Hemolymph transcriptome analysis of Chinese mitten crab (Eriocheir sinensis) with intact, left cheliped autotomy and bilateral eyestalk ablation

Hemolymph transcriptome analysis of Chinese mitten crab (Eriocheir sinensis) with intact, left cheliped autotomy and bilateral eyestalk ablation

Fish and Shellfish Immunology 81 (2018) 266–275 Contents lists available at ScienceDirect Fish and Shellfish Immunology journal homepage: www.elsevie...

NAN Sizes 0 Downloads 24 Views

Fish and Shellfish Immunology 81 (2018) 266–275

Contents lists available at ScienceDirect

Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Hemolymph transcriptome analysis of Chinese mitten crab (Eriocheir sinensis) with intact, left cheliped autotomy and bilateral eyestalk ablation

T

Cong Zhanga,∗∗,1, Yangyang Panga,1, Qian Zhanga, Genyong Huanga, Minjie Xua, Boping Tangb, Yongxu Chenga,∗∗∗, Xiaozhen Yanga,∗ a

National Demonstration Center for Experimental Fisheries Science Education, Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture, Engineering Research Center of Aquaculture, Shanghai Ocean University, Shanghai, China b Jiangsu Key Laboratory for Bioresources of Saline Soils, Jiangsu Synthetic Innovation Center for Coastal Bio-agriculture, Jiangsu Provincial Key Laboratory of Coastal Wetland Bioresources and Environmental Protection, School of Ocean and Biological Engineering, Yancheng Teachers University, Yancheng, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Eriocheir sinensis Hemolymph Autotomy cheliped Eyestalk ablation Comparative transcriptome

In the pond culture of Eriocheir sinensis, high limb-autotomy seriously affects the quality and culture's economic efficiency. Based on our previous studies, limb autotomy can induce the changes of hematological immune response in E. sinensis hemolymph. Eyestalk ablation can accelerate the regeneration of limbs after autotomy. To detect the important functional genes related to the hematological molecular immunity of E. sinensis, we compared and analyzed the hemolymph transcriptome data of the intact crab, left cheliped autotomized crabs and bilateral eyestalk ablation crabs with high-throughput sequencing techniques. The results showed that the three groups obtained 62 172 414, 68 143 682, and 67 811 618 clean reads, respectively. A total of 9567 differentially expressed genes were obtained by multiple comparison of the three groups' libraries. Gene ontology (GO) functional classification analysis shows that the differential genes belong to 42 categories of biological process, cellular components and molecular function. The differentially expressed genes in the three libraries were enriched to 344 specific KEGG metabolic pathways by KEGG enrichment analysis, such as the up-regulated gene (dual oxidase (Duox), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein (YWHAQ)) in MAPK signaling pathway, the up-regulated gene (aldehyde dehydrogenase 1 (ALDH 1)) and down-regulated gene (UDP-glucuronosyltransferase 2 (UGT 2)) in metabolism of the xenobiotics by cytochrome P450 pathway, the down-regulated gene (actin gene (AG), heat shock protein 90 (HSP 90)) in fluid shear stress and atherosclerosis pathway. To verify the expression levels of DEGs identified by RNA-Seq, the above six hematological immune-related genes were selected for qRT-PCR validation, the qRT-PCR results were consistent with the DEGs results. Our research obtained abundant E. sinensis hemolymph transcriptome information by RNA-Seq, which provides multi-level information for the cloning of novel genes and the study of hemolymph molecular immunology mechanisms of E. sinensis.

1. Introduction The Chinese mitten crab (Eriocheir sinensis) is an important special aquaculture species in China, which is delicious, nutritious, has high economic value, and is widely distributed in China's north-south coastal lakes and rivers [1]. At present, most of E. sinensis' culture models are

pond mixed culture and high-density culture, which frequently lead to limb autotomy. During the pond culture of E. sinensis, various factors can cause a high rate of limb autotomy, such as fighting, defense and foraging, unsuccessful or unsynchronized molting and artificial harvesting [2–5]. The limb-autotomy rate of E. sinensis has seriously affected the survival rate, quality and economic benefits of aquaculture.

∗ Corresponding author. Key Laboratory of Freshwater Aquatic Genetic Resources, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai, 201306, PR China. ∗∗ Corresponding author. Key Laboratory of Freshwater Aquatic Genetic Resources, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai, 201306, PR China. ∗∗∗ Corresponding author. Key Laboratory of Freshwater Aquatic Genetic Resources, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai, 201306, PR China. E-mail addresses: [email protected] (C. Zhang), [email protected] (Y. Cheng), [email protected] (X. Yang). 1 These authors contributed equally to this work.

https://doi.org/10.1016/j.fsi.2018.07.025 Received 28 April 2018; Received in revised form 8 July 2018; Accepted 11 July 2018 1050-4648/ © 2018 Elsevier Ltd. All rights reserved.

