc., Chicago, IL, USA). 3. Results 3.1. Annotation of EcR and USP genes and analysis of the promoter regions

2.5. Impact of WAF on post-embryonic development of P. nana Standard WAF for this experiment was prepared from Iranian heavy crude oil as shown described in Han et al. (2014) and Won et al. (2016). Briefly, crude oil and ASW were mixed in the ratio of 1:4 (w/v) (25 g crude oil/l of 30 psu ASW) with constant agitation for 18 h at 25 °C in a glass carboy with Teflon coated cap. Then, the mixture was allowed to settle for 6 h and the water phase, which contained the watersoluble part of crude oil, was used as WAF.

The full-length cDNA of P. nana EcR and USP genes were obtained by screening of RNA-seq database followed by rapid amplification of cDNA ends (RACE) techniques. The total length of the complete open reading frame (ORF) of EcR was 1470 bp, encoding 490 amino acids (aa) with 121.18 kDa molecular weight, whereas 1287 bp with 429 amino acid sequences having 105.03 kDa molecular weight for USP gene (Suppl. Figs. 1 and 2). The deduced amino acid sequences of EcR and USP were analogous to T. japonicus (52 and 51%), Daphnia magna (33 and 46%),

10

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

Crangon crangon (38 and 43%), Apis mellifera (37 and 31%), D. melanogaster (23 and 33%), Bombyx mori (32 and 33%), and T. castaneum (38 and 43%) (Table 1). While comparing the amino acids of these species with the deduced amino acid sequences of EcR and USP of P. nana, the DBD (C domain) and LBD (E/F domain) were conserved across the species (Suppl. Fig. 3). According to their coding sequences, the annotated domain structures of EcR and USP showed four domains (A/B, C, D, E/F) in the gene structure (Fig. 2). The amino acid coding sequences for each domain was different for EcR and USP. In EcR, the cDNA encodes 121 aa for A/B domain, 73 aa for C and D domains and 222 aa for E/F domain. Whereas USP comprises A/B, C, D and E/F domains with 74, 77, 40 and 237 aa respectively. The DNA binding domains (C domain) showed a high level of conservation with other arthropods (Table 1). The 5′-untranslated region (UTR) showed the response elements involved in the transcriptional regulation of the EcR and USP genes. Three different types of motifs were detected in the 5′ promoter region using the motif search of Genetyx ver. 7.0. Both the promoter regions were b1000 bp upstream of the transcription start site (ATG). The transcription responsive elements such as antioxidant response element (ARE), aryl hydrocarbon response element (AhRE), and xenobiotic response element (XRE) were identified from EcR, whereas AhRE was absent from USP promoter region. In EcR promoter region, three XREs were arranged at − 1257, − 3597, and − 4073 upstream of ATG; two AREs were arranged at − 1045 and − 4073, and one AhRE at − 2058. Whereas in USP, one XRE (at −2036) and four AREs (−919, −3240, −4457, and −4494) were observed (Fig. 3). 3.2. Phylogenetic analysis Phylogenetic relationships were performed by the Bayesian analysis using LBD sequences of EcR and USP and compared with seven arthropods obtained from the database (National Centre for Biotechnology Information (NCBI): http://www.ncbi.nlm.nih.gov/). The unrooted dial tree showed that EcR and USP were having highest similarity to the EcR and USP of the copepod T. japonicus (Fig.4). 3.3. Developmental stage-specific transcriptional activation of EcR and USP genes Developmental stage-specific mRNA transcript levels of the EcR and USP genes were measured in naupliar stage groups (N1-2, N3-4, N5-6), copepodid stage groups (C1-2, C3-4 and C5), and adult groups (male

DBD

LBD

A) EcR A/B (121)

C

D

E/F

(73)

(73)

(222)

B) USP A/B

C

D

E/F

(74)

(77)

(40)

(237)

DBD

LBD

Fig. 2. Schematic representation of P. nana EcR (A) and USP protein structures explaining the conserved domains and their length in terms of amino acid sequences. DBD: DNAbinding domain, LBD: ligand-binding domain, A/B: amino-terminal domain for ligandindependent transcriptional activation, C: central DBD with highly conserved zinc-finger motifs, D: hinge between the C and E/F domains which harbour nuclear localization signals, E/F ligand-binding domain for ligand-dependent transcriptional activation (modified from Nakagawa and Henrich, 2009).

