Identification and characterization of a goose-type lysozyme from sewage snail Physa acuta

Identification and characterization of a goose-type lysozyme from sewage snail Physa acuta

Fish & Shellfish Immunology 39 (2014) 321e325 Contents lists available at ScienceDirect Fish & Shellfish Immunology journal homepage: www.elsevier.com...

2MB Sizes 12 Downloads 21 Views

Fish & Shellfish Immunology 39 (2014) 321e325

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Short communication

Identification and characterization of a goose-type lysozyme from sewage snail Physa acuta Yunhai Guo a, b, Hongxuan He c, * a

National Institute of Parasitic Diseases, Chinese Center for Disease Control and Prevention, Shanghai 200025, China Key Laboratory of Parasite and Vector Biology of the Chinese Ministry of Health, WHO Collaborating Centre for Malaria, Schistosomiasis and Filariasis, Shanghai 200025, China c Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 December 2010 Received in revised form 16 May 2014 Accepted 19 May 2014 Available online 29 May 2014

Freshwater snail Physa acuta has been considered as an important invasive species and medical mollusc. Field investigation has shown that this snail could survive better than other snails in polluted water bodies. To understand the immune mechanisms of P. acuta, suppression subtractive hybridization hepatopancreas cDNA library has been constructed with bacterial challenge. In this study, a full-length cDNA of a novel goose-type lysozyme (PALysG) has been identified from P. acuta by EST and RACE technique. The conservative structure domains share high homology with other molluscan g-type lysozymes including the SLT domain, the substrate binding sites, the catalytic residues, three alpha-helices structures and six molluscan specific cysteines. Meanwhile, PALysG is the first record of goose-type lysozyme in Gastropoda. Real-time PCR indicated that PALysG mRNA had been expressed significantly at high levels in hepatopancreas for 8e48 h. PALysG recombinant protein displayed the lytic activity of gtype lysozyme with other organisms against Micrococcus lysodikicus. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Freshwater snail Physa acuta Goose-type lysozyme Real-time PCR Antimicrobial activities

1. Introduction The freshwater snail Physa acuta (Mollusca, Gastropoda) which is known for having been introduced to more than 70 countries in the world [1,2], has evolved the unique ability to survive in aquatic habitats with extreme microbial stress such as drains, sewage pools, and seriously polluted water bodies [3,4]. It also can be an excellent model organism for aquatic toxicity testing [5]. This species maybe play a suitable model organism for investigations of the immune mechanisms against microbial stress of invasive alien species. Innate immune system is of great importance to protect invertebrates against a wide range of microbial pathogens. Lysozyme is an important antibacterial protein based on hydrolytic activity to cleave the b-1, 4-glycosidic bond between N-acetyl-D-glucosamine and N-acetylmuramic acid in the peptidoglycan layer. Six different types of lysozymes are found including chicken-type lysozyme (ctype), goose-type lysozyme (g-type), and invertebrate-type lysozyme (i-type), plant-lysozyme, bacterial-lysozyme and phage-

* Corresponding author. Tel./fax: þ86 10 64807118. E-mail address: [email protected] (H. He). http://dx.doi.org/10.1016/j.fsi.2014.05.029 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

lysozyme [6]. Two different types of lysozymes are found in mollusc including g-type [7,8] and i-type [9]. In this study, we screen cDNA library of P. acuta that are induced upon immune challenge. Suppression subtractive hybridization (SSH) library has been constructed to selectively amplify and identify cDNAs that were differentially expressed in response to injected crude bacterial endotoxin (LPS). An expression sequence tag (EST) similar to g-type lysozymes has been identified that shows high similarity with other g-type lysozymes of mollusc and the full-length cDNA was obtained by RACE-PCR. Temporal expression pattern of this lysozyme in hepatopancreas was analyzed by Real-time quantitative PCR (RT-PCR). Antimicrobial activities assay of recombinant expression protein was performed by the radial diffusion method.