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

In recent years, the effect of limb-autotomy on E. sinensis has mostly remained at the macroscopic level, such as feeding efficiency [6], molting cycle [7] and survival rate [8]. Although, the changes in hemolymph physiology after limb autotomy have been studied, there is still no report on the effect of limb autotomy on E. sinensis at the genetic level, such as molecular immunology [9]. In addition, as an important neuroendocrine regulatory organ of crustaceans, the eyestalk plays an important role in molting, growth and gonadal development [10]. At present, it is very common for shrimps and crabs to ablate the eyestalk to promote molting, further accelerating the regeneration of the limb [1,11]. However, limb autotomy or eyestalk ablation will bring negative impacts on the immunity and antibacterial response of crustaceans [9,12–14]. However, the molecular mechanism of their immune regulation has not been reported. Unlike vertebrates, the crustacean's immune system is composed of the innate immune system, which includes hematological and cellular immunity. Hematological immunity mainly involves various hematological immune factors and immune-related enzymes in the hemolymph, such as heat shock protein 90 (HSP 90), tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein (14-3-3 protein, YWHAQ), dual oxidase (Duox), aldehyde dehydrogenase 1 (ALDH 1), Cathepsin L (CatL) and UDP-glucuronosyltransferase 2 (UGT 2) [15–19]. Hemocyte immunity mainly includes phagocytosis, package action, agglutination and melanization of hemocyte [20]. These immune regulators will function through one or some metabolic pathways. The MAPK signaling pathway is an important signaling system that mediates cellular response, which participates in the processes of cell growth, development, division, death, immune defense and stress response [21], Duox and YWHAQ belong to this pathway. Cytochrome P450 is involved in a variety of metabolic and biosynthetic processes, of which the cytochrome P450 enzyme is a multifunctional enzyme that is involved both in the biotransformation of exogenous substances and in the metabolism of endogenous substances [22], ALDH 1 and UGT 2 belong to this pathway. The fluid shear stress and atherosclerosis pathway include many immune-related proteins (e.g. HSP 90, AG, hioredoxin 1 (Trx 1)) and related enzymes (cathepsin L (Cts L), which are associated with body immunity, substance metabolism, cell structure and function maintenance, showed a significant down-regulation [23,24]. In addition, when the crustacean suffers from an external injury, the hemolymph and hemocyte are the quickest and most effective ways to exert immunity and wound repair. So far, there have been no reports on the hemolymph molecular immunological mechanism of E. sinensis after limb autotomy and eyestalk ablation. The development of highthroughput sequencing technology has become an important tool for studying the functional genomics of many species, especially exploring the molecular mechanisms of some biological phenomena. In this study, we performed hemolymph transcriptome comparisons between intact crabs, left cheliped autotomized crabs and bilateral eyestalk ablation crabs using transcriptomic high-throughput sequencing technology and bioinformatics methods. Our study will provide new insights into the hematological immunity and biological responses of the species to limb autotomy and eyestalk ablation.

Table 1 Primer information for quantitative real-time polymerase chain reaction. Primers

Sequences (5′-3′)

Duox-F Duox-R YWHAQ-F YWHAQ-R ALDH1-F ALDH1-R UGT2-F UGT2-R AG-F AG-R HSP90-F HSP90-R β-actin -F β-actin -R

TTGGCTTCTGGTCTGAGGAG CATGTGTCAACACAGCCAGT GGAATGGAGATGTGTAAATAGG ATCAGACAGTGCAGGAGAAGA CATCCGCAACCTGGAGGTCA CTCCCGAGTTGAAGGGTTACAT AAAAACAGGAATGCCCAGGAC AAGTGGCTACCCCAGCAAGAC GCTGTTGTGACAAAAGAATAAC AGTGCCCATCTATGAAGGTTA GAAGGTGATCCGCAAGAACC GTTGGTGGAGTCCTCATGGA TCATCACCATCGGCAATGA TTGTAAGTGGTCTCGTGGATG

Table 2 Evaluation of RNA-Seq Data of E. sinensis with different treatment.

Raw reads Clean reads Clean ratio (%) rRNA trimed rRNA ratio (%)

C

BESA

LCAu

65 201 612 62 172 414 95.35 61 819 301 0.57

71 413 202 68 143 682 95.42 67 878 007 0.39

70 693 958 67 811 618 95.92 67 536 543 0.41

Note: Clean ratio = (Clean reads/Raw reads) * 100%; rRNA ratio = [(Clean reads – rRNA trimed)/Clean reads] * 100%.

group): 1) control group (C); 2) left cheliped autotomized (LCAu), where autonomy was achieved by gently grasping the left cheliped using the researcher's fingers and then the crab would spontaneously autotomize the corresponding limb; and 3) bilateral eyestalk ablation group (BESA), where eyestalk ablation was performed by clipping the eyestalk using sterile scissors and immediately cauterizing the wound to prevent the loss of hemolymph and avoid infection. Before the start of the experiment, all crabs used for the experiment were anesthetized on ice, and both the crabs and all the experimental tools were wiped with sterile 75% alcohol cotton balls. 2.2. Sample collection After treatment, hemolymph was drawn using a sterile 1-mL syringe from the unsclerotized membrane of the right third pereopods and was immediately diluted 1:1 with sterile anticoagulant (30 mM trisodium citrate, 338 mM NaCl, 115 mM glucose, and 10 mM EDTA). The mixture was centrifuged at 12000 r/min for 10 min, after which the supernatant was discarded, and the precipitate was collected and stored in liquid nitrogen for RNA isolation. 2.3. RNA isolation and RNA-Seq library preparation

2. Materials and methods

In each group of 10 samples, two samples were randomly selected and mixed for 5 biological replicates in each group. Total RNA was extracted from collected hemolymph using RNAiso™ plus reagent (RNA Extraction Kit, TaKaRa, Japan) according to the manufacturer's protocol. The total RNA concentration, integrity and quality were estimated using a micro-volume ultraviolet–visible spectrophotometer (Quawell Q5000; Thmorgan, China) and agarose-gel electrophoresis, respectively. The RNA integrity number (RIN) of all the RNA samples above 8.0 was used for RNA-Seq library construction using the Illumina Truseq™ RNA sample Prep Kit (Illumina, USA). Then, we used the Illumina Truseq™ 2000 sequencing platform to complete the transcriptome sequencing. The transcriptome sequencing of the target

2.1. Experimental crabs and ethics All experimental protocols were reviewed and approved by the Animal Bioethics Committee, Shanghai Ocean University, China. Sampling operations complied with the IACUS Guidelines for the Care and Use of Animals in Scientific Experiments. During early July 2017, 30 male healthy and intact E. sinensis (Crustacea; Decapoda; and Grapsidae) (13.25 g ± 2.92 g) were collected from the earth pond at the Chongming research base of Shanghai Ocean University (Shanghai, China). Crabs were randomly divided into three groups (10 crabs each 267

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

Fig. 1. The function of the GO classification statistics of E. sinensis with different treatments. (A) BESA group vs C group; (B) LCAu group vs C group; (C) LCAu group vs BESA group.

sample was completed by Shanghai Biotechnology Corporation (Shanghai, China).