and female) (Fig. 5A). EcR gene was highly expressed in N1-N6 stages, especially at the N3-4 stage. Among the copepodid stages (C1-C5) and adults, EcR showed the highest expression in early copepodid stage (C1-2) and in the adult females. Except at the N3-4 stage, USP was highly expressed in C1-C5 stages and in adult females. Compare to EcR, a higher level of USP expression was observed in copepodid stages and adult female (Fig. 5B and Suppl. Fig. 4). 3.4. Effects of WAFs on post-embryonic development The post-embryonic developments from nauplius (N) to copepodid (C) and adult (A) stages of P. nana in response to different concentrations of WAFs (20, 40, and 80%) were measured and compared with the control. As shown in Fig. 6, the developmental time for each developmental stage (N-C/C-A) was significantly delayed (P b 0.05) in response to 40 and 80% WAFs compared to 20% WAFs and the control. Particularly, P. nana exposed to 80% WAFs, the developmental time from N-C and C-A showed ~6 and 7 days respectively, whereas at 40% WAFs these were ~1 and 3 days, respectively (Fig. 6). 3.5. Modulation of EcR and USP genes in response to WAFs

Table 1 Conserved domain structures of A) EcR and B) USP genes and their degree of similarities. Species

A) EcR Tigriopus japonicus (ADD82902) Daphnia magna (BAF49030) Crangon crangon (ACO44665) Apis mellifera (NP_001091685) Drosophila melanogaster (NP_724456) Bombyx mori (BAA07890) Tribolium castaneum (NP_001107650) B) USP Tigriopus japonicus (AID52845) Daphnia magna (BAF49028) Crangon crangon (ACO44668) Apis mellifera (NP_001011634) Drosophila melanogaster (NP_476781) Bombyx mori (NP_001037470) Tribolium castaneum (EFA04649)

Total length (amino acids)

Identity (%) A/B C

D

E/F Total

546 693 440 629 849

9 5 1 5 7

80 76 76 78 73

18 12 5 118 6

68 59 55 58 25

52 33 38 37 23

603 549

6 9

69 5 78

44 57

32 38

The effect of WAFs exposure on modulation of EcR and USP genes over time in the nauplius and adult P. nana were shown in Fig. 7. During exposure to different concentrations of WAFs (20, 40, and 80%), differential expression of EcR and USP genes were observed in the nauplius. EcR was not activated by WAFs, whereas USP was down-regulated in the nauplius, irrespective of the concentration of exposed WAFs (Fig. 7A). Concentration and time-dependent activation of EcR and USP genes were observed when adult P. nana exposed to 40 and 80% WAFs for 48 h (Fig. 7B and C). The mRNA transcripts of USP, irrespective of the concentration WAFs, were not activated till 12 h post-exposure and then the significant up-regulation observed (P b 0.05) at 24 and Table 2 GenBank accession numbers and primer sets used in this study.

546 693 440 629 849

16 22 23 20 18

88 88 87 88 90

17 4 12 7 10

53 47 44 41 29

51 46 43 31 33

603 549

22 26

88 10 89 9

31 42

33 43

Gene

GenBank accession no. Oligo name Sequence (5′- N 3′)

Pn-EcR

KX789413

Pn-USP

KX789414

Pn-18S rRNA FJ214952

F R F R F R

TCACGAAGGAGAACTACAAAC TGATGGCGGTCAATAATC CGCACCCTCATCATACAGAC GGGTGCGACAATGCTCTTC TTTAGGAATGGCCTTGTTCG AACCAAAGGCAGCCAAATAA

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

11

A) EcR promoter region ARE

AhRE

atg

ARE

-5 kb XRE

XRE

XRE 1 kb

B) USP promoter region ARE

atg

ARE

ARE

-5 kb XRE ARE: Antioxidant response element AhRE: Aryl hydrocarbon response element XRE: Xenobiotic response element

1 kb

Fig. 3. The nucleotide sequences of the 5′-untranslated region (5′-UTR) of the EcR and USP gene showing transcriptional regulation motifs upstream (−5 kb) of the start codon (ATG). The representative positions (not in scale) of the putative ARE: Antioxidant response element AhRE: aryl hydrocarbon response element and XRE: xenobiotic response element are provided. The arrow (black) indicates the starting of open reading frame (ORF). The putative transcription factor-binding sites (motifs) were screened using Genetyx version 7.0.

