Genetic diversity of green algal and cyanobacterial photobionts in Nephroma (Peltigerales)

Genetic diversity of green algal and cyanobacterial photobionts in Nephroma (Peltigerales)

Lichenologist 35(4): 325–339 (2003) doi:10.1016/S0024-2829(03)00051-3 Genetic diversity of green algal and cyanobacterial photobionts in Nephroma (Pe...

256KB Sizes 0 Downloads 13 Views

Lichenologist 35(4): 325–339 (2003) doi:10.1016/S0024-2829(03)00051-3

Genetic diversity of green algal and cyanobacterial photobionts in Nephroma (Peltigerales) Katileena LOHTANDER, , Ilona OKSANEN and Jouko RIKKINEN Abstract: Genetic diversity of green algal and cyanobacterial photobionts in Nephroma was examined by using nucleotide sequences of the ribosomal gene cluster. The lichens studied included both bipartite and tripartite species. There was very little variation in green algal-ITS sequences of N. arcticum and N. expallidum. Almost identical sequences were obtained from all thalli analysed and also from two tripartite Peltigera species. On the basis of SSU rDNA data the green algal photobionts of N. arcticum are closely related to the primary photobiont of P. britannica, and also to an endophytic alga of Ginkgo biloba. The SSU rDNA region of lichen-forming cyanobacteria was rather variable. A phylogenetic analysis indicated that the Nostoc specimens formed a monophyletic group and the strains were divided into two main groups. One clade included only cyanobionts of lichens, including those of all bipartite Nephroma species. The second group was genetically more heterogeneous and included mainly cyanobionts of terricolous cyanolichens, including those of both tripartite Nephroma species studied. The distinction between bi- and tripartite Nephroma species is significant as the mycobionts of tripartite species are not monophyletic. It implies that within Nephroma, evolutionary transitions between symbiosis types cannot have been achieved simply via an acquisition or loss of the green algal photobiont. As the Nostoc symbionts of bi- and tripartite species belong to di#erent phylogenetic groups, an evolutionary change in green algal association has required a concurrent change in cyanobiont composition.  2003 The British Lichen Society. Published by Elsevier Ltd. All rights reserved.

Key words: Coccomyxa, ITS, lichen, Nostoc, phylogeny, SSU rDNA, symbiosis.

Introduction The genus Nephroma (Nephromataceae, Peltigerales) includes about 40 species of foliose, predominately epiphytic cyanolichens (Wetmore 1960; James & White 1987; White & James 1988). Most of these lichens are bipartite, but the genus also includes some tripartite species. Some tripartite Nephroma species can also produce K. Lohtander and J. Rikkinen: Department of Applied Biology, P.O. Box 27, FIN-00014 University of Helsinki, Finland. K. Lohtander, I. Oksanen and J. Rikkinen: Department of Ecology and Systematics, Division of Systematics, P.O. Box 65, FIN-00014 University of Helsinki, Finland. I. Oksanen: Department of Applied Chemistry and Microbiology, Division of Microbiology, P.O. Box 56, FIN-00014 University of Helsinki, Finland. 0024-2829/03/040325+15 $30.00/0

photosymbiodemes (James & Henssen 1976; Tønsberg & Holtan-Hartwig 1983; Go$net & Bayer 1997). The cyanobacterial symbionts can provide both photosynthate and fixed nitrogen to their fungal partners and the relative importance of these functions varies between bi- and tripartite symbioses (Palmqvist 2002; Rai 2002). Several epiphytic Nephroma species prefer habitats of long environmental continuity and have been used as indicators of forest antiquity. In a recent study of Nephroma mycobionts we found that all species studied (11) formed a monophyletic group within the Peltigerales (Lohtander et al. 2002). We also found that tripartite species did not form a monophyletic group within the genus. For example, the tripartite N. expallidum was more closely related to several bipartite taxa

 2003 The British Lichen Society. Published by Elsevier Ltd. All rights reserved.

326

THE LICHENOLOGIST

than to N. arcticum, another tripartite species. This implied that a transition between the two symbiosis types has occurred more than once during the evolution of Nephroma. We also found that the mycobionts of N. resupinatum formed a sister group to those of all other Nephroma species, including both bipartite and tripartite taxa. Furthermore, the mycobionts of N. helveticum, N. laevigatum, and N. resupinatum were quite variable and seemed to represent aggregates of closely related taxa (Lohtander et al. 2002). The green algal symbionts of tripartite Nephroma species are thought to belong to Coccomyxa (Tschermak-Woess 1988; Mia˛dlikowska & Lutzoni 2000). The cyanobacterial photobionts are of the Nostoc-type, that is they are filamentous, heterocystous and produce isopolar trichomes with more or less spherical cells and exhibit no evidence of branching (Geitler 1932; Rippka et al. 1979; Mollenhauer 1988; Koma´rek & Anagnostidis 1989; Castenholz 2001; Wright et al. 2001). Also the typical life cycle of Nostoc, with motile hormogonia and with vegetative filaments exhibiting di#erent degrees of coiling is expressed by most isolates. The phenotypic characteristics of di#erent Nostoc strains show substantial variation, and several names have been used for morphologically di#erent cyanobionts. However, the genetic basis of this variability remains largely unknown and no clear strain boundaries presently exist. The identification of lichen cyanobionts is further complicated by the fact that as an adaptation to symbiosis they undergo great anatomical and physiological modifications (Jordan & Rickson 1971; Kardish et al. 1989; Kardish et al. 1990; Scheidegger 1994). Leizerovich et al. (1990) studied the genetic relatedness of Nostoc strains from Nephroma laevigatum and other symbiotic systems by using restriction fragment patterns of nifH and nifK among other genes. They identified two Nostoc cyanobionts in Peltigera polydactyla, both of which were also present in Cycas revoluta. One of these strains appeared as the single cyanobiont in Nephroma laevigatum and in the