2.6. Quantitative real-time polymerase chain reaction (qRT-PCR validation) and statistical analyses

2.4. Transcriptome data processing and analysis

To confirm the accuracy of the RNA-Seq results, 6 pairs of genes were selected for qRT-PCR validation from the 3 metabolic pathways that were significantly enriched for differential genes. qRT-PCR was performed using the ABI 7500 Real-Time PCR System (Life Technology, USA) with ChamQ™ Universal SYBR® qPCR Master Mix (Vazyme Biotech Co., Ltd, Nanjing, China) kits using the following program: 95 °C for 30 s; 40 cycles at 95 °C for 5 s, 60 °C for 34 s; and followed by a melting curve at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. The PCR primer sequences are present in Table 1 (Sangon Biotech Co., Ltd. Shanghai, China). β-actin was used as the internal control and performed in triplicate for each sample. Relative changes in the level of the gene expression were determined by the 2-△△Ct method. Data were analyzed and presented as the average values ± standard deviation (SD). In addition, the percentage values (dependent variable) were arcsine transformed before the analysis. Tukey's honestly significant difference test (Tukey's HSD) and one-way ANOVA were used to analyze the statistical significance between the five groups, and a Pvalue < 0.05 was considered significant. All statistical analyses were performed using SPSS 20.0 software (Chicago, USA; Version 22.0).

First, Seqtk was used to filter the raw reads from the sequencing to get clean reads that can be used for data analysis. After filtering, RNASeq high-quality sequencing data were obtained, and then de novo splicing was performed using Trinity software (version number: trinityrnaseq_r20140413) [25]. The final UniGene sequences were compared with the Go (Gene Ontology) database [26], and the comparison results of the best hit were classified according to molecular function, cellular component and biological process. We used BlastX2.2.25 [27] to compare with the UniProt, Nr, and KEGG databases to obtain the corresponding annotation information (E-value < 1e-5). 2.5. Differential gene expression analysis EdgeR [28] was applied to analyze the gene differences among the samples. After p-values were obtained, multiple hypothesis tests were performed and corrected, and the threshold of the p-value was determined by controlling the FDR (false discovery rate) [29]. The corrected p-value was the q-value. At the same time, we calculate the differential expression multiples based on the FPKM value, i.e., fold change. The screening conditions for the differential genes were the qvalue ≤ 0.05 and fold change ≥ 2. 268

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

cellular component (Fig. 1 B). Moreover, the comparison results between the BESA group and LCAu group libraries were the same as those of the C group and the BESA group libraries (Fig. 1C).

Table 3 Results of KEGG Pathway of E. sinensis with different treatment. Pathway

Ribosome MAPK signaling pathway Toll and Imd signaling pathway Other glycan degradation Antifolate resistance Sphingolipid metabolism ABC transporters Metabolism of xenobiotics by cytochrome P450 Glycosaminoglycan biosynthesis Phenylalanine metabolism Pentose and glucuronate interconversions Phagosome Fluid shear stress and atherosclerosis Plant-pathogen interaction Th17 cell differentiation IL-17 signaling pathway Isoquinoline alkaloid biosynthesis Glycosphingolipid biosynthesis Caffeine metabolism Tropane, piperidine and pyridine alkaloid biosynthesis

DEGS with pathway

Pathway ID

3.3. Significant enrichment analysis of KEGG pathway

BESA vs C

LCAu vs C

LCAu vs BESA

42 – –

– 9 8

44 – –

ko03010 ko04013 ko04624

– – – – –

4 4 4 4 3

– – – – –

ko00511 ko01523 ko00600 ko02010 ko00980



2



ko00532

– –

2 2

3 –

ko00360 ko00040

– –

– –

12 12

ko04145 ko05418

– – – –

– – – –

6 6 6 3

ko04626 ko04659 ko04657 ko00950

– – –

– – –

3 3 2

ko00601 ko00232 ko00960

To further understand the relationship between differentially expressed genes under different processing conditions, the differentially expressed genes in the three libraries were enriched to 344 specific KEGG metabolic pathways by KEGG enrichment analysis, of which 20 differential genes were significantly enriched in the metabolic pathway with a Q-value < 0.05 (Table 3). Differentially expressed genes with different treatments in the ribosome (ko03010), MAPK signaling pathway (ko04013) (Fig. 2), metabolism of xenobiotics by cytochrome P450 (ko00980) (Fig. 3), fluid shear stress and arteriosclerosis (ko05418) (Fig. 4) and other pathways were significantly enriched. 3.4. Differential expression analysis The basic information of the differentially expressed genes in the hemolymph between the three groups was obtained by a comparative analysis of each of the three databases. There were 1884 genes upregulated and 1993 genes down-regulated in the control group (C) compared with the bilateral eyestalk ablation group (BESA). Compared with the control group (C) and the left cheliped autotomized group (LCAu), there were 2019 genes up-regulated and 1629 genes downregulated. Moreover, 1148 up-regulated genes and 894 down-regulated genes were observed when compared with the bilateral eyestalk ablation group (BESA) and the left cheliped autotomized group (LCAu) (Fig. 5). In the comparison of the LCAu and C groups, the up-regulated genes, such as the aldehyde dehydrogenase 1 gene (ALDH 1), dual oxidase gene (Duox), and tyrosine 3-monooxygenase/tryptophan 5monooxygenase activation protein gene (YWHAQ), are involved in cell growth, tissue repair, and immune defense. Moreover, compared with the LCAu group and the BESA group, we observed that genes such as the actin gene (AG), UDP-glucuronosyltransferase 2 gene (UGT 2) and heat shock protein 90 gene (HSP 90) were down-regulated, which played an important role in maintaining the normal cell morphology and resisting bacterial invasion.