48 h post-exposure. However, EcR gene was found significantly (P b 0.05) activated in both the concentrations of WAFs (40 and 80%), suggesting EcR gene of adult P. nana is highly responsive to WAFs, compared to USP gene. Overall, a differential expression pattern of EcR and USP genes were observed in the nauplius stage and adult P. nana in response to WAFs. 4. Discussion In this study, two dimerizing partners of the functional ecdysone receptor, EcR and USP genes, were identified the first time from the cyclopoid copepod P. nana and found that both genes were encoded by single exons with four domains (A/B, C, D, E/F). The DBD (C-domain) was highly conserved with those of other arthropods (Fig. 2; Suppl. Fig 3). Similar to this finding, previously, four and five domains in EcR and USP were reported from the copepod T. japonicus (Hwang et al., 2010a) and the water flea D. magna (Kato et al., 2007). Moreover, several studies have reported the presence of multiple exons especially in EcR of the arthropods T. castaneum (Tan and Palli, 2008) and B. mori (Shirai et al., 2007). EcR and USP are nuclear receptors (NR) family genes, and the highly conserved DBDs and moderately conserved LBDs are the characteristic features that confer specificity and activation (Wurtz et al., 1996; Billas et al., 2001). EcR needs to heterodimerize with its partner USP for the stabilization of a ligand-binding configuration (Billas et al., 2003) and the ligand binding requires a portion of the EcR-LBD to be stiffened by the anchoring of USP through interface contacts, allowing the more flexible region of the LBD to mould around the ligand (Billas et al., 2003). Phosphorylation of tyrosines on EcR and USP allows the formation of new signalling complexes and thus leads to activation of signalling pathways (Sridhara, 2012). The highly variable amino-terminal (A/B) region interacts with other transcriptional factors, and is responsible for a ligand-independent transcriptional activation (Nakagawa and Henrich, 2009). Also this N-terminal transactivation domain (A/B) in the protein structure generates different isoforms of EcR and USP in arthropods (Kato et al., 2007). These isoforms are formed by alternative promoting and splicing in arthropods (Shirai et al., 2007; Lafont, 2000a). For example, three isoforms of EcR have been reported from D. melanogaster and D. magna, while two isoforms were from T. castaneum and B. mori with varied A/B domain and identical C and E/F domains (Talbot et al., 1993; Kato et al., 2007; Shirai et al., 2007; Tan and Palli, 2008). Moreover, each isoform had

different tissue-specific expression patterns and distinct roles during metamorphosis in T. castaneum and B. mori (Tan and Palli, 2008; Shirai et al., 2007). In this study, the developmental stage specific differential expression patterns of EcR and USP were observed in the P. nana in response to WAFs (discussed below). Though we could identify EcR and USP genes from P. nana, we could not rule out the possible existence of isoforms due to variation in the A/B domain. While analyzing the 5′-UTR, three response elements such as XRE (GCGTG), ARE (TGAYNNNGC), and AhRE (CACGC) were identified at the promoter region of EcR, whereas XRE and ARE elements were found from USP (Fig. 3). The 5′-UTR (5 kb) of EcR and USP were examined and the regulatory regions (motifs) were identified using the motif scan program of Genetyx ver. 7.0. Interestingly, both EcR and USP have ARE sites at the proximal region of ATG, upstream of −1045 and − 919 bp, respectively in the 5′-UTR region. In T. japonicus EcR (Tj-EcR), XRE was reported at the proximal region of ATG at 5′ UTR (Hwang et al., 2010a). The responsible elements sites (XRE, ARE, and AhRE) in the promoter structure of EcR and USP confer specificity to ligand binding and are responsible for ligand-dependent transactivation (Billas et al., 2001). In the copepod T. japonicus, they had three heat shock protein responsive elements and one XRE in EcR gene promoter region (Hwang et al., 2010a). Also, regulatory motifs such as interleukin enhancer binding factor (ILF), cAMP-responsive element (CRE) and XRE were identified from the EcR gene promoter of B. mori (Shirai et al., 2007). Characterization of promoter elements is a must to identify the functional significance of cis-acting responsive elements in the 5′-UTR of EcR and USP (Hwang et al., 2010a). Though the regulatory element motifs were identified from EcR and USP of P. nana, the functional significance could not be revealed through this study. However, a differential interaction of xenobiotic responsive elements, which induce the development stage specific expression of EcR and USP were observed in response to WAFs (discussed below). Phylogenetic relationship of the LBD of EcR and USP showed very distinct topology which was clustered in a separate clade but was closer to copepod (T. japonicus) and arthropods (Fig. 4). However, more similarity was shown towards the crustaceans than the insects. Similar findings were observed in T. japonicus which formed a separate clade of crustacean EcR (Hwang et al., 2010a). Moreover, EcR of Marsupenaeus japonicus and EcR and USP of D. magna were also separated from insects (Asazuma et al., 2007; Kato et al., 2007). However, the similarity of Daphnia EcR and USP were more towards the fruit fly than human

12

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

Fig. 4. Phylogenetic analysis of the deduced amino acid sequences for P. nana EcR and USP genes with those of other crustacean and insects using Bayesian method. The scale bar represents genetic distance and numbers at the unrooted branch nodes representing the confidence level of posterior probability.