Vol. 35

angiosperm Gunnera kaalensis, while the other strain appeared to be identical to a free-living, soil-inhabiting Nostoc, and was also found as the single cyanobiont of Peltigera horizontalis and a Collema species. More recently, the diversity of symbiotic Nostoc in two Nephroma species has been studied by using the nucleotide sequence of the tRNA Leu (UAA) intron as a genetic marker (Paulsrud & Lindblad 1998; Paulsrud et al. 1998, Paulsrud et al. 2000; Paulsrud 2001). Individual Nephroma thalli have invariably housed a single Nostoc strain, this being similar to the situation observed in most Peltigera species, but in contrast with higher levels of cyanobiont diversity in many other Nostoc symbioses (Miao et al. 1997; West & Adams 1997; Costa et al. 1999; Costa et al. 2001; Paulsrud 2001; Rasmussen & Nilsson 2002; Oksanen et al. 2002; Summerfield et al. 2002). Generally, the strain identities of lichen-forming Nostoc have been determined more by the species identities of lichen mycobionts than the geographic origins of the specimens. For example, the tRNA Leu (UAA) intron sequences of N. resupinatum from northern Europe and western North America were found to be quite similar, di#ering by only one base substitution and one indel in the variable region of the intron (Paulsrud et al. 2000). Two di#erent intron types have been identified from samples of N. arcticum collected from both Finland and Sweden, this diversity being of similar magnitude to that reported for tripartite Peltigera species in northern Europe and western North America (Paulsrud & Lindblad 1998; Paulsrud et al. 1998, 2000, 2001). Already Jordan & Rickson (1971) reported finding two distinct cyanobacterial morphotypes in the cephalodia of N. arcticum. Both types were found in the same thallus and occasionally even in the same cephalodium, but attempts to culture the cyanobacteria were unsuccessful (Jordan & Rickson 1971). Although lichen mycobionts are highly selective in their choice of Nostoc symbionts, several fungal species can often share identical cyanobiont strains. Recently we demonstrated the extent of this phenomenon by

2003

Photobiont diversity in Nephroma—Lohtander et al.

studying Nostoc diversity in epiphytic cyanolichen communities (Rikkinen et al. 2002). Mainly on the basis of SSU rDNA sequences we found that many cyanolichens, including several Nephroma species, invariably associated with a specific group of Nostoc strains that had not been found in other types of cyanolichens (Rikkinen et al. 2002). In the present study we have continued to examine patterns of photobiont diversity in Nephroma and other cyanolichens. Levels of green algal and/or cyanobacterial diversity have been determined in several Nephroma species, including all species native to northern Europe. We have also determined the phylogenetic position of the green algal photobionts of Nephroma by using the nuclear SSU rDNA sequences in a phylogenetic analysis. Our main goal was to determine whether or not the cyanobacterial photobionts represent a monophyletic group and to compare the phylogeny of Nephroma cyanobionts with that of Nephroma mycobionts. Special emphasis was given to relations between bipartite and tripartite species. All these questions were addressed by analysing ITS and SSU rDNA sequences of green algal symbionts and SSU rDNA sequences of cyanobacterial symbionts. Materials and Methods Biological material Fresh specimens of Nephroma and other cyanolichens were collected from Europe (Finland, Sweden, Russia, Ireland), East Asia (NE China, SE China) and western North America (Oregon). These field collections were supplemented with herbarium specimens from several other geographic regions (Tables 1, 2 & 3). The green algae Coccomyxa glaronensis (strain Takacova 1983/2, from a lichen) was obtained from Culture Collection of Algal Laboratory, Tøebo, Czech Republic. Many of the specimens in this study were also used in our previous study concerning the genetic variability of Nephroma mycobionts (Lohtander et al. 2002). Lichens were identified according to James & White (1987) and White & James (1988). The secondary chemistry of many Nephroma thalli was determined by thin-layer chromatography (TLC) as described in Lohtander et al. (2002). Lichen substances were identified by comparing the TLC patterns obtained with those in James & White (1987). Voucher specimens of all lichens have been deposited in Helsinki (H) or in

327

Oulu (OULU), Finland. For further information of the specimens and the GenBank numbers of the sequences, see Tables 1–3. In some cases the lichen-forming cyanobacteria were first cultivated on nitrogen free medium (Z8x) on agarose plates for several weeks and used directly in PCR after being suspended in dH2O. Molecular techniques The total DNA of lichen samples was extracted using the QIAamp Tissue Kit (Qiagen) according to the manufacturer’s instructions with slight modifications described in Lohtander et al. (2000) or obtained directly from crushed cells. A 600 bp fragment (that spans the positions 40–640) of the nuclear SSU rDNA of three green algal specimens (Table 1) was amplified using the green algal specific primers (Table 4). The internal transcribed spacers 1 and 2 (ITS) together with the 5.8S rDNA of the nuclear ribosomal gene region were sequenced from the green algal photobionts of 19 specimens of tripartite Nephroma and Peltigera species (Table 2), using the primers in Table 4. The primer KL-ITS1A2 (forward) was designed for this study and used together with the universal primer ITS4 (reverse; White et al. 1990) to specifically amplify green algal sequences. The primers KL-SSUb1 (forward) and KLSSUb2 (reverse) were designed to specifically amplify the first 800 bp of the approximately 1400 bp long small subunit of the cyanobacterial ribosomal gene cluster (Table 4). The cyanobacterial SSU rDNA sequences were obtained from 50 lichen specimens, representing a variety of Nephroma and other cyanolichens (Table 3). Additional sequences were obtained from unpublished studies of our research group and from GenBank (Table 3). All PCR-reactions were performed using Amersham Pharmacia Biotech Inc. Ready To Go PCR beads following a procedure described in Lohtander et al. (2000). The PCR profile for each reaction was 60 s at 95(C (denaturation), 60 sec at 58(C (annealing), and 60 sec at 72(C (extension), 30 cycles, followed by 7 min at 72(C. The products were purified with the PCR Purification Kit (Qiagen). The amplified DNA products were sequenced with the primers presented in Table 4, using the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). Sequence reactions were then purified using the AutoSeqe G-50 columns of Amersham Pharmacia Biotech Inc. The purified samples were then run on an ABI Prism 377 automated sequencer (PE Biosystems). Alignment and phylogenetic analysis Sequences were aligned using the ClustalW (Thompson et al. 1994) alignment program with various parameter settings (gap opening penalty 15-5 and gap extension penalty 5-1). The alignment that resulted in most supported groups was chosen for phylogenetic analysis. Phylogenetic trees were obtained using the heuristic search option in PAUP 4.0 (Swo#ord 2000), with random addition sequence and TBR branch

328

THE LICHENOLOGIST

Vol. 35

T 1. Origin of green algal SSU rDNA sequences No.