3. Results 3.1. Transcriptome sequence assessment and annotation Three groups of E. sinensis hemolymph transcriptomes were sequenced, and 65 201 612 (C), 71 413 202 (BESA) and 70 693 958 (LCAu) raw reads sequences were obtained (Table 2). After filtering unqualified reads with low quality, containing sequencing primers and low end quality, 62 172 414 (C), 68 143 682 (BESA), and 67 811 618 (LCAu) clean reads that can be used for data analysis were obtained (Table 2). Additionally, 330 686 unigenes were obtained from transcripts after de novo stitching of the sample sequencing data using Trinity software. Among them, 52 297 and 48 001 unigenes were annotated by the UniProt and Nr database, respectively, and the annotation ratios were 30.88% and 28.34%, respectively, which helped us to understand and analyze the Unigene sequence information as a whole.

3.5. qRT-PCR verification To verify the expression levels of differential expression genes (DEGs) identified by RNA-Seq, three up-regulated genes and three down-regulated genes were randomly selected from three groups for qRT-PCR analysis. The expression levels of the DEGs involved in immune system defense (Duox, YWHAQ, and ALDH 1) were significantly increased (P < 0.05) in the LCAu group (8.97 ± 2.58, 2.72 ± 0.43, 7.20 ± 2.35, respectively), whereas the expression level of UGT 2 (LCAu group: 1.18 ± 0.21) was significantly decreased (P < 0.05) compared with the C group (1 ± 0.17, 1.48 ± 0.36, 1.32 ± 0.31, 13.30 ± 3.45, respectively) (Fig. 6). Moreover, the levels of DEG involved in immune system defense and maintenance of cell morphological structure (HSP 90 and AG) were significantly decreased in the LCAu group (1.49 ± 0.52, 1.41 ± 0.41, respectively) (P < 0.05) compared with the BESA group (5.86 ± 1.62, 5.18 ± 1.40, respectively) (Fig. 4). The qRT-PCR results showed that the expression of the selected six genes was consistent with our DEG results.

3.2. GO functional classification of differentially expressed genes The Blastx alignment (E-value < 1e-5) was performed between the Unigene sequence and the GO (Gene Ontology) database. The results of the best hit were classified according to biological process, cellular component and molecular function, which can be categorized into 42 categories of 3 major ontologies (Fig. 1). By comparing the databases of the C group and the BESA group, we found that in the biological process, genes associated with the metabolic processes, cellular process and single-organism process were enriched. In the cellular component category, genes associated with the cell, cell part, organelle, and macromolecular complex were more enriched. In the category of the molecular functions, genes associated with binding and catalytic activity were enriched (Fig. 1 A). The comparison results between the C group and the LCAu group library were similar to that of the C group and the BESA group, but the difference was that no significant gene enrichment was found in the

4. Discussion In recent years, with the continuous development of RNA-Seq technology, its application in aquatic animals has received increasing attention. At present, this technique has made great progress in many aspects, such as the anti-stress response, immune response, biological evolution and pathology of aquatic animals [30]. In this study, the 269

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

Fig. 2. Localization of differentially expressed genes in the MAPK signaling pathway. Up-regulated genes are marked by red rectangles. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

group. Duox plays an important role in the immune defense system of organisms, and YWHAQ is also involved in the regulation of many important cell life activities, such as the glucose and lipid metabolism, cell cycle, cell growth and development, etc. [17,31]. Reactive oxygen species (ROS) play an important role in the innate immunity of the crustacean [32]. ROS includes the superoxide anion (O2−) and superoxide-derived hydrogen peroxide (H2O2) that can be used independently or in combination with other free radical intermediates and is mainly associated with antibacterial and antiviral host defense mechanisms [33,34]. However, Duox is one of the important enzymes that produce ROS [35]. Studies have shown that Vibrio penaeicida injection combined with Duox gene knockdown increased the mortality rate of Marsupenaeus japonicus compared to untreated shrimp [35]. The study found that in Drosophila, Duox was expressed in the intestine and participates in intestinal immunity and host resistance during natural infections, and the survival rate of Drosophila infected with Erwinia carotovora 15 is significantly decreased after injection of specific RNAi

RNA-Seq technique was used to perform transcriptome sequencing on the hemolymph of E. Sinensis with limb-intact, left cheliped autotomized and bilateral eyestalk ablation, respectively. As a result, many gene sequences were obtained, and the genomic resources of E. sinensis were enriched to some extent. 4.1. Immune-related genes (e.g. Duox, YWHAQ) in MAPK signaling pathway The expression of many genes showed significant up- or downregulation in the MAPK signaling pathway of the significantly enriched KEGG pathway (Fig. 2). The MAPK signaling pathway is an important signaling system that mediates cellular response, which participates in the processes of cell growth, development, division, death, immune defense and stress response [21]. In the MAPK signaling pathway, the expression of Duox and YWHAQ in the hemolymph transcriptome of the LCAu group was significantly up-regulated compared to the control 270

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

Fig. 3. Localization of differentially expressed genes in the metabolism of xenobiotics by the cytochrome P450 pathway. Up-regulated genes are marked by red rectangles; Down-regulated genes are marked by green rectangles. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

prevent further deterioration of the wound. Our results are similar to those of some studies on Duox in insects and humans [36,38,39]. As a highly conserved soluble acidic protein, the tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein (14-3-3 protein, YWHAQ) is involved in the regulation of many important life activities in organisms, such as metabolism, cell signaling transduction,

sequences against Duox [36,37]. The present study found that compared with intact crabs, the expression of the Duox gene (EC:1.6.3.1 1.11.1.-, Red gene, Fig. 5) in the hemolymph was significantly increased after left cheliped autotomized. We speculate that the significantly increased Duox gene expression in the hemolymph was to expedite the clearance of infected bacteria from the hemolymph and to 271

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

Fig. 4. Localization of differentially expressed genes in the fluid shear stress and atherosclerosis pathway. Down-regulated genes are marked by green rectangles. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

suffering from hypoxic stress or injection of Vibrio parahaemolyticus [16].