(Kato et al., 2007). The separate cluster of P. nana EcR and USP gene products suggests that EcR and USP have evolved in parallel, despite their functional similarity in ecdysteroid signal transduction. In order to confirm that EcR and USP play an important role in the development, we examined stage-specific differential mRNA expressions in each developmental stage (Fig. 5). Ecdysteroid signalling pathwayrelated genes have a role in both reproduction and development of ecdysozoan (Oro et al., 1992; Fahrbach et al., 2011; Hwang et al., 2016). As reported in the previous studies (Hwang et al., 2010a), EcR gene was highly expressed in N1-N6 stages, especially at the N3-4 stage, whereas USP gene elicited at C1–C5 stages and in adults. However, in Daphnia, nine-fold differences in expression level of EcR and USP were observed with highly evoked EcR pattern during embryogenesis (Kato et al., 2007). In the copepod T. japonicus, EcR and USP showed the highest expression levels at N5-6 stages (Hwang et al., 2016).

These developmental stage-specific expressions pattern are mainly due to the molting and metamorphosis-inducing factor (20E), which reported in D. melanogaster (Sullivan and Thummel, 2003). RNAi-based gene silencing confirmed the importance of EcR and USP in the early metamorphosis of Blattella germanica (Cruz et al., 2008). In the adult female of P. nana, USP gene was highly expressed. To substantiate this finding, similarly observation was made in T. japonicus, in which USP was highly expressed in adult female (Hwang et al., 2016). Also several studies reported that USP was a necessary factor for embryonic development, molting, and fertilisation from D. melanogaster (Oro et al., 1992), T. castaneum (Xu et al., 2010), and A. aegypti (Martin et al., 2001). The observed distinct expression pattern of EcR and USP may be related to molting events in P. nana, as functional EcR receptor in the ecdysteroid signal cascade is the outcome of EcR/USP dimerization. Moreover, ecdysteroids involve in the development, growth, and molting and

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

13

A) Developmental stages

B) Gene expression over developmental stages N1-2

N3-4

N5-6

C1-2

C3-4

C5

Male

Female

EcR USP 0

1

2

Fig. 5. A) Developmental stages of the cyclopoid copepod P. nana. N1–N6 represents the six nauplius stages of early post-embryonic developments. C1–C5 and adults represent five copepodite stages and two adult stages with separate stages for males and females from C4 stage onwards. The measurements of N6 and adult female are given in μm. (Modified from Hwang et al. [2010b]) B) The heat map diagram shows the relative mRNA transcription levels of P. nana EcR and USP genes at various developmental stages. The detailed bar diagram with a statistical difference of relative mRNA transcription levels can be seen in Supplementary Fig. S3.

ovarian maturation of arthropods (Lafont, 2000b; Jayasankar et al., 2002). As with other species, the observed result suggests that distinct expression pattern of EcR and USP genes plays a critical role in signal transduction during the development of P. nana. However, the

20 18

Control WAF 20% WAF 40% WAF 80%

c

16 14

b

Day

12

c

10 8 6

a a

b a a

4 2 0

N-C

N-A

Fig. 6. Effects of WAFs on post-embryonic development of P. nana. A) Developmental time from nauplius (N) to copepodite (C) and nauplius to adult (A) at 20, 40 and 80% WAFs and the control over 20 days. Significant differences were analyzed by ANOVA (Tukey's post hoc test; P b 0.05) and are indicated with different letters. Data are the mean ± SD of replicates (n = 10).

functional roles of differential expression of EcR and USP genes are not elucidated. A developmental time delay was observed in WAFs-exposed P. nana. Particularly 80% WAFs significantly reduced the N-C development by 6 days and N-A by 7 days (Fig. 6). As developmental delay in invertebrates has considered an important toxicological parameter in response to xenobiotics (Won and Lee, 2014), the result indicated that WAFs had direct impairment on P. nana at higher concentration. In our previous study, WAFs-induced developmental delay in the copepod T. japonicus was explained (Han et al., 2014). Also, modulations of cytochrome P450 (CYP) genes expression in response to WAFs on P. nana were monitored and found that T. japonicus was more susceptible to WAFs (Han et al., 2015). Han et al. (2014) reported developmental lags in T. japonicus in a dose-dependent manner with 50% reduction in hatching rate at 80% WAFs. Though with varied tolerance level, a similar response was observed in the rotifer Brachionus plicatilis exposed to crude oil (Rico-Martínez et al., 2013). In addition to the above findings, several studies have also confirmed the impact of crude oil or petroleum hydrocarbons on growth retardation in phytoplankton, amphipods, bivalves, and fishes (Lindén, 1976; Hsiao, 1978; MacDonald and Thomas, 1982; Carls et al., 2008). Therefore, it is apparent that sublethal doses of WAFs can lead to adverse effects on development of P. nana. In this study, a developmental stage specific differential transcriptional activation of EcR and USP was observed. In adult P. nana, WAFs led to the up-regulation of EcR and USP genes in a time and dosedependent manner (Fig. 7), whereas USP gene was down-regulated in

14

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

Relative mRNA expression

A) Nauplius stage (for 24h) EcR USP

1.4 1.2

a

a

c

a

1.0

a b

0.8 0.6

a

a 0.4 0.2 0.0

0

20

40

80

WAF (%)