Species or host

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

Sphagnum fallax Marchantia polymorpha Chara connivens Staurastrum punctulatum Mantoniella antarctica Prasinococcus sp. Nephroselmis olivacea Ulva rigida Enteromorpha intestinalis Urospora penicilliformis Acrosiphonia sp. Monostroma grevillea Pseudoendoclonium brasiliensis Ulothrix zonata Gloetilops paucicellularis Protoderma sarcinoidea Ankistrodesmus stipitatus Scenedesmus obliquus Neochloris aquatica Hydrodictyon reticulatum Pediastrum duplex Paulschulzia pseudovolvox Chlamydomonas reinhardtii Volvox carteri Asteromonas gracilis Haematococcus pluvialis Chlorosarcinopsis minor Chlorococcum ellipsoideum Characium saccatum Chloromonas perforata Chlorella ellipsoidea Pabia signensis Stichococcus bacillaris Prasiola crispa Dictyochloropsis reticulata Watanabea reniformis Chlorella luteoviridis C. trebouxioides Pseudochlorella sp. Lobosphaera tirolensis Myrmecia bisekta Leptosira terrestris Microthamnion kuezingianum Trebouxia magna Myrmecia biatorellae M. astigmatica Friedmannia israliensis Trebouxia impressa T. usneae T. jamesii T. arboricola T. asymmetrica Nannochloris sp. Nannochloris coccoides Photobiont of Nephroma arcticum Photobiont of Peltigera britannica Coccomyxa glaronensis Endosymbiont from Ginkgo biloba

Collector or strain

CCMP1614

UTEX907

Rikkinen 004001 Rikkinen A16 Takacova 1983/2 BC98

GenBank No. X78468 AB021684 AF408223 AF115442 AB17128 AF203403 X74754 AJ005414 AF189077 AB049417 U03757 AF015279 Z47996 Z47999 Z47997 Z47998 X56100 AJ249515 M62861 M74497 M62997 U83120 M32703 X53904 M95614 U70590 AB049415 U70586 M84319 U70794 X63520 AJ416108 AJ416107 AJ416106 Z47207 X73991 AB006045 AB006048 AB006049 AB006051 Z47209 Z28973 Z28974 Z21552 Z28971 Z47208 M62995 Z21551 Z68702 Z68700 Z68705 Z21553 X81965 X89012 AY333643 AY333644 AY333645 AJ302940

2003

Photobiont diversity in Nephroma—Lohtander et al.

329

T 1 Continued. No.

Species or host

Collector or strain

GenBank No.

59 60 61 62 63 64 65 66 67 68 69 70 71

Endosymbiont from Ginkgo biloba Planctonema sp. Eremosphaera viridis Tetrachlorella alternans Amphikrikos sp. Oocystis marssonii Chlorella kessleri Micractinium pusillum Chlorella lobophora C. vulgaris Prototheca wickerhamii Nannochloris sp. Nanochlorum eukaryotum

CMS93 J45-9

AJ302939 AF387149 AF387154 AF228687 AF228690 AF228688 X56105 AF237662 X63504 X13688 X56099 AJ131691 X06425

SAG 211-11b RCC 011

T 2. Origin of ITS sequences obtained from tripartite lichens Host

Collector

Locality

GenBank No.

DNA type

Nephroma arcticum N. arcticum N. arcticum N. arcticum N. arcticum N. arcticum N. arcticum N. arcticum N. arcticum N. expallidum N. expallidum Peltigera aphthosa P. aphthosa P. aphthosa P. britannica P. leucophlebia P. leucophlebia P. leucophlebia P. leucophlebia Coccomyxa glaronensis

Wehr 59 Rikkinen 004002 Rikkinen et al. 003011 Vitikainen 11479 Rikkinen et al. 003016 Rikkinen et al. 003001 Rikkinen 004009 Rikkinen et al. 003002 Paulsrud 66955 Goward 92-636 Ulvinen 15 July 1999 Rikkinen 004007 Rikkinen et al. 003013 Rikkinen et al. 003008 Rikkinen 98A16 Rikkinen 004005 Rikkinen et al. 003010 Rikkinen et al. 003014 Rikkinen et al. 003015 Takacova 1983/2

C Canada N Finland C Finland C Norway C Finland C Finland N Finland C Finland Sweden NW U.S.A. N Finland N Finland C Finland C Finland NW U.S.A. N Finland C Finland C Finland C Finland

AY333647

A at position 218 A at position 218 A at position 218 A at position 218 A at position 218 A and T at position 218 A and T at position 218 A and T at position 218 A at position 218 A at position 218 T at position 218 T at position 218 A at position 218 A at position 218 Di#ers from all the other T at position 218 A and T at position 218 A at position 218 A at position 218 Di#ers from all the other

swapping options. Support for each node was estimated using bootstrapping (5000 replications), as implemented in PAUP. Gaps were coded as fifth character states in the analyses. The cyanobacterial SSU rDNA data set was also analysed using Maximum Likelihood (with all rates coded as equal) for comparison, as implemented in PAUP. However, the results of the MP and ML analyses are not fully comparable, since gaps cannot be utilised in the latter procedure. An alignment with gap opening penalty 5 and gap extension penalty 1 was chosen for the phylogenetic analysis of the green algal SSU rDNA sequences. The green photobiont sequences were analysed with several

AY333648

AY333649

AY333650

AY333646

other green algal SSU rDNA sequences from GenBank in order to examine their phylogenetic position. The bryophyte Sphagnum fallax was used as outgroup. An alignment with gap opening penalty 5 and gap extension penalty 5 was chosen for the phylogenetic analysis of the cyanobacterial SSU rDNA sequences. In several cases identical cyanobacterial sequences were found from several lichen thalli. In order to facilitate the analysis only a few copies of such sequences were included in the analysis (Table 1). A sequence of Prochlorothrix was used as outgroup based on previous studies of cyanobacterial SSU rDNA phylogenies (Wilmotte 1994).

