Identification of biogenic amines-producing lactic acid bacteria isolated from spontaneous malolactic fermentation of chilean red wines

Identification of biogenic amines-producing lactic acid bacteria isolated from spontaneous malolactic fermentation of chilean red wines

LWT - Food Science and Technology 68 (2016) 183e189 Contents lists available at ScienceDirect LWT - Food Science and Technology journal homepage: ww...

622KB Sizes 0 Downloads 72 Views

LWT - Food Science and Technology 68 (2016) 183e189

Contents lists available at ScienceDirect

LWT - Food Science and Technology journal homepage: www.elsevier.com/locate/lwt

Identification of biogenic amines-producing lactic acid bacteria isolated from spontaneous malolactic fermentation of chilean red wines n b, Apolinaria Garcia c, Martha B. Hengst d, Karem Henríquez-Aedo a, Daniel Dura a, * Mario Aranda a

Department of Food Science and Technology, University of Concepcion, Chile Department of Clinical Biochemistry, University of Concepcion, Chile Department of Microbiology, University of Concepcion, Chile d Department of Pharmaceutical Sciences, Catholic University of the North, Chile b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 May 2015 Received in revised form 23 November 2015 Accepted 1 December 2015 Available online 9 December 2015

Most Chilean wineries perform malolactic fermentation by means of non-typified autochthonous lactic acid bacteria already present in grapes and oak barrels or fermenters. The objective of this research was to investigate the principal lactic acid bacteria present during spontaneous malolactic fermentation of Chilean Cabernet Sauvignon wines and to study its role in BA formation. To the best of our knowledge this is the first time that this relation has been reported for Chilean wines. Lactic acid bacteria were isolated from five wineries located in three Chilean geographical regions. Genotypic differentiation of each bacterial isolated was performed via a restriction fragment length polymorphism method using rpoB and 16S rRNA genes and HinfI, AciI and MseI enzymes. Sixty-five colonies were isolated and identified as lactic acid bacteria, identifying two species, Lactobacillus rhamnosus and Oenococcus oeni. The predominant species was L. rhamnosus, which, to the best of our knowledge, we are describing for the first time in the vinification process. Considering that L. rhamnosus was detected in wineries from different geographical viticultural regions, it could be preliminarily considered as an endemic species. Both species were biogenic amines producers, L. rhamnosus being mainly responsible for biogenic amines present in the Cabernet Sauvignon wines studied. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Lactic acid bacteria RFLP Cabernet sauvignon Wine Biogenic amines

1. Introduction Winemaking or vinification is an ancient and traditional technological process that involves an almost perfect combination of biochemical and microbiological reactions. This process typically requires two fermentation stages: i) alcoholic fermentation (AF) performed by yeasts and ii) malolactic fermentation (MLF) conducted by lactic acid bacteria (LAB) mainly Oenococcus oeni species. This last step has been considered relevant and non-avoidable for red wines, because produces a decrease in total wine acidity, enhances organoleptic properties and improves microbiological stability (Capozzi et al., 2010; Lonvaud-Funel, 1995; Versari,

* Corresponding author. Laboratory of Advanced Research on Foods and Drugs, Department of Food Science and Technology, Faculty of Pharmacy, University of Concepcion, Barrio Universitario s/n Concepcion, Chile. E-mail addresses: [email protected], [email protected] (M. Aranda). http://dx.doi.org/10.1016/j.lwt.2015.12.003 0023-6438/© 2015 Elsevier Ltd. All rights reserved.

Parpinello, & Cattaneo, 1999). LAB are naturally present in grapes, musts and wines, the predominant genera are Leuconostoc, Pediococcus, Lactobacillus and Oenococcus (Lonvaud-Funel, 1995; Versari et al., 1999). During MLF the most observed species is ~ oz, 2012) which is capable Oenococcus oeni (Garcia-Moruno & Mun of proliferating in the harsh wine environment, i.e. low pH (ca. 3.5), high alcohol content (14% v/v), high concentration of SO2 (50e80 mg L1) and low temperature (18-20  C) (Versari et al., 1999). During MLF, besides the beneficial conversion of L-malic to L-lactic acid mainly via malate decarboxylase (malolactic enzyme), other compounds like biogenic amines (BA) are formed. These kinds of compounds, produced by free amino acids decarboxylation (Gerbaux, Villa, Monamy, & Bertrand, 1997; Lonvaud-Funel, 2001), can negatively affect the wine quality and its presence might be considered a possible health risks for some consumers (AncinAzpilicueta, Gonzalez-Marco, & Jimenez-Moreno, 2008; Anli & Bayram, 2009). Our research group evaluated the BA content in