2. Materials and methods 2.1. Animal collection and maintenance Adult P. acuta were collected from Xiaoyue River, Chaoyang district, Beijing (40.0221 N, 116.2138 E) and immediately transported to the key laboratory of animal ecology and conservation

322

Y. Guo, H. He / Fish & Shellfish Immunology 39 (2014) 321e325

biology, Institute of Zoology, Chinese Academy of Sciences. Snails were placed in holding tanks with recirculating freshwater maintained at room temperature until spawning. The offspring were transferred to other holding tanks until mature. Snails were fed approximately 1 g mixed fish food per 10 adult snails every second day. Food was withheld 24 h prior to experimentation. 2.2. Immune challenge of snail and collection of hepatopancreas Fifty adult offspring snails, weighing between 140 and 190 mg, were used for immune challenge. 5 ml PBS sample volume, corresponding to 10 mg ml1 LPS (purified Escherichia coli endotoxin, Sigma, USA) per adult snail were injected into the foot using 1 ml disposable syringes. Meanwhile, another group snails injected with 5 ml PBS were used as control and maintained without bacterium challenge. Hepatopancreas from immune challenged, saline challenged snail was taken at 5 time periods, starting at 2, 4, 6, 8 and 24 h after injection. Snail was frozen in liquid nitrogen and immediately taken hepatopancreas to store at 80  C. 2.3. Construction of cDNA libraries by SSH Total RNA of P. acuta challenged with LPS and controls were extracted, respectively, by use of TRIzol Reagent (Invitrogene) following the manufacturer's protocol. The pooled RNA used for SSH was prepared by mixing equal quantity of all RNA samples together. From the total RNA, 2 mg mRNA was purified using poly (A) Tract mRNA Isolation Systems (Promega), and utilized as template, the first strand cDNA was generated using the SMART PCR cDNA Synthesis Kit (Clontech) according to the manufacturer's protocol. The double strand cDNA was obtained by long distanced PCR with related primers. The cDNA libraries were constructed by SSH using the PCR-Select cDNA Subtraction Kit (Clontech) as described by the manufacturer. The challenged group cDNA was used for tester and the control group was used for driver. 2.4. cDNA cloning of lysozyme in P. acuta By Blastx in the DNA database of NCBI, sequence comparison revealed that an EST from the SSH library of P. acuta had a high homology with lysozyme from the Zhikong scallop, Chlamys farreri (AY987008), and the Bay scallop, Argopecten irradians (AY437875). To obtain complete sequence from the EST, rapid amplification cDNA ends (RACE) technique was utilize to amplify 50 and 30 ends sequences using SMART™ RACE cDNA Amplification Kit (Clontech) and gene specific primers (Table 1). 2.5. Sequence analysis The deduced amino acid sequence from the identified cDNA sequence was called PALysG. The sequence analysis and protein domain features were performed by the Expert Protein Analysis

System (http://www.ncbi.nlm.nih.gov/blast) and Simple Modular Architecture Research Tool [10], separately. Sequence alignments were computed using the ClustalX software [11]. Phylogenetic tree was reconstructed using neighbor-joining method [12] by the software MEGA [13]. The relative supports of branches were tested by bootstrap analysis with 1000 replicates. Trees were showed with the software TREEVIEW. Sequences of g-type lysozymes included Homo sapiens (NP_783862.2), Azumapecten farreri (AGA95494.1), Haliotis discus discus (AGQ50335.1, AGQ50337.1), A. irradians (AAX09979.1), Mizuhopecten yessoensis (AEY77130.1), C. farreri (ABB53641.1), Branchiostoma floridae (XP_002611412.1), Trichoplax adhaerens (XP_002107677.1), Danio rerio (NP_001002706.1), Gallus gallus (NP_001001470.1), Xenopus (Silurana) tropicalis (NP_001015739.1), Ciona intestinalis (XP_002126087.1), Oikopleura dioica (CAD92344.1, CAD92342.1), and Crassostrea gigas (BAH66799.1). 2.6. Temporal expression patterns of PALysG mRNA in hepatopancreas DNase-treated total RNAs were isolated from each treated individual which infected or controlled at 0, 2, 4, 8, 12, 24, 48 h by using RNA pureR total RNA extraction kit (Bioteke) according to the manufacturer's instrument. For Real-time PCR analysis, cDNAs were transcribed from RNAs treated with DNase by using an Omniscript reverse transcriptase kit (Qiagen). RT-PCR specific primers and bactin gene primers (Table 1) were designed using the software Oligo 6, respectively. Triplicate experiments were performed for all reactions. 2.7. Recombinant expression and purification of PALysG The P. acuta lysozyme gene was amplified with specific expression primers and cloned into Bac-to-Bac® Baculovirus expression system (Invitrogen) expression vector. For construction expression vector, EcoRI site and Xho I site were added to the PALysG gene recombinant expression primers, separately (Table 1). The purified PCR product were cloned into pFastBacHTa vector and sequenced to ensure in-frame insertion. pFastBacHTa/ PALysG was transformed to E. coli DH10Bac. The cells were then spread on LB plates containing antibiotics (50 mg/ml kanamycin, 7 mg/ml gentamicin, and 10 mg/ml tetracycline), 100 mg/ml X-gal and the inducer, 40 mg/ml IPTG. The recombinant bacmid baculoviruses was extracted from the amplified E. coli DH10Bac, and then transfected into logarithmic growth phase Sf9 cell (preserved in our laboratory). Grace's insect cell culture medium (Invitrogen) was utilized at 27  C in laboratory. Recombinant protein contained 6 His tag at N-terminal according to pFastBacHTa vector design. Ni-NTA spin columns were utilized to purify the protein. The results were identified on 12% slab SDSPAGE. 2.8. Antimicrobial activities of PALysG