330

THE LICHENOLOGIST

Vol. 35

T 3. Origin of cyanobacterial SSU rDNA sequences obtained from lichens and GenBank No.

Species or host

Collector or strain

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

Prochlorococcus marinus Myxosarcina sp. Pleurocapsa sp. Plectonema boryanum Oscillatoria sp. Gloeocapsa sp. Gloeothece membranacea Lyngbya sp. Scytonema sp. Calothrix desertica Anabaena cylindrica Anabaena sp. Cylindrospermum sp. Cyanospira rippkae Anabaenopsis sp. Nodularia sphaerocarpa N. harveyana Anabaena affinis A. solitaria A. flos-aquae Aphanizomenon sp. Nephroma helveticum Nephroma parile N. parile N. resupinatum N. bellum N. parile N. parile N. parile Parmeliella triptophylla Nephroma parile N. resupinatum N. bellum N. bellum N. bellum Dendriscocaulon sp. Nephroma helveticum N. laevigatum N. tangeriense N. resupinatum N. laevigatum N. cellulosum N. helveticum N. helveticum Lobaria pulmonaria Nephroma helveticum N. helveticum Lobaria retigera Nephroma resupinatum N. resupinatum N. laevigatum N. laevigatum Sticta fuliginosa Nephroma laevigatum Peltigera membranacea Peltigera sp. Nephroma arcticum Nostoc sp.

EQPAC1 PCC 7312 PCC7516 UTEX 485 M-117 PCC73106 PCC6501 PCC7419 U-3-3 PCC7102 PCC7122 PCC7120 PCC7417 PCC9501 PCC9215 UTEX-B2093 NIES40 NIES80 NRC44-1 202 Rikkinen 000119 (H) Nash III 30009A (H) Oksanen et al. VI.2.2 (H) Nash III 30009 (H) Nash III 30009 (H) Rikkinen et al. 003005 (H) Vitikainen 13242 (H) Hansen, 22 vi 1998 (OULU) Oksanen et al. I.3.1 (H) Oksanen et al. III.2 (H) Oksanen et al. VI.5 (H) Oksanen et al. III (H) Vitikainen 13239 (H) Ahti & Djan-Che´kar 60277 (H) Rikkinen 000313 (H) McCune 4 ii 2001A (H) McCune 4 ii 2001B (H) Burgaz, 22 July 1995 (H) Rikkinen 98A34B (H) Skyte´n 6243 (H) Stenroos 3680 (H) Ahti et al. 46357 (H) Nash III 37165 (H) McCune B (H) McCune 4 ii 2001E (H) Kivisto¨, 17 vii 2000 (OULU) Rikkinen 990782 (H) McCune 4 ii 2001 C (H) Oksanen et al. V.1 (H) Mayrhofer & Pru¨gger 11583 (H) Feuerer & Marth, 19 vii 1997 (H) Rikkinen 980W1A (H) Ka¨a¨nto¨nen 284/94 (H) TDI#AR94 Oksanen et al. III.1.2 (H) Rikkinen et al. 003002 ATCC53789

Locality

C China SW U.S.A. C Finland SW U.S.A. SW U.S.A. C Finland SW Canada SW Greenland C Finland C Finland C Finland C Finland SW Canada E Canada C China NW U.S.A. NW U.S.A. S Portugal NW U.S.A. C Norway S Argentina NW China SW U.S.A. NW U.S.A. NW U.S.A. N China C China NW U.S.A. C Finland France, Corse Macaronesia NW U.S.A. S Finland W Canada C Finland C Finland

GenBank No. AF311217 AJ344561 X78681 AF132793 AB003163 AB039000 X78680 AJ000714 AY069954 AF132779 AF091150 AP003598 AJ133163 AY038036 AY038033 AF268018 AF268021 AF247591 AF247594 AF247596 AJ133153 AF506250 AY333615 AF506251 AY333616 AY333617 AY333618 AY333619 AY333620 AF506255 AF506257 AY112695 AF506256 AY333621 AY333622 AY333623 AY333624 AF506264 AY333625 AY333626 AY333627 AY333628 AF506260 AY333629 AF506261 AF506262 AF506258 AF506259 AF506265 AF506263 AY333630 AY333631 AY333632 AY333633 AF027653 AF506247 AY333634 AF062638

2003

Photobiont diversity in Nephroma—Lohtander et al.

331

T 3 Continued. No.

Species or host

Collector or strain

Locality

GenBank No.

59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75

Nostoc punctiforme Leptogium corniculatum Pannaria pezizoides Nostoc sp. Nephroma arcticum N. expallidum Nostoc sp. Lobaria hallii Peltigera collina Nephroma arcticum Peltigera praetextata Nephroma arcticum Nostoc sp. DM103 Peltigera membranacea Nephroma expallidum N. arcticum N. expallidum

PCC73102 Rikkinen V2b (H) Rikkinen E10 (H) AWT 203 Rikkinen 004009 (H) Ulvinen, 22 vii 1998 (OULU) GSV224 McCune D (H) McCune A (H) Hansen 700 (OULU) Rikkinen V2a (H) Hansen, 6 viii 1998 (OULU) SAG 2028 PCC9709 Ulvinen, 22 vii 1998 (OULU) Rikkinen et al. 003016 (H) Hansen, 31 vii 1998 (OULU)

Australia NW U.S.A. W Ireland

AF027655 AY333635 AY333636 AF317630 AF506241 AY333637 AF062637 AF506244 AF506245 AY333638 AY333639 AY333640 AJ344563 AF027654 AF506248 AY333641 AY333642

Results The alignment of the SSU rDNA sequences of the green algae resulted in a data set of 1909 characters, of which 561 were informative. The phylogenetic analysis of the SSU rDNA data set resulted in eight equally parsimonious trees, 3420 steps long and with a consistency index of 0·35 excluding uninformative characters. The strict consensus tree was well-resolved but bootstrap support remained low or negligible for many groups (Fig. 1). The SSU rDNA fragment of the green algal photobionts of Nephroma and Peltigera were 98% identical and grouped together within Trebouxiophyceae. Their sister group comprised of Coccomyxa glaronensis and two strains of endophytic algae from Ginkgo biloba. This group, in turn, formed a sister group to two Nannochloris strains (Fig. 1). The ITS sequences of the green algal photobionts from Nephroma arcticum, N. expallidum, Peltigera aphthosa, and P. leucophlebia were 612 bp long; the lengths of the ITS1, 5.8S and ITS2 regions were 244, 165 and 190 bp, respectively. Variation among the sequences was negligible; one position (218 in ITS1) had either A or T, or both (Table 2). However, the sequence obtained from the single Peltigera britannica thallus from North America was 597 bp long