4.2. Immune-related genes (e.g. ALDH 1, UGT 2) in metabolism of xenobiotics by cytochrome P450 pathway Cytochrome P450 is involved in a variety of metabolic and biosynthetic processes, of which the cytochrome P450 enzyme is a multifunctional enzyme that is involved both in the biotransformation of exogenous substances and in the metabolism of endogenous substances [22]. In the metabolism of xenobiotics by the cytochrome P450 pathway (Fig. 3), the expression of ALDH 1 in the hemolymph transcriptome of the LCAu group was significantly up-regulated compared to the control group, whereas the expression of UGT 2 was significantly down-regulated. As a class of cytoplasmic isozymes, the aldehyde dehydrogenase (ALDH) family is responsible for the oxidation of intracellular aldehydes, which can promote the oxidation of retinol to retinoic acid in early stem cell differentiation, thereby protecting cells from oxidative damage [44–47]. ALDH1 is in class 1 of the ALDH family and is the predominant ALDH isoform in mammals, which can act as a regulator of cell proliferation and regulate the proliferation of stem cells [18,48]. Studies have shown that ALDH1 is a specific marker for stem cells in breast cancer and is associated with the occurrence of diseases [49]. In our study, the expression of the ALDH 1 gene in the hemolymph of E. sinensis was significantly up-regulated after the left cheliped was

Fig. 5. Differentially expressed genes of E. sinensis with different treatments.

cell proliferation and apoptosis, immune defense, etc. [40]. In addition, studies have found that the tyrosine 3-monooxygenase/tryptophan 5monooxygenase activation protein (14-3-3 1β) is involved in association with glucose and lipid metabolism and participates in biological processes such as glycolysis, gluconeogenesis and fat synthesis [41]. Nomura et al. showed that BAX, a protein that regulates apoptosis, can bind with the 14-3-3ζ to inhibit cell apoptosis directly [42]. Fanger and other studies have found that 14-3-3ζ can be involved in MAPK signaling pathways by combining MEKK1 and indirectly inhibiting apoptosis [43]. The present study found that to prevent cell apoptosis and enhance immune defense, the expression level of YWHAQ in the hemolymph of E. increased was significantly up-regulated after left cheliped autotomy. Similar results appeared in Haliotis diversicolor after 272

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

Fig. 6. Expression levels of six selected DEGs normalized to β-actin of E. sinensis with different treatments. Groups marked “*” represented significant difference at P < 0.05.

environmental or pathogenic stress, a heat shock reaction occurs, and the HSP 90 gene is induced to express, which is related to the body's injury and infection and participates in the related immune stress responses [53]. Studies have found that when Charybdis japonica was exposed to disrupting chemicals (EDCs), such as bisphenol A (BPA) and 4-nonylphenol (NP), the expression of the HSP 90 gene in crab tissue was significantly increased in a short time [54]. Studies of shrimp Fenneropenaeus chinensis [55], aquatic midge Chironomus riparius [56] and rare minnow Grobiocypris rarus [57] found that environmental stress (such as heat shock and hypoxia) and other EDCs (such as di-2ethylhexyl phthalate and atrazine) could cause significant up-regulation of the HSP 90 gene expression in tissues. The thioredoxin system is one of the most important antioxidant systems in the organism, which maintains the organism's redox balance [58]. At present, the most studied is the thioredoxin-1 gene (Trx 1) [24]. The study found that Trx 1 can participate in many physiological activities of cells and plays an important role in various identities, such as somatomedin and enzyme receptors [59]. In the present experiment, we found that the expression levels of HSP 90 and Trx 1 in the hemolymph from the BESA group were significantly lower than those in the LCAu group. Although the loss of cheliped or the loss of the eyestalk is an injury to the organism itself, there is a difference in the size of the wound. Moreover, autotomy is a congenital active response to cope with external stress, whereas bilateral eyestalk ablation is acquired by passive mechanical injury. Therefore, there are great differences in the damage caused to the crabs by the two treatments. Compared with left cheliped autotomization, bilateral eyestalk ablation caused more serious damage to the body. Our previous study found that the survival rate of crabs was severely affected after eyestalk ablation [1]. Therefore, to cope with the damage to the body, the crab mobilized many immune-related proteins and immune-related enzymes to enhance the antioxidant ability and immunity. In response to environmental stresses, the immune-related proteins and immune-related enzymes will work together to enhance the body's immune defense ability. Cathepsin L (CatL), a major member of the

autotomized compared with the limb-intact crabs. We speculated that in this process, the up-regulation of ALDH 1 expression not only protects cells from oxidative damage but also promotes hemocyte proliferation to repair wounds and prevent the further loss of hemolymph. Our previous study found that the total hemocyte counts (THC) of E. sinensis were significantly increased, and there was agglutination at the wound area after autotomy the left cheliped [9]. UDP-glucuronosyltransferase (UGT) is widely present in many organisms, from bacteria to humans. As a membrane protein combined with the endoplasmic reticulum, UGT can play a catalytic role in the transfer of glucuronic acid and promote the biotransformation of endogenous and exogenous chemical substances in organisms [50,51]. It was previously reported that the UGT 2 family is an important liver drug metabolism enzyme [52]. In the present study, the expression of the UGT 2 gene (EC:2.4.1.17, Green gene, Fig. 6) in the hemolymph of E. Sinensis was significantly down-regulated after the left cheliped was autotomized compared with the limb-intact crabs. We hypothesized that the normal metabolic function of the body was affected after left cheliped autotomization, the transfer process of glucuronic acid was inhibited, and the elimination of endogenous toxins was hindered.