Table 1 Oligonucleotide primers used in the present study. Primer RaR1 RaF2 RTF1 RTR1 RTbF1 RTbR1 ExF1 ExR1

Procedure 0

5 RACE reverse 30 RACE forward Real-time PCR forward Real-time PCR reverse b-Actin primer forward b-Actin primer reverse Recombinant primer forward Recombinant primer reverse

Sequence (50 e30 ) GGGCCTTGACCTGGTTAATGTATGG CGGCTCTCTGCTTGTTTCTACTGG ACGTCGCTAACTCTGGACTGCC CTGACGCCGAAGTTGTAG ACCTTCAACACACCAGCTATGT ACCAGCCAAATCCAATCTC CCGGAATTCATGTATCTAGTTG CCCTCGAGCGCTTAGTTCCAG

Based on Minagawa et al. [14], PALysG antimicrobial activity assay were performed using hen egg white lysozyme (HEWL) as reference by the radial diffusion method. Three bacterial strains Micrococcus lysodikicus, Staphylococcus aureus MRSA and E. coli DH5a were used as substrates. The 200 ml bacteria were spread into the freshly poured 90 mm plates after the concentration was adjusted to 0.1 absorbance unit at 600 nm. Fifty mg purified protein was dropped into individual 5 mm diameter well. Radial diffusion assays were performed after 48 h incubation at 25  C according to the radius of the clearing zone.

Y. Guo, H. He / Fish & Shellfish Immunology 39 (2014) 321e325

3. Results 3.1. Characterization of PALysG gene Seven hundred and sixty-nine significant ESTs were sequenced from SSH library of P. acuta. A 233 bp EST was highly similar to other identified g-type lysozymes in invertebrate and vertebrate species by BLASTx analysis. Based on PA100245 sequence, 50 -end and 30 -end nucleotide sequences were determined separately using RACE technique. The full-length cDNA sequence of PALysG (GenBank accession no. HQ435321) was obtained by sequences splicing. As shown in Fig.1, PALysG cDNA 50 -end contained a 31 bp untranslated region, and 30 -end had a canonical polyadenylation signal sequence TATAAA and a poly A tail. A 597 bp open reading frame (ORF) encoded a 198 amino acids polypeptide. The predicted molecular weight and theoretical isoelectric point was 21.2 kDa and 6.38, respectively. The presumed amino acids sequence included a 15 amino acids signal peptide, a transglycosylase SLT domain (Bacterial lytic transglycosylases Domain) which contained special hydrolytic activity sites. BLASTx results indicated that PALysG shared high similarity with other molluscan g-type lysozyme proteins, such as A. irradians (AAX09979, 60% identity, E ¼ 1e-63), C. farreri (ABB53641, 58% identity, E ¼ 8e-60), C. gigas (BAH66799, 48% identity, E ¼ 1e-42). Fig. 2 showed the conserved amino acids sites, such as the substrate binding sites (+; Ile 101, Ile 124, Gly 155, Gly 175) [7] and the catalytic residues (:; Glu 79, Asp 94, Asp 105) [7,8,15], and three predicted alpha-helices structures of g-type lysozymes by multiple alignment [8,16]. Especially, PALysG shared the same six cysteine residues (D; Cys20, Cys57, Cys66, Cys104, Cys113, Cys121) with other mollusc [7,17]. Based on above descriptions, it apparently showed that PALysG should be a new g-type lysozyme. Using 16 sequences of multiple alignments to construct phylogenetic tree, the result (Fig. 3) indicated that PALysG (ADV36303.1) was first clustered with other six molluscan g-type lysozymes. Other eight chordate animals g-type lysozyme constructed another major branch. 3.2. RT-PCR analysis To understand the transcript levels of the PALysG lysozyme mRNA, hepatopancreas were used in different time after LPS