N Finland N Finland W U.S.A. W U.S.A. SW Greenland NW U.S.A. SW Greenland South Africa W Canada N Finland C Finland SW Greenland

and di#ered significantly from the other ITS sequences, as did the Coccomyxa glaronensis sequence that was 690 bp long. There was substantial sequence variation in the SSU rDNA region of Nephroma and Peltigera cyanobionts and other filamentous cyanobacteria. However, the alignment of these sequences was not problematic. The alignment of the cyanobacterial SSU rDNA sequences provided a data set of 840 characters, of which 203 were informative. The phylogenetic analysis resulted in 312 equally parsimonious trees, 913 steps long and with a consistency index excluding uninformative characters of 0.43. In a strict consensus tree (Fig. 2) the genus Nostoc (including all the lichen cyanobionts) formed a monophyletic group with 92% bootstrap support. A clade consisting of specimens of Anabaena and Aphanizomenon appeared as a sister group to the Nostoc clade (Fig. 2). The Nostoc clade was divided into two groups. The first subgroup (A in Fig. 2) included the cyanobionts of Nephroma bellum, N. cellulosum, N. helveticum, N. laevigatum, N. parile, N. resupinatum, and N. tangeriense. Also the cyanobionts of Dendriscocaulon sp., Parmeliella triptophylla and two Lobaria species grouped here. A group including Nostoc strains from Chinese Nephroma helveticum and Finnish and North

332

Name KL-18SA1 KL-18SA2 KL-ITS1A2 ITS4 ITS5 KL-SSUb1 KL-SSUb2 460R

Sequence TCCTCCGCTTATTGATATGC TCCTCCGCTTATTGATATGC CGATTGGGTGTGCTGGTGAAG TCCTCCGCTTATTGATATGC GGAAGTAAAAGTCGTAACAAGG TAACACATGCAAGTCGAACG CTCCACCGCTTGTGCGGG CCGTATTACCGCGGCTGCT

Reference 18S 18S ITS ITS ITS 16S 16S 16S

forward, PCR, sequencing reverse, PCR, sequencing forward, PCR, sequencing reverse, PCR, sequencing forward, sequencing forward, PCR, sequencing reverse, PCR, sequencing reverse, sequencing

Green algal; this study Green algal; this study Green algal; this study White et al. (1990) White et al. (1990) Bacterial; this study, Bacterial; this study Wilmotte et al. (1993)

THE LICHENOLOGIST

T 4. Primers used in this study

Vol. 35

2003

Photobiont diversity in Nephroma—Lohtander et al.

333

F. 1. A strict consensus of eight equally parsimonious trees based on green algal SSU rDNA sequence data. Bootstrap support >50% is shown at nodes.

334

THE LICHENOLOGIST

Vol. 35

F. 2. A strict consensus of 312 equally parsimonious trees based on cyanobacterial SSU rDNA sequence data. Bootstrap support >50% is shown at nodes. The capital letters before collecting localities refer to geographical areas (N = north, NW = north-west, C = central, etc.).

2003

Photobiont diversity in Nephroma—Lohtander et al.

American Nephroma parile formed a sister group to all other specimens (Fig. 2). In the remaining group the cyanobionts of N. bellum and N. resupinatum from Arizona, U.S.A., grouped together with 85% bootstrap support and formed a sister group to the remaining specimens (Fig. 2). The remaining group included Nostoc strains from European and North and South American specimens of Nephroma bellum, N. cellulosum, N. parile, N. resupinatum, N. tangeriense, Lobaria spp., Parmeliella triptophylla and Sticta fuliginosa. Some of these specimens formed a well-supported group (A1 in Fig. 2; bootstrap support 98%). This clade mainly included cyanobionts of Nephroma helveticum and N. laevigatum, but also those of some other cyanolichens (Fig. 2). The second main group of Nostoc (B in Fig. 2) included all the Nostoc strains from N. arcticum and N. expallidum. They grouped together with the cyanobionts of various Peltigera, Pannaria and Lobaria species, and with non-lichenized Nostoc strains. Detailed phylogenetic relationships within group B remained obscure as the clade only had few supported groups. As a whole, genetic variability among the group B was clearly higher than that in the group A. Hence, sequences of the former group had 65 variable sites (43 informative characters), compared to only 22 variable sites (of which 14 were parsimony informative characters) within the latter group. Only three characters were informative within the well-supported subgroup A1 (Fig. 2). The ML analysis (tree not shown) resulted in a tree that deviated from the MP tree (Fig. 2) only slightly, despite the fact that gaps were coded as character states in the MP analysis and as missing data in the ML analysis. In the ML tree the sequences 57-61 grouped together while in the parsimony tree (Fig. 2) the sequences 57-59 remained unresolved with a group consisting of sequences 60 and 61. Sequences from Nostoc strains 22, 23 and 24 shared similarities with both sequence types (A & B). When these three sequences were removed from the analysis, the boot-

335

strap supports for both groups increased markedly, to 97% for group A and to 85% for the group B (tree not shown). Discussion Coccomyxa is believed to be the primary photobiont of most tripartite Nephroma and Peltigera species (Tschermak-Woess 1988; Mia˛dlikowska & Lutzoni 2000). Also in our analysis both sequences from the green algal photobionts of tripartite Nephroma species grouped together with Coccomyxa glaronensis and an endophytic alga from Ginkgo biloba (Fig. 1). This recently described endophyte resides inside the cells of its host plant (Tre´mouillaux-Guiller et al. 2002). Our results further indicate that the Nephroma and Peltigera photobionts are more closely related to some Nannochloris strains than to other lichen-forming green algae (e.g. Dictyochloropsis, Myrmecia and Trebouxia). There was hardly any variation in the green algal ITS sequences of Nephroma arcticum and N. expallidum. All thalli analysed of both tripartite species contained similar sequences, these also being identical to those obtained from Peltigera aphthosa and P. leucophlebia (Table 2). This is interesting as the lichen specimens had been collected from widely di#erent geographical areas, including both European and North American sites. The sequence of Peltigera britannica photobiont, as well as that of Coccomyxa glaronensis were clearly distinct, but when analysed with the SSU rDNA sequences of other green algae, they were found to be from the same group (Fig. 1). It is possible that these deviating sequences represent di#erent species or subspecies of Coccomyxa. Comparable levels of phylogenetic diversity have been reported from lichens with Trebouxia photobionts (Kroken & Taylor 2000; Dahlkild et al. 2001). There was substantial variation in the SSU rDNA region of Nostocalean cyanobacteria. The SSU rDNA has been widely used to resolve phylogenetic relationships of diverse organisms, including cyanobacteria. The region harbours highly conservative regions enabling relatively easy sequence