4.3. Immune-related genes (e.g. AG, HSP 90) in fluid shear stress and atherosclerosis pathway In the fluid shear stress and atherosclerosis pathway, the gene expression of related proteins (HSP90, AG, hioredoxin 1 (Trx 1)) and related enzymes (cathepsin L (Cts L)), which are associated with body immunity, substance metabolism, cell structure and function maintenance, showed a significant down-regulation (Fig. 4, Green gene). HSP 90 is an abundant molecular chaperone and an important component of the body's anti-stress response. It plays a key role in signal transduction, cell cycle control, genome silencing, and protein translocation. Moreover, HSP 90 plays an important role in resisting the invasion of pathogens, regulating immune function and anti-aging [23]. Studies have reported that when the crustacean is exposed to 273

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

papain C1 family in cysteine proteases, is widely present in various biological organisms [60]. As a lysosomal protein, CatL plays an important role in the innate immune regulation of invertebrates. CatL participates in important life activities, such as proteolysis, tissue regeneration, bone resorption, antigen presentation, and apoptosis in vivo [61]. A previous study reported that the expression level of the CatL gene in hemocytes was significantly up-regulated after infection with Vibrio anguillarum [19]. Similar results were observed in the study of Litopenaeus vannamei [62]. Therefore, CatL may play an important role in the defense of bacteria and viruses. In present study, we observed that the expression of the CatL gene in the hemolymph of BESA group crabs was significantly higher than that in the LCAu group. We believe that bilateral eyestalk ablation will result in larger wounds, which is more susceptible to bacterial infection than left cheliped autotomy. Therefore, the organism will significantly up-regulate the expression of the antibacterial-related enzyme genes to prevent bacterial and viral infections.

[6] [7]

[8]

[9]

[10] [11]

[12]

[13]

5. Conclusion [14]

This study not only compared the differences between the hemolymph transcriptomes of left cheliped autotomized crabs and intact crabs of E. sinensis but also explored the differences between the left cheliped autotomized crabs and the bilateral eyestalk ablation crabs. The results showed that compared with intact crabs, the autotomized/ eyestalk ablation crabs rapidly mobilized immune-related proteins and immune-related enzymes in the hemolymph and up-/down-regulated the expression of related genes to enhance the body's immune defense ability and regulated the body's restoration of the normal immunity level as soon as possible. In addition, as a congenital stress response mechanism, the effect of autotomy on the immune system is less than that caused by human-induced injuries. In this experiment, the differentially expressed genes of the intact crab, left cheliped autotomized crabs and bilateral eyestalk ablation crabs were detected and screened by transcriptomic high-throughput sequencing technology and bioinformatics methods. However, these studies were only preliminary studies, which helped to provide some scientific references for studying the molecular immune mechanisms of crustacean limb autotomy and eyestalk ablation.

[15]

[16] [17]

[18]

[19]

[20]

[21] [22] [23]

[24]

Declarations of interest

[25]

None. [26]

Acknowledgements

[27]

This work was supported by the Extension of Chinese Mitten Crab Eriocheir Sinensis Aquaculture Technology that was found from Shanghai Agricultural Commission [grant number 2015D1-7], the Aquaculture Engineering Research Platform in Shanghai Established by (Shanghai Science and Technology Commission [grant number 16DZ2281200]), and the China Agriculture Research System [grant number CARS-48].

[28]

[29] [30] [31] [32]

References

[33] [1] C. Zhang, X.Z. Yang, M.J. Xu, et al., Melatonin promotes cheliped regeneration, digestive enzyme function, and immunity following autotomy in the Chinese mitten crab, Eriocheir sinensis, Front. Physiol. 9 (2018) 269–280. [2] C.W. Thomas, C.G. Carter, B.J. Crear, Feed availability and its relationship to survival, growth, dominance and the agonistic behaviour of the southern rock lobster, Jasus edwardsii in captivity, Aquaculture 215 (2003) 45–65. [3] R. Riquelme-Bugueño, Incidence patterns of limb autotomy in the estuarine crab, Hemigrapsus crenulatus (H. Milne edwards, 1837) (Brachyura, grapsoidea) from a temperate estuary in the eastern south pacific, Crustaceana 79 (2006) 925–932. [4] L. Sui, M. Wille, Y. Cheng, et al., Larviculture techniques of Chinese mitten crab Eriocheir sinensis, Aquaculture 315 (2011) 16–19. [5] R.N. Lipcius, W.F. Herrnkind, Molt cycle alterations in behavior, feeding and diel

[34] [35]

[36] [37]

[38]