B) 40% WAF (adult stage) Relative mRNA expression

4 EcR USP

c c

3

c

b

bc 2

1

a a

ab a

a

0 Control

6

12

24

48

Time (h)

C) 80% WAF (adult stage) Relative mRNA expression

6 EcR USP

b

5 4

ab

c

3

ab

b

2 1

a a

a a

a

the nauplius without any significant change in the modulation of EcR, suggesting a possible transcriptional activation of EcR and USP by interacting with the regulatory elements (XRE) in the 5′-UTR region of EcR and USP, which are highly developmental stage specific in activation. Interestingly, USP gene of the nauplius was down-regulated, whereas it was up-regulated in the adults in response to WAFs, indicating the importance of USP in the signaling pathway during postembryonic development. In the insect Chironomus riparius, bisphenol A (BPA) exposure led to the increased expression of EcR (Planello et al., 2008), whereas the expression of EcR in T. japonicus significantly decreased by 24 h post-exposure to 100 μg/l BPA and then the level returned to normal at 48 h (Hwang et al., 2010a), suggesting that even the same chemical have differential effects in transcriptional activation of EcR/USP genes. In T. japonicus, BDE-47 (100 and 200 μg/l) downregulated the EcR and USP genes (Hwang et al., 2016) and resulted in delayed developmental rate, whereas the ecdysone agonist ponasterone A (PoA) up-regulated the gene expressions. Similarly, in the D. melanogaster B2 cell line, the insecticide gammahexachlorocyclohexane (γ-HCH) competitively inhibited binding ability of PoA to EcR-USP (Dinan et al., 2001). In our previous study, we observed that WAFs at higher concentrations (40 and 80%) significantly down-regulated the expression of NR family genes including EcR and USP genes in the naupliar stages of T. japonicus and resulted in inhibition of chitin metabolic pathways (unpublished data). This is in accordance with the present study that USP was down-regulated in the nauplius of P. nana in response to WAFs. Also, WAFs-induced adverse effects (e.g. oxidative stress, delay in development and reproduction) were reported in T. japonicus (Han et al., 2014), P. nana (Han et al., 2015), and the rotifer Brachionus koreanus (Won et al., 2016). The molecular mechanistic action of WAFs on EcR and USP of invertebrates are not well understood. However, the EcR-USP activation was found strictly dependent on the concentration of inducers, while reversing the process beyond an optimum dose, which was proved by observing the action of 20E in A. mellifera (Mello et al., 2014) and Manduca sexta (Jindra et al., 1996). Moreover, 20E led to the expression of EcR, USP, and other NR family genes (HR3, HR4, HR78, E75, E78, and FTZ-F1) in the fruit fly D. melanogaster, (Sullivan and Thummel, 2003). Thus, WAFs was acted as ecdysone agonists in adult P. nana, and an antagonist in the nauplius, by binding to xenobiotic response elements in the regulatory region of EcR and USP genes and triggered the transcriptional activation. This suggests the possibility of developmental stage specific activation of EcR and USP genes in P. nana in response to xenobiotics. Though the basic mode of action could be proved, the functional difference in the expression pattern of EcR and USP in adult copepods and the naupliar stages in response to WAFs are not yet identified. In brief, environmental stressor like WAFs can potentially induce the differential effect in the regulation of ecdysteroid signalling pathways of adult P. nana and their nauplius through a developmental stage specific interaction with EcR/USP complex. Thus, EcR and USP genes can be considered as biomarkers for studying the effects of various environmental stressors on the copepod P. nana and other arthropods. However, elaborative study using CRISPR/CAS9 or other genome editing methods is required to find out the developmental stage specific differential mechanism of EcR and USP genes in P. nana. Acknowledgements

0 Control

6

12

24

48

Time (h) Fig. 7. Transcription profile of EcR and USP genes in the nauplius and adult stages of P. nana exposed to different concentrations of WAFs. A) concentration-dependent differential expression of EcR and USP genes in nauplius exposed to 0, 20, 40 and 80% WAFs for 24 h. B) Time-dependent modulations of EcR and USP genes in the adult P. nana exposed to 40 and 80% (C) WAFs for 48 h. Significant differences from control value are indicated by different letters on the data bar (P b 0.05) analysed by Tukey's post hoc analysis. Data are the mean ± SD of replicates.

This work was supported by a grant of the Development of Techniques for Assessment and Management of Hazardous Chemicals in the Marine Environment of the Ministry of Oceans and Fisheries, Korea funded to Jae-Seong Lee. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cbpc.2016.11.002.