336

THE LICHENOLOGIST

alignments between distantly related taxa, but, on the other hand, it does not usually provide much information at lower taxonomic levels (Nichols 1982; Giovannoni et al. 1988; Nelissen et al. 1992, Wilmotte et al. 1992; Wilmotte et al. 1993; Wilmotte et al. 1994; Palmer & Delwiche 1998; Lehtima¨ki et al. 2000). Our results indicated that the first 800 bp contain enough variation to be useful in phylogenetic analyses of the genus Nostoc. In the complete SSU rDNA sequences of Nostoc specimens most of the variable sites reside in the first half of the sequence. According to our results the genus Nostoc is monophyletic. The Nostoc clade was well supported and divided into two main groups, one of which included only cyanobionts of bipartite Nephroma. The second group was genetically more heterogenous and included mainly Nostoc strains of terricolous cyanolichens including all tripartite Nephroma species (Fig. 2). A significant finding was that both tripartite Nephroma species, N. arcticum and N. expallidum, housed group B Nostocs, while all cyanobionts of bipartite Nephroma species invariably belonged to group A (Fig. 2). This is interesting, as we have previously shown that the mycobionts of tripartite Nephroma species do not form a monophyletic group within the genus. Conversely, N. expallidum is more closely related to several epiphytic, bipartite taxa than to N. arcticum. This implies that the transition from a bipartite to a tripartite symbiosis, or vice versa, has occurred more than once within Nephroma (Lohtander et al. 2002). Our present results indicate that such transitions cannot have been achieved simply through the acquisition or loss of a green algal symbiont. As the symbiotic cyanobacteria of tripartite and bipartite Nephroma species belong to di#erent phylogenetic groups, any loss or gain of a green algal photobiont must have been accompanied by a concurrent switch of cyanobiont strains. Generally, within the two main clades of Nostoc the lichenized strains did not group according to the species identities of their fungal hosts (Fig. 2). For example, based on the two fungal gene regions studied, we

Vol. 35

had previously found that Nephroma parile is rather uniform. The mycobionts of N. helveticum and N. laevigatum, on the other hand, seem to represent aggregates of closely related fungi (Lohtander et al. 2002). However, in the present study we found more genetic variation among the Nostoc cyanobionts of N. parile than in the two last species. Our previous study has also shown that mycobionts of N. resupinatum form a sister group to the rest of the genus including all other bipartite Nephroma species. However, the Nostoc strains in many N. resupinatum thalli were sequence-identical to those amplified from other bipartite Nephroma species (Fig. 2). Finally, while genetic di#erences among N. helveticum mycobionts were correlated with some features in thallus morphology, secondary chemistry and geographic origin, the limited variation in cyanobiont composition did not correlate with obvious trends in fungal variation (Fig. 2; Lohtander et al. 2002). While we were unable to find direct correlations between fungal and cyanobacterial phylogenies in Nephroma, there seemed to be a correlation between cyanobacterial strain identities and lichen ecology. The second main clade of Nostoc spp. (group B) included mainly cyanobionts of terricolous lichens. Lobaria hallii, Peltigera collina, P. praetextata, and Pannaria sp. also grow as epiphytes, but usually prefer bryophyte dominated basal trunks and only rarely extend to the higher canopy. It is also worth noting that the cycad cyanobiont and the free-living Nostoc strain grouped together with the cyanobionts of terricolous lichens (Fig. 2). On the other hand, all Nostoc strains in the well-supported Group A were largely restricted to epiphytic and/or lithophytic lichens. This group included all the cyanobionts of bipartite Nephroma species, but also those of two species of Lobaria. Ongoing studies have indicated that the cyanobionts of several other genera of epiphytic and lithophytic cyanolichens also belong to this group (data not shown). There was much less genetic variation among the Nostoc strains of epiphytic lichens than in those of terricolous lichens and

2003

Photobiont diversity in Nephroma—Lohtander et al.

especially the well-supported group A1 was highly homogenous (Fig. 2). There were remarkably few variable sites in this group of sequences, even though they originated from several di#erent cyanolichen species collected from four di#erent continents. Interestingly, almost all cyanobionts of Nephroma helveticum, N. laevigatum, and N. tangeriense, which are essentially temperate species, grouped in A1, while the cyanobionts of most boreal epiphytes were found from lower nodes of the epiphyte clade (Fig. 2). As a whole, our new results add significantly to what was previously known about photobiont diversity and specificity in cyanolichens. They indicate that there is limited genetic variation among the Coccomyxa photobionts of tripartite Nephroma and Peltigera species. This contrasts with a greater diversity among Nostoc cyanobionts. Our results confirm earlier observations that di#erent thalli of specific Nephroma species can often contain di#erent Nostoc strains (Paulsrud & Lindblad 1998; Paulsrud et al. 2000). They also show that di#erent Nephroma species often house sequence-identical Nostoc strains. A similar situationhas previously been detected among some species of Peltigera (Paulsrud 2001). However, the distribution of specific Nostoc strains among Nephroma species is far from random. Within the functional groups of bipartite and tripartite species, even distantly related taxa collected from di#erent geographical regions often harboured sequenceidentical cyanobacteria. No cephalodial cyanobionts of tripartite Nephroma species have as yet been found in bipartite epiphytes or vice versa. According to present knowledge, this type of segregation is not evident in Peltigera (Paulsrud et al. 1998, 2000). The phylogenetic distinction between the cyanobionts of bi- and tripartite Nephroma species is significant as the mycobionts of tripartite species do not form a monophyletic group. This implies that within Nephroma, evolutionary transitions between the two types of symbiosis cannot have been achieved simply via an acquisition or loss of Coccomyxa. As the Nostocs of bi- and tripartite species