274

rhythms of a decapod crustacean, the spiny lobster Panulirus argus, Mar. Biol. 68 (1982) 241–252. R.E. Brock, L.D. Smith, Recovery of claw size and function following autotomy in Cancer productus (Decapoda: Brachyura), Biol. Bull. 194 (1998) 53–62. E.T. Quinitio, F.D.P. Estepa, Survival and growth of Mud crab, Scylla serrata, juveniles subjected to removal or trimming of chelipeds, Aquaculture 318 (2011) 229–234. J.L. Simonson, Reversal of handedness, growth, and claw stridulatory patterns in the stone crab Menippe mercenaria (say) (Crustacea: xanthidae), J. Crustac Biol. 5 (1985) 281. X.Z. Yang, C. Zhang, G.Y. Huang, et al., Cellular and biochemical parameters following autotomy and ablation-mediated cheliped loss in the Chinese mitten crab, Eriocheir sinensis, Dev. Comp. Immunol. 81 (2017) 33–43. K.V. Jayalakshmy, T. Balasubramanian, Effect of eyestalk ablation on moulting and growth in penaeid prawns: Metapenaeus monoceros, Indian J. Fish. 57 (2010) 25–32. R. Fernandez, E.V. Radhakrishnan, Effect of bilateral eyestalk ablation on ovarian development and moulting in early and late intermoult stages of female spiny lobster Panulirus homarus (Linnaeus, 1758), Invertebr. Reprod. Dev. 60 (2016) 238–242. A.C.J. Asusena, S.H.J. Carlos, F.C.J. Arturo, et al., The effects of eyestalk ablation on the reproductive and immune function of female Macrobrachium americanum, J. Aquacult. Res. Dev. 3 (2012). J.C. Sainz-Hernández, I.S. Racotta, S. Dumas, et al., Effect of unilateral and bilateral eyestalk ablation in Litopenaeus vannamei male and female on several metabolic and immunologic variables, Aquaculture 283 (2008) 188–193. V. Matozzo, C. Gallo, M. Monari, et al., Cellular and biochemical parameters in the crab Carcinus aestuarii after experimentally-induced stress: effects of bacterial injection, leg ablation and bacterial injection/leg ablation combination, J. Exp. Mar. Biol. Ecol. 398 (2011) 18–25. R. Zhang, J. Song, P. Li, et al., Cloning and characterization of heat shock protein 90 gene introns in the chinese mitten crab Eriocheir Sinensis, J. Nanjing Normal Univ. 36 (2013) 107–1935. X. Zhang, Y. Huang, X. Cai, et al., Molecular cloning and expression of 14-3-3ζ in Haliotis diversicolor under stresses, J. Fish. China 38 (2014) 492–502. H.T. Yang, M.C. Yang, J.J. Sun, et al., Dual oxidases participate in the regulation of intestinal microbiotic homeostasis in the kuruma shrimp Marsupenaeus japonicus, Dev. Comp. Immunol. 59 (2016) 153–163. E.H. Huang, M.J. Hynes, T. Zhang, et al., Aldehyde dehydrogenase 1 is a marker for normal and malignant human colonic stem cells (SC) and tracks SC overpopulation during colon tumorigenesis, Canc. Res. 69 (2017) 3382–3389. W.W. Li, X.K. Jin, H. Lin, et al., Molecular cloning, characterization, expression and activity analysis of cathepsin L in Chinese mitten crab, Eriocheir sinensis, Fish Shellfish Immunol. 29 (2010) 1010–1018. P. Jiravanichpaisal, B.L. Lee, K. Söderhäll, Cell-mediated immunity in arthropods: hematopoiesis, coagulation, melanization and opsonization, Immunobiology 211 (2006) 213–236. M. Qi, E.A. Elion, MAP kinase pathways, J. Cell Sci. 118 (2005) 3569–3572. P. Anzenbacher, E. Anzenbacherovã, Cytochromes P450 and metabolism of xenobiotics, Cell. Mol. Life Sci. 58 (2001) 737–747. P. Pandey, A. Saleh, A. Nakazawa, et al., Negative regulation of cytochrome cmediated oligomerization of Apaf-1 and activation of procaspase-9 by heat shock protein 90, EMBO J. 19 (2000) 4310–4322. J.Y. Song, J.H. Roe, The role and regulation of Trxl, a cytosolic thioredoxin in Schizosaccharomyces pombe, J. Microbiol. 46 (2008) 408–414. B.J. Haas, A. Papanicolaou, M. Yassour, et al., De novo transcript sequence reconstruction from RNA-Seq: reference generation and analysis with Trinity, Nat. Protoc. 8 (2013) 1494. M. Ashburner, C. Ball, Botstein D. Ja, et al., Gene ontology: tool for the unification of biology, The Gene Ontology Consortium, Nat. Genet. 25 (2000) 25–29. C. Camacho, G. Coulouris, V. Avagyan, et al., BLAST+: architecture and applications, BMC Bioinf. 10 (2009) 421. M.D. Robinson, D.J. McCarthy, G.K. Smyth, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data, Bioinformatics 26 (2010) 139–140. Y. Benjamini, D. Yekutieli, The control of the false discovery rate in multiple testing under dependency, Ann. Stat. 29 (2001) 1165–1188. H.Y.H. Luo, S.J. Xiao, S. Zheng, X. Wang, Z. Wang, Application of transciptomics technology to aquatic animal research, J. Fish. China 39 (2015) 598–607. Y. Zeng, L. Wei, Latest research progress on 14-3-3β, China Med. Herald. 13 (2016) 59–62. W. Dröge, Free radicals in the physiological control of cell function, Physiol. Rev. 82 (2002) 47–95. N. Vol, Antibacterial effects of hydrogen peroxide and methods for its detection and quantitation, J. Food Protect. 59 (1996) 1233–1241. V.P. Skulachev, Possible role of reactive oxygen species in antiviral defense, Biochem.Biokhimiia 63 (1998) 1438–1440. M. Inada, K. Kihara, T. Kono, et al., Deciphering of the Dual oxidase (Nox family) gene from kuruma shrimp, Marsupenaeus japonicus: full-length cDNA cloning and characterization, Fish Shellfish Immunol. 34 (2013) 471–485. E.M. Ha, C.T. Oh, Y.S. Bae, et al., A direct role for dual oxidase in Drosophila gut immunity, Science 310 (2005) 847–850. L. Thomas, S.M. Leto, Hurt Darrell, Ueyama Takehiko, Targeting and regulation of reactive oxygen species generation by nox family NADPH oxidases, Antioxidants Redox Signal. 11 (2009) 2607–2619. S. Morand, T. Ueyama, S. Tsujibe, et al., Duox maturation factors form cell surface complexes with Duox affecting the specificity of reactive oxygen species generation,