J. Puthumana et al. / Comparative Biochemistry and Physiology, Part C 192 (2017) 7–15

References Ara, K., Nojima, K., Hiromi, J., 2002. Acute toxicity of Bunker A and C refined oils to the marine harpacticoid copepod Tigiropus japonicus Mori. Bull. Environ. Contam. Toxicol. 69, 104–110. Asazuma, H., Nagata, S., Kono, M., Nagasawa, H., 2007. Molecular cloning an expression analysis of ecdysone receptor and retinoid X receptor from the kuruma prawn, Marsupenaeus japonicus. Comp. Biochem. Physiol. B 148, 139–150. Billas, I.M.L., Moulinier, L., Rochel, N., Moras, D., 2001. Crystal structure of the ligandbinding domain of the ultraspiracle protein USP, the ortholog of retinoid X receptors in insects. J. Biol. Chem. 276, 7465–7474. Billas, I.M.L., Iwema, T., Garnier, J.-M., Mitschler, A., Rochel, N., Moras, D., 2003. Structural adaptability in the ligand-binding pocket of the ecdysone hormone receptor. Nature 426, 91–96. Bortolin, F., Piulachs, M.-D., Congiu, L., Fusco, G., 2011. Cloning and expression pattern of the ecdysone receptor and retinoid X receptor from the centipede Lithobius peregrinus (Chilopoda, Lithobiomorpha). Gen. Comp. Endocrinol. 174, 60–69. Carls, M.G., Holland, L., Larsen, M., Collier, T.K., Scholz, N.L., Incardona, J.P., 2008. Fish embryo are damaged by dissolved PAHs, not oil particles. Aquat. Toxicol. 88, 121–127. Cruz, J., Nieva, C., Mané-Padrós, D., Martín, D., Bellés, X., 2008. Nuclear receptor BgFTZ-F1 regulates molting and the timing of ecdysteroid production during nymphal development in the hemimetabolous insect Blattella germanica. Dev. Dyn. 237, 3179–3191. Dahms, H.-U., Won, E.-J., Kim, H.-S., Han, J., Jeong, C.-B., Park, H.G., Souissi, S., Raisuddin, S., Lee, J.-S., 2016. Potential of the small cyclopoid copepod Paracyclopina nana as an invertebrate model for ecotoxicity testing. Aquat. Toxicol. 180, 282–294. Dinan, L., Bourne, P., Whiting, P., Dhadialla, T.S., Hutchinson, T.H., 2001. Screening of environmental contaminants for ecdysteroid agonist and antagonist activity using the Drosophila melanogaster B cell in vitro assay. Environ. Toxicol. Chem. 20, 2038–2046. Fahrbach, S.E., Smagghe, G., Velarde, R.A., 2011. Insect nuclear receptors. Annu. Rev. Entomol. 57, 83–106. Han, J., Won, E.-J., Hwang, D.-S., Shin, K.-H., Lee, Y.-S., Leung, K.M., Lee, J.-S., 2014. Crude oil exposure results in oxidative stress-mediated dysfunctional development and reproduction in the copepod Tigriopus japonicus and modulates expression of cytochrome P450 (CYP) genes. Aquat. Toxicol. 152, 308–317. Han, J., Won, E.-J., Kim, H.-S., Nelson, D.R., Lee, S.-J., Park, H.G., Lee, J.-S., 2015. Identification of the full 46 cytochrome P450 (CYP) complement and modulation of CYP expression in response to water accommodated fractions (WAFs) of crude oil in the cyclopoid copepod Paracyclopina nana. Environ. Sci. Technol. 49, 6982–6992. Hsiao, S.I.C., 1978. Effects of crude oils on the growth of arctic marine phytoplankton. Environ. Pollut. 17, 93–107. Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754–755. Hwang, D.-S., Lee, J.-S., Lee, K.-W., Rhee, J.-S., Han, J., Lee, J., Park, G.S., Lee, Y.-M., Lee, J.-S., 2010a. Cloning and expression of ecdysone receptor (EcR) from the intertidal copepod, Tigriopus japonicus. Comp. Biochem. Physiol. C 151, 303–312. Hwang, D.-S., Lee, K.-W., Han, J., Park, H.G., Lee, J., Lee, Y.-M., Lee, J.-S., 2010b. Molecular characterization and expression of vitellogenin (Vg) genes from the cyclopoid copepod, Paracyclopina nana exposed to heavy metals. Comp. Biochem. Physiol. C 151, 360–368. Hwang, D.-S., Han, J., Won, E.-J., Kim, D.-H., Jeong, C.-B., Hwang, U.-K., Zhou, B., Choe, Lee, J.-S., 2016. BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus. Aquat. Toxicol. 177, 285–294. Jayasankar, V., Tsutsui, N., Jasmani, S., Saido-Sakanaka, H., Yang, W.J., Okuno, A., Hien, T.T.T., Aida, K., Wilder, M.N., 2002. Dynamics of vitellogenin mRNA expression and changes in hemolymph vitellogenin levels during ovarian maturation in the giant freshwater prawn Macrobrachium rosenbergii. J. Exp. Zool. 293, 675–682. Jeong, C.-B., Lee, M.-C., Lee, K.-W., Seo, J.S., Park, H.G., Rhee, J.-S., Lee, J.-S., 2015. Identification and molecular characterization of dorsal and dorsal-like genes in the cyclopoid copepod Paracyclopina nana. Mar. Genomics 24, 319–327. Jindra, M., Malone, F., Hiruma, K., Riddiford, L.M., 1996. Developmental profiles and edcysteroid regulation of the mRNAs for two ecdysone receptor isoforms in the epidermis and wings of the tobacco hornworm, Manduca sexta. Dev. Biol. 180, 258–272. Kato, Y., Kobayashi, K., Oda, S., Tatarazako, N., Watanabe, H., Iguchi, T., 2007. Cloning and characterization of the ecdysone receptor and ultraspiracle protein from the water flea Daphnia magna. J. Endocrinol. 193, 183–194. Ki, J.-S., Park, H.G., Lee, J.-S., 2009. The complete mitochondrial genome of the cyclopoid copepod Paracyclopina nana: a highly divergent genome with novel gene order and a typical gene numbers. Gene 435, 13–22. Kim, D.-H., Puthumana, J., Kang, H.-M., Lee, M.-C., Jeong, C.-B., Han, J., Hwang, D.-S., Kim, I.C., Lee, J.-W., Lee, J.-S., 2016. Adverse effects of MWCNTs on life parameters, antioxidant systems, and activation of MAPK signaling pathways in the copepod Paracyclopina nana. Aquat. Toxicol. 179, 115–124. King-Jones, K., Thummel, C.S., 2005. Nuclear receptors-a perspective from Drosophila. Nat. Rev. Genet. 6, 311–323. Koelle, M.R., Talbot, W.S., Segraves, W.A., Bender, M.T., Cherbas, P., Hogness, D.S., 1991. The Drosophila EcR gene encodes an ecdysone receptor, a new member of the steroid-receptor superfamily. Cell 67, 59–77. Lafont, R., 2000a. Understanding insect endocrine systems: molecular approaches. Entomol. Exp. Appl. 97, 123–136. Lafont, R., 2000b. The endocrinology of invertebrates. Ecotoxicology 9, 41–57. LeBlanc, G.A., Mu, X., Rider, C.V., 2000. Embryotoxicity of the alkylphenol degradation product 4-nonylphenol to the crustacean Daphnia magna. Environ. Health Perspect. 108, 1133–1138.