184

K. Henríquez-Aedo et al. / LWT - Food Science and Technology 68 (2016) 183e189

Chilean red wines finding higher concentrations than in foreign wines (Henríquez-Aedo, Vega, Prieto-Rodríguez, & Aranda, 2012; Pineda, Carrasco, Pena-Farfal, Henriquez-Aedo, & Aranda, 2012). In Chile most wineries perform MLF by means of non-typified autochthonous lactic acid bacteria already present in grapes, oak barrels or fermenters, thus, for Chilean wineries, the identification of autochthonous lactic acid bacteria is important in order to determine which kinds of bacteria are present and responsible for MLF and to establish their relation with BA formation. The objective of this research was to isolate, characterize and identify autochthonous lactic acid bacteria present during spontaneous MLF of Cabernet Sauvignon wines and to study their role in biogenic amines formation. To the best of our knowledge this is the first time that this relation has been reported for Chilean wines.

~ iga, Pardo, & Ferrer, 1993). All media were pretomato juice (Zún pared with ultra-pure water (18 MU cm), autoclaved and stored refrigerated at 4  C. The pH (4.8e5.3) was adjusted with 1 N HCl. To avoid yeast proliferation 100 mg L1 of filtered (0.22 mm) pimaricin solution (VGP Pharmachem, Vic, Spain) was added after the autoclave process (Sanchez et al., 2010). Serial dilutions were plated onto the MRS, ATB and LABW media and incubated for 24e48 h at 37  C under microaerophilic conditions (7% CO2). MLO plates were anaerobically incubated (BD Gaspak EZ from Sparks, Marylans, USA) for 5e7 days at 30  C. After count (CFU mL1), colonies from different plates were randomly selected and transferred to the original broth. Each colony was transferred at least three successive times to obtain pure cultures. Each isolate was stored at 80  C in the original medium supplemented with glycerol (20% v/v).

2. Materials and methods 2.3. Microbiological characterization of lactic acid bacteria isolated from MLF

2.1. Samples All MLF samples were collected in 2011 from five wineries (A-E) located in three Chilean valleys: Limari (30 340 29.100 S and 71 24.450 45.400 W), Curico (35 050 54.500 S and 71 180 37.00 W) and Itata (36 460 4.80 S and 72 130 00.50 W). All the wineries selected carry out spontaneous MFL without commercial starter. The winemaking process was initiated with grapes harvested in March, followed by the traditional vinification practices of each winery. As a general rule, AF using freeze-dried yeast was performed in plastics bins (wineries A and B) or stainless steel tanks (wineries C, D and E) at 22-25  C. Spontaneous MLF was carried out immediately after AF in oak barrels (wineries A, B, D and E) or stainless steel tanks (winery C) at 18-22  C for 30e40 days. Sampling was randomly done in the cellar, 100 mL of different barrels (or tanks) were pooled to obtain 750 mL of composed sample. Chemical parameters such as pH and alcohol content were determined before microbiological assays. Samples were stored at 4  C until be processed. 2.2. Bacterial isolation and culture media Bacterial isolation was carried out using four different media (Table 1): Man Rogosa & Sharpe (MRS) (De Man, Rogosa, & Sharpe, 1960) from Difco (Le Pont de Claix, France); Acid Tomato Broth (ATB) using grape juice instead tomato juice (Garvie, 1967); Lactic Acid Bacteria from Wine (LABW) (Weiler & Radler, 1970) and Medium for Leuconosctoc oenos (MLO), supplemented with 10% v/v of

Table 1 Culture media composition for lactic acid bacteria isolation from MLF samples. Componenta

MRS

ATB

LABW

MLO

Casein trypsin digest Gelatin pancreatic digest Yeast extract Glucose Fructose MgSO4.7H2O MnSO4.4H2O Grape juice Tomato juice (NH4)2 citrate NaCH3COO$3H20 Tween 80 FeSO4$7H20 KH2PO4 pH

10.0 10.0 5.0 20.0 e 0.1 0.05 e e 2.0 5.0 1.0 e 2.0 5.0

10.0 e 5.0 10.0 e 0.2 0.05 25b e e e e e e 4.8

e 5.0 5.0 10.0 e 0.5 0.2 e e 2.0 5.0 1.0 0.05 5.0 5.3

10.0 e 5.0 10.0 5.0 0.2 0.05 e 100.0b 3.5 e 1.0 e e 4.8

a b

g L1. mL.