323

challenge. The quantitative real-time PCR analysis results (Fig. 4) indicated PALysG mRNA was expressed significantly in 8 h, and arrived the highest level in 12 h after challenge. 3.3. Recombinant expression and antimicrobial activities of PALysG The target protein molecular mass was 21 kDa which was consistent with the expected molecular mass by software. The antimicrobial activity of purified product was evaluated the antimicrobial activities by radial diffusion assay. As shown in Fig. 5, recombinant expression protein was inhibited significantly M. lysodikicus multiplication according to the radius of the antimicrobial zone. Meanwhile, the antimicrobial capability of this protein was relatively stronger on E. coli DH5a than hen egg white lysozyme, but shared same effect on S. aureus MRSA. 4. Discussion As an invasive species, P. acuta has been studied on distribution diffusion, migration and parasite host [1,4,18e21]. However, our study focus on the another phenomenon that P. acuta could survive better in polluted water environment than other snails. A better understanding the immune mechanisms of P. acuta might be lead to important advances in the innate immune system of invertebrate. In this study, we have constructed a suppression subtractive hybridization (SSH) library of P. acuta to selectively amplify and identify hepatopancreas cDNAs under immune challenge. A g-type lysozyme EST has identified by BLASTx and the full-length cDNA has amplified out by RACE techniques. The putative amino acid sequence (designated PALysG) shares the same SLT domain, the substrate binding sites, the catalytic residues and the three alphahelices structures with other invertebrate and vertebrate g-type lysozyme [7,8,15]. Specially, same six cysteines with other molluscan g-type lysozyme also appear in PALysG which possibly constitute disulphide bridge to result in a compact structure [7,17]. It should further support that the six cysteines are mollusc-specific [7]. Many of g-type lysozymes have been identified from birds and fishes [15,22e28]. The g-type lysozyme has been found in invertebrate during the recent years. Until now, several g-type lysozymes have been discovered from molluscan Pelecypoda, such as

Fig. 1. Complete cDNA sequence and deduced amino acid sequence. Three boxes show the initiation codon, the termination codon and poly A signal sequence (TATAAA). The solid line indicates the putative signal peptide. The dot line indicates the SLT domain in the C-terminus.

324

Y. Guo, H. He / Fish & Shellfish Immunology 39 (2014) 321e325

Fig. 2. Multiple amino acid sequence alignment of PALysG with other g-type lysozymes from various animals. Catalytic residues and the substrate binding sites of g-type lysozymes are marked with black pentagon (+) and black triangle (:), respectively [7]. White triangles (▵) show the six cysteine residues [7,8,15]. Three boxes indicate three predicted alphahelices structures [8,16]. Sequences used for the analysis are g-type lysozymes of Homo sapiens (NP_783862), Xenopus (Silurana) tropicalis (NP_001015739), Gallus gallus (NP_001001470), Danio rerio (NP_001002706), Branchiostoma floridae (XP_002611412), Ciona intestinalis (XP_002126087), Crassostrea gigas (BAH66799), Chlamys farreri (ABB53641), Argopecten irradians (AAX09979) and Trichoplax adhaerens (XP_002107677).

C. gigas, C. farreri and A. irradians [7,8,17]. In this study, we have first identified a g-type lysozyme PALysG from Gastropoda. It demonstrates that this lysozyme is possibly existed extensively in molluscs. This molecular evolutionary relationship revealed the agreement with the concept of traditional taxonomy. In this

Fig. 3. Phylogenetic analysis of PALysG with other g-type lysozymes from various organism. Homo sapiens (NP_783862.2), Azumapecten farreri (AGA95494.1), Haliotis discus discus (AGQ50335.1, AGQ50337.1), A. irradians (AAX09979.1), Mizuhopecten yessoensis (AEY77130.1), C. farreri (ABB53641.1), Branchiostoma floridae (XP_002611412.1), Trichoplax adhaerens (XP_002107677.1), Danio rerio (NP_001002706.1), Gallus gallus (NP_001001470.1), Xenopus (Silurana) tropicalis (NP_001015739.1), Ciona intestinalis (XP_002126087.1), Oikopleura dioica (CAD92344.1, CAD92342.1).