337

belong to di#erent phylogenetic groups, any changes in green algal association must have been accompanied by concurrent changes in cyanobiont composition. This study was financially supported by the Academy of Finland. We thank Bruce McCune, Laura Kivisto¨, Pekka Halonen, Per Paulsrud, and Orvo Vitikainen for providing lichen specimens. All specimens from Hunan, China, were collected on excursions organised by the Forest Department of Hunan Province and its Forest Botanical Garden, in cooperation with the Division of Systematic Biology, Department of Ecology and Systematics, and the Botanical Museum, University of Helsinki. These collecting trips were financed by the Academy of Finland.

R Castenholz, R. W. (2001) Phylum BX. Cyanobacteria. In Bergey’s Manual of Systematic Bacteriology I (G. M. Garrity, ed.): 473–599. Berlin: Springer-Verlag. Costa, J. L., Paulsrud, P. & Lindblad, P. (1999) Cyanobiont diversity within coralloid roots of selected cycad species. FEMS (Federation of European Microbiological Societies) Microbiology Ecology 28: 85–91. Costa, J. L., Paulsrud, P., Rikkinen, J. & Lindblad, P. (2001) Genetic diversity of Nostoc endophytically associated with two bryophyte species. Applied and Environmental Microbiology 67: 4393–4396. ˚ ., Ka¨llersjo¨, M., Lohtander, K. & Tehler, A. Dahlkild, A (2001) Photobiont diversity in the Physciaceae (Lecanorales). Bryologist 104: 527–536. Geitler, L. (1932) Cyanophyceae. In Kryptogamenflora ¨ sterreich und der Schweiz, Vol. 14 von Deutschland, O (Kolkwitz, ed.): 1–1196. Leipzig: Akademische Verlagsgesellschaft. Giovannoni, S. J., Turner, S., Olsen, G. J., Barns, S., Lane, D. J. & Pace, N. R. (1988) Evolutionary relationships among cyanobacteria and green chloroplasts. Journal of Bacteriology 170: 3584–3592. Go$net, B. & Bayer, R. J. (1997) Characterization of mycobionts of phytomorph pairs in the Peltigerineae (lichenized ascomycetes) based on internal transcribed spacer sequences of the nuclear ribosomal DNA. Fungal Genetics and Biology 21: 228–237. James, P. W. & Henssen, A. (1976) The morphological and taxonomic significance of cephalodia. In Lichenology, Progress and Problems (D. H. Brown, D. L. Hawksworth & R. H. Bailey, eds.): 27–77. London: Academic Press. James, P. W. & White, F. J. (1987) Studies on the genus Nephroma. I. The European and Macaronesian species. Lichenologist 19: 215–268.

338

THE LICHENOLOGIST

Jordan, W. P. & Rickson, F. R. (1971) Cyanophyte cephalodia in the lichen genus Nephroma. American Journal of Botany 58: 562–568. Kardish, N., Kessel, M. & Galun, M. (1989) Characterization of symbiotic and cultured Nostoc of the lichen Nephroma laevigatum Ach. Symbiosis 7: 257–266. Kardish, N., Rotem-Abarbanell, D., Ziberstein, A. & Galun, M. (1990) Comparison between the symbiotic Nostoc of the lichen Nephroma laevigatum Ach. and its cultured, isolated Nostoc by recombination DNA. Symbiosis 8: 135–145. Koma´rek, J. & Anagnostidis, K. (1989) Modern approach to the classification system of cyanophytes. 4. Nostocales. Archiv fu¨r Hydrobiologie Supplementband 82: 247–345. Kroken, S. & Taylor, J. W. (2000) Phylogenetic species, reproductive mode, and specificity of the green alga Trebouxia forming lichens with the fungal genus Letharia. Bryologist 103: 645–660. Lehtima¨ki, J., Lyra, C., Suomalainen, S., Sundman, P., Rouhianen, L., Paulin, L. et al. (2000) Characterization of Nodularia strains, cyanobacteria from brackish waters, by genotypic and phenotypic methods. International Journal of Systematic and Evolutionary Microbiology 50: 1043–1053. Leizerovich, I., Kardish, N. & Galun, M. (1990) Comparison between eight symbiotic, cultured Nostoc isolates and free-living Nostoc by recombinant DNA. Symbiosis 8: 75–85. Lohtander, K., Ka¨llersjo¨, M., Moberg, R. & Tehler, A. (2000) The family Physciaceae in Fennoscandia: phylogeny inferred from ITS sequences. Mycologia 92: 728–735. Lohtander, K., Oksanen, I. & Rikkinen, J. (2002) Phylogenetic study of Nephroma (lichen-forming Ascomycota). Mycological Research 106: 777–787. Mia˛dlikowska, J. & Lutzoni, F. (2000) Phylogenetic revision of the genus Peltigera (lichen-forming Ascomycota) based on morphological, chemical and large subunit nuclear ribosomal DNA data. International Journal of Plant Sciences 161: 925–958. Miao, V., Rabenau, A. & Lee, A. (1997) Cultural and molecular characterization of photobionts of Peltigera membranacea. Lichenologist 29: 571–586. Mollenhauer, D. (1988) Nostoc species in the field. Archiv fu¨r Hydrobiologie (Algological studies) 80: 315–326. Nelissen, B., Wilmotte, A., De Baere, R., Haes, F., Van de Peer, Y., Neefs, J. M. et al. (1992) Phylogenetic study of cyanobacteria on the basis of 16S ribosomal RNA sequences. Belgian Journal of Botany 125: 210–213. Nichols, J. M., Foulds, I. J., Crouch, D. H. & Carr, N. G. (1982) The diversity of cyanobacterial genomes with respect to ribosomal RNA cistrons. Journal of General Microbiology 128: 2739–2746. Oksanen, I., Lohtander, K., Paulsrud, P. & Rikkinen, J. (2002) A molecular approach to cyanobacterial diversity in a rock pool community involving gelatinous lichens and free-living Nostoc colonies. Annales Botanici Fennici 39: 93–99.