15

Lee, K.-W., Rhee, J.-S., Han, J., Park, H.G., Lee, J.-S., 2012. Effect of culture density and antioxidants on naupliar production and gene expression of the cyclopoid copepod, Paracyclopina nana. Comp. Biochem. Physiol. A 161, 145–152. Lee, B.-Y., Kim, H.-S., Choi, B.-S., Hwang, D.-S., Choi, A.-Y., Han, J., Won, E.-J., Choi, I.-Y., Lee, S.-H., Om, A.-S., Park, H.G., Lee, J.-S., 2015. RNA-seq based whole transcriptome analysis of the cyclopoid copepod Paracyclopina nana focusing on xenobiotics metabolism. Comp. Biochem. Physiol. D 15, 12–19. Lindén, O., 1976. Effects of oil on the amphipod Gammarus oceanicus. Environ. Pollut. 10, 239–250. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408. MacDonald, B.A., Thomas, M.L.H., 1982. Growth reduction in the soft shell clam Mya arenaria from a heavily oiled lagoon in Chedabucto Bay, Nova Scotia. Mar. Environ. Res. 6, 145–156. Mane-Padros, D., Cruz, J., Cheng, A., Raikhel, A.S, 2012. A critical role of the nuclear receptor HR3 in regulation of gonadotrophic cycles of the mosquito Aedes aegypti. PLoS One 7, e45019. Marchler-Bauer, A., Lu, S., Anderson, J.B., Chitsaz, F., Derbyshire, M.K., DeWeese-Scott, C., Fong, J.H., Geer, L.Y., Geer, R.C., Gonzales, N.R., Gwadz, M., Hurwitz, D.I., Jackson, J.D., Ke, Z., Lanczycki, C.J., Lu, F., Marchler, G.H., Mullokandov, M., Omelchenko, M.V., Robertson, C.L., Song, J.S., Thanki, N., Yamashita, R.A., Zhang, D., Zhang, N., Zheng, C., Bryant, S.H., 2011. CDD: a conserved domain database for the functional annotation of proteins. Nucleic Acids Res. 39, D225–D229. Martin, D., Wang, S.-F., Raikhel, A.S., 2001. The vitellogenin gene of the mosquito Aedes aegypti is a direct target of ecdysteroid receptor. Mol. Cell. Endocrinol. 173, 75–86. Mello, T.R.P., Aleixo, A.C., Pinheiro, D.G., Nunes, F.M.F., Bitondi, M.M.G., Hartfelder, K., Barchuk, A.R., Simoes, Z.L.P., 2014. Developmental regulation of ecdysone receptor (EcR) and EcR-controlled gene expression during pharate-adult development of honeybees (Apis mellifera). Front. Genet. 5, 445. Mu, X., Rider, C.V., Hwang, G.S., Hoy, H., LeBlang, G.A., 2005a. Covert signal disruption: anti-ecdysteroidal activity of bisphenol A involves cross talk between signaling pathways. Environ. Toxicol. Chem. 24, 146–152. Nakagawa, Y., Henrich, V.C., 2009. Arthropod nuclear receptors and their role in molting. FEBS J. 276, 6128–6157. Oro, A.E., McKeown, M., Evans, R.M., 1992. The Drosophila retinoid X receptor homolog ultraspiracle functions in both female reproduction and eye morphogenesis. Development 115, 449–462. Planello, R., Martinez-Guitarte, J.L., Morcillo, G., 2008. The endocrine disruptor bisphenol A increases the expression of HSP70 and ecdysone receptor genes in the aquatic larvae of Chironomus riparius. Chemosphere 71, 1870–1876. Raisuddin, S., Kwok, K.W.H., Leung, K.M.Y., Schlenk, D., Lee, J.-S., 2007. The copepod Tigriopus: a promising marine model organism for ecotoxicology and environmental genomics. Aquat. Toxicol. 83, 161–173. Rico-Martínez, R., Snell, T.W., Shearer, T.L., 2013. Synergistic toxicity of Macondo crude oil and dispersant Corexit 9500A® to the Brachionus plicatilis species complex (Rotifera). Environ. Pollut. 173, 5–10. Shirai, H., Kamimura, M., Fujiwara, H., 2007. Characterization of core promoter elements for ecdysone receptor isoforms of the silkworm, Bombyx mori. Insect Mol. Biol. 16, 253–264. Sridhara, S., 2012. Ecdysone receptor and ultraspiracle proteins are tyrosine phosphorylated during adult development of silkmoths. Insect Biochem. Mol. Biol. 42, 91–101. Sullivan, A.A., Thummel, C.S., 2003. Temporal profiles of nuclear receptor gene expression reveal coordinate transcriptional responses during Drosophila development. Mol. Endocrinol. 17, 2125–2137. Talbot, W.S., Swyryd, E.A., Hogness, D.S., 1993. Drosophila tissues with different metamorphic responses to ecdysone express different ecdysone receptor isoforms. Cell 73, 1323–1337. Tan, A., Palli, S.R., 2008. Edysone receptor isoforms play distinct roles in controlling molting and metamorphosis in the red flour beetle, Tribolium castaneum. Mol. Cell. Endocrinol. 291, 42–49. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tool. Nucleic Acids Res. 24, 4876–4882. Won, E.-J., Lee, J.-S., 2014. Gamma radiation induces growth retardation, impaired egg production, and oxidative stress in the marine copepod Paracyclopina nana. Aquat. Toxicol. 150, 17–26. Won, E.-J., Lee, Y., Han, J., Hwang, U.-K., Shin, K.-H., Park, H.G., Lee, J.-S., 2014. Effects of UV radiation on hatching, lipid peroxidation, and fatty acid composition in the copepod Paracyclopina nana. Comp. Biochem. Physiol. C 165, 60–66. Won, E.-J., Kim, R.-O., Kang, H.-M., Kim, H.-S., Hwang, D.-S., Han, J., Lee, Y.H., Hwang, U.-K., Zhou, B., Lee, S.-J., Lee, J.-S., 2016. Adverse effects, expression of the Bk-CYP3045C1 gene, and activation of the ERK signaling pathway in the water accommodated fraction-exposed rotifer. Environ. Sci. Technol. 50, 6025–6035. Wurtz, J.-M., Bourguet, W., Renaud, J.-P., Vivat, V., Chambon, P., Moras, D., Gronemeyer, H., 1996. A canonical structure for the ligand-binding domain of nuclear receptors. Nat. Struct. Biol. 3, 87–94. Xu, J., Tan, A., Palli, S.R., 2010. The function of nuclear receptors in regulation of female reproduction and embryogenesis in the red flour beetle, Tribolium castaneum. J. Insect Physiol. 56, 1471–1480. Yao, T.-P., Forman, B.M., Jiang, Z., Cherbas, L., Chen, J.-D., Mckeown, M., Cherbas, P., Evans, R.M., 1993. Functional ecdysone receptor is the product of EcR and Ultraspiracle genes. Nature 366, 476–479. Zou, E., Fingerman, M., 1997. Effect of estrogenic xenobiotics on molting of the water flea, Daphnia magna. Ecotoxicol. Environ. Saf. 38, 281–285.