molecular phylogenetic analysis, the mollusca g-type lysozyme of C. gigas was excluded. According to Itoh and Takahash [8], the gtype lysozyme gene of C. gigas also contains peptidoglycan recognition protein (PGRP) sequence, and maybe possess simultaneously the function of bacterio-lytic and peptidoglycan recognition. The unique structure increase the likelihood of molecular evolution changing, also affect the molecular phylogenetic analysis.

Fig. 4. RT-PCR analysis of mRNA expression levels of PaLysG in hepatopancreas at different times after LPS challenge. Vertical bars were shown as means ± S.E.,n ¼ 3.

Y. Guo, H. He / Fish & Shellfish Immunology 39 (2014) 321e325

Fig. 5. Cylinder-plate method analysis antimicrobial activities of PALysG. 1, Micrococcus lysodikicus; 2, Staphylococcus aureus MRSA; 3, E. coli DH5a; HEWL, hen egg white lysozyme. Vertical bars were shown as means ± S.E.,n ¼ 3.

The g-type lysozyme has been found in different molluscan tissues, such as gills, hepatopancreas, gonad, hemocytes, mantle, heart, intestine, etc. [7,8,17]. Previous studies have also suggested that g-type lysozyme had predominantly expressed in hepatopancreas of C. farreri [7]. In this study, we have succeeded to get gtype lysozyme PALysG from P. acuta hepatopancreas, and the expression pattern has been investigated in hepatopancreas with bacterial challenge in different time. The result has shown that PALysG mRNA had been expressed significantly at high levels in hepatopancreas for 8e48 h. It is a clear sign that PALysG has participated in internal defenses of microbial infection. To understand the immune mechanism of P. acuta in polluted water environment, the recombinant expression of PALysG has been performed in baculovirus expression system to perform activity assay. The recombinant protein PALysG possessed the same lytic activity of g-type lysozyme with other organisms against M. lysodikicus. PALysG was similar to display without inhibiting capacity against S. aureus with C. farreri g-type lysozyme CFLysG [7]. Meanwhile, our radial diffusion assay indicated that PALysG had exhibited a weak defensive activity toward E. coli, which was consistent with grass carp Ctenopharyngodon idellus g-type lysozyme [29]. Although g-type lysozyme has been identified from sewage snail P. acuta, the detailed knowledge need further researches, whether PALysG antimicrobial activity is stronger than other g-type lysozyme. Acknowledgments This work was funded by grants from CAS Innovation Program (KSCX2-YW-N-063), National Key Basic Research and Development Program of China (9732007BC109103), USDA (0760621234), and the National Natural Science Funds (31040072). References [1] Paraense WL, Pointier JP. Physa acuta Draparnaud, 1805 (Gastropoda: Physidae): a study of topotypic specimens. Mem Inst Oswaldo Cruz 2003;98(4): 513e7.