Fish and Shellfish Immunology 81 (2018) 266–275

C. Zhang et al.

[52] C. Guillemette, E. Lévesque, M. Harvey, et al., UGT genomic diversity: beyond gene duplication, Drug Metabol. Rev. 42 (2010) 24–44. [53] B.S. Polla, Heat shock proteins in host-parasite interactions, Immunol. Today 7 (1991) A38–A41. [54] K. Park, I.S. Kwak, Characterize and gene expression of heat shock protein 90 in marine crab Charybdis japonica following bisphenol a and 4-nonylphenol exposures, Environ. Health. Toxicol. 29 (2014) 1–7. [55] F. Li, W. Luan, C. Zhang, et al., Cloning of cytoplasmic heat shock protein 90 (FcHSP90) from Fenneropenaeus chinensis and its expression response to heat shock and hypoxia, Cell Stress & Chaperones 14 (2009) 161–172. [56] K. Park, I.S. Kwak, Characterization of heat shock protein 40 and 90 in Chironomus riparius larvae: effects of di(2-ethylhexyl) phthalate exposure on gene expressions and mouthpart deformities, Chemosphere 74 (2008) 89–95. [57] L. Yang, J. Zha, X. Zhang, et al., Alterations in mRNA expression of steroid receptors and heat shock proteins in the liver of rare minnow (Grobiocypris rarus) exposed to atrazine and p,p'-DDE, Aquat. Toxicol. 98 (2010) 381–387. [58] J.Y. Song, J. Cha, J. Lee, et al., Glutathione reductase and a mitochondrial thioredoxin play overlapping roles in maintaining iron-sulfur enzymes in fission yeast, Eukaryot. Cell 5 (2006) 1857–1865. [59] H. Nakamura, Y. Hoshino, H. Okuyama, et al., Thioredoxin 1 delivery as new therapeutics, Adv. Drug Deliv. Rev. 61 (2009) 303–309. [60] L. Liu, A.H. Warner, Further characterization of the cathepsin L-associated protein and its gene in two species of the brine shrimp, Artemia, Comp. Biochem. Physiol., A Mol. Integr. Physiol. 145 (2006) 458–467. [61] A. Dohchin, J.I. Suzuki, H. Seki, et al., Immunostained cathepsins B and L correlate with depth of invasion and different metastatic pathways in early stage gastric carcinoma, Cancer 89 (2000) 482–487. [62] Z.Y. Zhao, Z.X. Yin, S.P. Weng, et al., Profiling of differentially expressed genes in hepatopancreas of white spot syndrome virus-resistant shrimp (Litopenaeus vannamei) by suppression subtractive hybridisation, Fish Shellfish Immunol. 22 (2007) 520–534.

Faseb. J. 23 (2009) 1205–1218. [39] S. Kumar, A. Molina-Cruz, L. Gupta, et al., A peroxidase/dual oxidase system modulates midgut epithelial immunity in Anopheles gambiae, Science 327 (2010) 1644–1648. [40] H. Fu, R.R. Subramanian, S.C. Masters, 14-3-3 proteins: structure, function, and regulation, Annu. Rev. Pharmacol. Toxicol. 40 (2003) 617–647. [41] X. Liu, B. Yang, X. He, et al., Relationship of ALT levels and levels of glucose and lipid metabolism in diabetic patients, Guizhou. Med. J. 39 (2015) 1255–1257. [42] M. Nomura, S. Shimizu, T. Sugiyama, et al., 14-3-3 interacts directly with and negatively regulates pro-apoptotic Bax, J. Biol. Chem. 290 (2015) 2058–2065. [43] G.R. Fanger, C. Widmann, A.C. Porter, et al., 14-3-3 proteins interact with specific MEK kinases, J. Biol. Chem. 273 (1998) 3476–3483. [44] M. Magni, S. Shammah, R. Schiró, et al., Induction of cyclophosphamide-resistance by aldehyde-dehydrogenase gene transfer, Blood 87 (1996) 1097–1103. [45] N.A. Sophos, A. Pappa, T.L. Ziegler, et al., Aldehyde dehydrogenase gene superfamily: the 2000 update, Chem. Biol. Interact. 130–132 (2001) 323–337. [46] L.C. Hsu, Human aldehyde dehydrogenase gene family, FEBS J. 251 (2010) 549–557. [47] S.J. D, L. B, I.K. P, et al., Correction: colorectal cancer stem cells are enriched in xenogeneic tumors following chemotherapy, PLoS One 3 (2008) e2428. [48] A.H.P.D. David, T.P. Craft, L. Wirthlin, et al., Widespread nonhematopoietic tissue distribution by transplanted human progenitor cells with high aldehyde dehydrogenase activity, Stem Cell. 26 (2008) 611–620. [49] C. Ginestier, H.H. Min, E. Charafejauffret, et al., ALDH1 is a marker of normal and malignant human mammary stem cells and a predictor of poor clinical outcome, Cell Stem Cell. 1 (2007) 555–567. [50] R. Meech, J.O. Miners, B.C. Lewis, et al., The glycosidation of xenobiotics and endogenous compounds: versatility and redundancy in the UDP glycosyltransferase superfamily, Pharmacol. Therapeut. 134 (2012) 200–218. [51] C. Guillemette, Pharmacogenomics of human UDP-glucuronosyltransferase enzymes, Pharmacogenomics J. 3 (2003) 136–158.

275