Vol. 35

Palmer, J. D. & Delwiche, C. F. (1998) The origin and evolution of plastids and their genomes. In Molecular Systematics of Plants. II. DNA sequencing (D. E. Soltis, P. S. Soltis & J. J. Doyle, eds.): 375–409. Massachusetts: Kluwer Academic Publishers. Palmqvist, K. (2002) Cyanolichens: carbon metabolism. In Cyanobacteria in Symbiosis. (A. Rai, B. Bergman, & U. Rasmussen eds.): 73–96. Dordrecht: Kluwer Academic Publishers. Paulsrud, P. (2001) The Nostoc symbiont of lichens. Diversity, specificity and cellular modifications. Acta Universitatis Upsaliensis Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 662: 1–55. Paulsrud, P. & Lindblad, P. (1998) Sequence variation of the tRNALeu intron as a marker for genetic diversity and specificity of symbiotic cyanobacteria in some lichens. Applied and Environmental Microbiology 64: 310–315. Paulsrud, P., Rikkinen, J. & Lindblad, P. (1998) Cyanobiont specificity in some Nostoc-containing lichens and a Peltigera aphthosa photosymbiodeme. New Phytologist 139: 517–524. Paulsrud, P., Rikkinen, J. & Lindblad, P. (2000) Spatial patterns of photobiont diversity in some Nostoccontaining lichens. New Phytologist 146: 291–299. Paulsrud, P., Rikkinen, J. & Lindblad, P. (2001) Field investigation on cyanobacterial specificity in Peltigera aphthosa. New Phytologist 152: 117–123. Rai, A. N. (2002) Cyanolichens: nitrogen metabolism. In Cyanobacteria in Symbiosis (A. Rai, B. Bergman & U. Rasmussen, eds.): 97–115. Dordrecht: Kluwer Academic Publishers. Rasmussen, U. & Nilsson, M. (2002) Cyanobacterial diversity and specificity in plant symbioses. In Cyanobacteria in Symbiosis. (A. Rai, B. Bergman & U. Rasmussen, eds.): 313–328. Dordrecht: Kluwer Academic Publishers. Rikkinen, J., Oksanen, I. & Lohtander, K. (2002) Lichen guilds share related cyanobacterial symbionts. Science 297: 357. Rippka, R., Deruelles, J., Waterbury, J. B., Herdman, M. & Stanier, R. Y. (1979) Generic assignments, strain histories and properties of pure cultures of cyanobacteria. Journal of General Microbiology 111: 1–61. Scheidegger, C. (1994) Low-temperature scanning electron microscopy: the localization of free and perturbed water and its role in the morpholgy of the lichen symbionts. Cryptogamic Botany 4: 290–299. Summerfield, T. C., Galloway, D. J. & Eaton-Rye, J. J. (2002) Species of cyanolichens from Pseudocyphellaria with indistinguishable ITS sequences have di#erent photobionts. New Phytologist 155: 121–129. Swo#ord, D. L. (2000) PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sunderland, Massachusetts: Sinauer Associates. Thompson, J. D., Higgins, D. G. & Gibson, T. J. (1994) ClustalW: improving the sensitivity of progressive multiple sequence alignment through

2003

Photobiont diversity in Nephroma—Lohtander et al.

sequence weighting, positions-specific gap-penalties and weigh matrix choice. Nucleic Acids Research 22: 4673–4680. Tre´mouillaux-Guiller, J., Rohr, T., Rohr, R. & Huss, V. A. R. (2002) Discovery of an endophytic alga in Ginkgo biloba. American Journal of Botany 85: 727–733. Tschermak-Woess, E., (1988) The algal partner. In CRC Handbook of Lichenology, Vol. I (M. Galun, ed.): 39–92. Boca Raton: CRC Press Inc. Tønsberg, T. & Holtan-Hartwig, J. (1983) Phycotype pairs in Nephroma, Peltigera and Lobaria in Norway. Nordic Journal of Botany 3: 681–688. West, N. J. & Adams, D. G. (1997) Phenotypic and genotypic comparison of symbiotic and free-living cyanobacteria from a single field site. Applied and Environmental Microbiology 63: 4479–4484. Wetmore, C. M. (1960) The genus Nephroma in North and Middle America. Publications of the Museum, Michigan State University, Biological Series 1: 369–452. White, F. J. & James, P. W. (1988) Studies on the genus Nephroma. II. The southern temperate species. Lichenologist 20: 103–166. White, T. J., Bruns, T. D., Lee, S. & Taylor, J. W. (1990) Amplification and direct sequencing of fungal ribosomal genes for phylogenetics. In PCR

339

Protocols (M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White, eds): 315–322. San Diego: Academic Press. Wilmotte, A. (1994) Molecular evolution and taxonomy of the cyanobacteria. In The Molecular Biology of Cyanobacteria (D. A. Bryant, ed.): 1–25. Dordrecht: Kluwer Academic publishers. Wilmotte, A., Neefs, J. M. & de Wachter, R. (1994) Evolutionary a$liation of the marine nitrogen-fixing cyanobacterium Trichodesmium sp. strain NIBB 1067, derived by 16S ribosomal RNA sequence analysis. Microbiology 140: 2159–2164. Wilmotte, A., Turner, S., van de Peer, Y. & Pace, N. R. (1992) Taxonomic study of marine Oscillatorian strains (cyanobacteria) with narrow trichomes. II. Nucleotide sequence analysis of the 16S ribosomal RNA. Journal of Phycology 28: 828–838. Wilmotte, A., van der Auwera, G. & de Wachter, R. (1993) Structure of the 16S ribosomal RNA of the thermophilic cyanobacterium Chlorogloeopsis HTF (‘Mastigocladus laminosus HTF’) strain PCC 7518, and phylogenetic analysis. FEBS (Federation of European Biochemical Societies) Letters 317: 96–100. Wright, D., Prickett, T., Helm, R. F. & Potts, M. (2001) Form species Nostoc commune (Cyanobacteria). International Journal of Systematic and Evolutionary Microbiology 51: 1839–1852.

Accepted for publication 9 July 2003