325

[2] Dillon RT, Robinson JD, Smith TP, Wethington AR. No reproductive isolation between freshwater pulmonate snails Physa virgata and P-acuta. Southwest Nat 2005;50(4):415e22. [3] Aditya G, Raut SK. Predation potential of the water bugs Sphaerodema rusticum on the sewage snails Physa acuta. Mem Inst Oswaldo Cruz 2002;97(4):531e4. [4] De Kock KN, Wolmarans CT. Distribution and habitats of the alien invader freshwater snail Physa acuta in South Africa. Water SA 2007;33(5):717e22. [5] Woodard VH. Feasibility for utilization of a freshwater pulmonate snail, Physa acuta, as a model organism for environmental toxicity testing, with special reference to cadmium ion toxicity. Arlington: University of Texas; 2005 [Ph.D. thesis]. [6] Joskova R, Silerova M, Prochazkova P, Bilej M. Identification and cloning of an invertebrate-type lysozyme from Eisenia andrei. Dev Comp Immunol 2009;33(8):932e8. [7] Zhao J, Song L, Li C, Zou H, Ni D, Wang W, et al. Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein. Mol Immunol 2007;44(6):1198e208. [8] Itoh N, Takahashi KG. A novel peptidoglycan recognition protein containing a goose-type lysozyme domain from the Pacific oyster, Crassostrea gigas. Mol Immunol 2009;46(8e9):1768e74. [9] Xue QG, Schey KL, Volety AK, Chu FLE, La Peyre JF. Purification and characterization of lysozyme from plasma of the eastern oyster (Crassostrea virginica). Comp Biochem Physiol B e Biochem Mol Biol 2004;139(1):11e25. [10] Schultz J, Milpetz F, Bork P, Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 1998;95(11):5857e64. [11] Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The CLUSTAL_ X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 1997;25(24):4876e82. [12] Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol 1987;4(4):406e25. [13] Kumar S, Tamura K, Jakobsen IB, Nei M. MEGA2: molecular evolutionary genetics analysis software. Bioinformatics 2001;17(12):1244e5. [14] Minagawa S, Hikima J, Hirono I, Aoki T, Mori H. Expression of Japanese flounder c-type lysozyme cDNA in insect cells. Dev Comp Immunol 2001;25(5e6):439e45. [15] Hikima J, Minagawa S, Hirono I, Aoki T. Molecular cloning, expression and evolution of the Japanese flounder goose-type lysozyme gene, and the lytic activity of its recombinant protein. Biochim Biophys Acta 2001;1520(1): 35e44. [16] Pooart J, Torikata T, Araki T. Enzymatic properties of rhea lysozyme. Biosci Biotechnol Biochem 2005;69(1):103e12. [17] Zou H, Song L, Xu W, Yang G. Molecular cloning and characterization analysis of cDNA encoding g-type lysozyme from scallop (Argopecten irradians). High Technol Lett; 2005:15101e6. [18] Bousset L, Henry PY, Sourrouille P, Jarne P. Population biology of the invasive freshwater snail Physa acuta approached through genetic markers, ecological characterization and demography. Mol Ecol 2004;13(7):2023e36. [19] Thiengo SC, Mattos AC, Santos SB, Fernandez MA. Freshwater snails and Schistosomiasis mansoni in the state of Rio de Janeiro, Brazil: VIeNoroeste Fluminense Mesoregion. Mem Inst Oswaldo Cruz 2006;101(Suppl.):1239e45. [20] Henry PY, Bousset L, Sourrouille P, Jarne P. Partial selfing, ecological disturbance and reproductive assurance in an invasive freshwater snail. Heredity 2005;95(6):428e36. [21] Sebastian Escobar J, Epinat G, Sarda V, David P. No correlation between inbreeding depression and delayed selfing in the freshwater snail Physa acuta. Evolution 2007;61(11):2655e70. [22] Canfield RE, McMurry S. Purification and characterization of a lysozyme from goose egg white. Biochem Biophys Res Commun 1967;26(1):38e42. [23] Thammasirirak S, Torikata T, Takami K, Murata K, Araki T. Purification and characterization of goose type lysozyme from cassowary (Casuarius casuarius) egg white. Biosci Biotechnol Biochem 2001;65(3):584e92. [24] Nakano T, Graf T. Goose-type lysozyme gene of the chicken: sequence, genomic organization and expression reveals major differences to chickentype lysozyme gene. Biochim Biophys Acta 1991;1090(2):273e6. [25] Larsen AN, Solstad T, Svineng G, Seppola M, Jorgensen TO. Molecular characterisation of a goose-type lysozyme gene in Atlantic cod (Gadus morhua L.). Fish Shellfish Immunol 2009;26(1):122e32. [26] Yin ZX, He JG, Deng WX, Chan SM. Molecular cloning, expression of orangespotted grouper goose-type lysozyme cDNA, and lytic activity of its recombinant protein. Dis Aquat Org 2003;55(2):117e23. [27] Schoentgen F, Jolles J, Jolles P. Complete amino acid sequence of ostrich (Struthio camelus) egg-white lysozyme, a goose-type lysozyme. Eur J Biochem 1982;123(3):489e97. [28] Simpson RJ, Begg GS, Dorow DS, Morgan FJ. Complete amino acid sequence of the goose-type lysozyme from the egg white of the black swan. Biochemistry 1980;19(9):1814e9. [29] Ye X, Zhang L, Tian Y, Tan A, Bai J, Li S. Identification and expression analysis of the g-type and c-type lysozymes in grass carp Ctenopharyngodon idellus. Dev Comp Immunol;34(5):501e9.