Isolated colonies were phenotypically characterized including macroscopic and microscopic analysis, i.e. shape, color, border, surface, aspect, elevation, light and consistency. A gram test was assayed observing a positive reaction for lactic acid bacteria and a negative reaction for acetic acid bacteria. A catalase test was performed with 3% (v/v) of hydrogen peroxide (Wu, Ma, Zhang, & Chen, 2012) and a negative reaction was observed in the presence of lactic acid bacteria.

2.4. Molecular characterization of lactic acid bacteria: 16S rRNA and rpoB genes Cells from bacterial cultures were collected by centrifugation at 15183  g for 5 min. The pellet generated was subjected to DNA extraction using Power Soil DNA isolation kit (Mo Bio Laboratories Inc, Solana Beach, CA, USA) adhering to the manufacturer's protocol but using double incubation time (10 min) for DNA extraction. DNA purity and concentration were determined spectrophotometrically €nnedorf, Switzerland) Multimode Reader Infinite using a Tecan (Ma M200 Pro NanoQuant. The extracted DNA was amplified using the primers: WLAB1 (50 -TCCGGATTTATTGGGCGTAAAGCGA-30 ) and WLAB2 (5-TCGAATTAAACCACATGCTCCA-3) (Lopez et al., 2003), that amplifies the region V4 and V5 of the 16S rRNA subunit generating a product of ca. 400 bp. For RNA polymerase b subunit (rpoB) the following primers were used: rpoB1 (50 ATTGACCACTTGGGTAACCGTCG 30 ) and rpoB2 (50 ACGATCACGGGTCAAACCACC 30 ) obtaining an amplification product of ca. 306 bp (Claisse, Renouf, & Lonvaud-Funel, 2007; Renouf, Claisse, & LonvaudFunel, 2006). Each amplification reaction solution was prepared by mixing 12.5 mL of Takara kit (Bio inc, Shiga, Japan), 0.4 mM of primers and 20 ng of DNA template. The amplification was performed using a Veriti 96-wall gradient thermocycler from Applied Biosystem (Foster, CA, USA) utilizing the following program: 2 min at 95  C for initial denaturation, 30 cycles of: 30 s at 95  C for denaturation, 30 s at 55  C for rpoB annealing and 30 s at 60  C for WLAB annealing, and 1 min at 72  C for extension. Afterwards a final extension step was carried out for 2 min at 72  C. PCR products were separated by gel electrophoresis on 2% w/v agarose gel, prepared with 1X TAE (Tris acetate-EDTA, pH 8) buffer, in a MS Mini-7 horizontal chamber (Cleaver Scientific, Warwickshire, UK) applying 100V. PCR amplification patterns were visualized under a UV light using SafeView Nucleic Acid Stain (NBS Biologicals, Richmond, Canada) and 100 bp ladder (Thermo Scientific, Vilnius, Lithuania) as a DNA molecular weight marker.

K. Henríquez-Aedo et al. / LWT - Food Science and Technology 68 (2016) 183e189

2.5. Bacterial differentiation by RFLP Each bacterial colony was subjected to DNA extraction and PCR procedures as described in section 2.4. The presence of PCR products, i.e. amplicons of ca. 306 and 400 bp obtained with rpoB and WLAB primers respectively, were first confirmed by gel electrophoresis and then were independently digested directly from PCR tubes each with Thermo Scientific restriction enzymes, i.e. HinfI, AciI and MseI, following the protocol described by Claisse et al. (Claisse et al., 2007) with slight modifications. Briefly, 10 uL of PCR products were mixed with 0.5 mL of enzyme and 2 mL of 10X FastDigest Green Buffer (Thermo Scientific), then the reaction mixture was subjected to enzymatic digestion for 3 h at 37  C inside the thermocycler block. The resulting DNA fragments (patterns) were separated by gel electrophoresis on 12% v/v polyacrylamide gel in a omniPAGE mini vertical chamber (Cleaver Scientific, Warmickshire, UK) applying 80 V. RFLP patterns were visualized under UV light using 0.5 mg mL1 of ethidium bromide with 20 bp ladder (Thermo Scientific) as a DNA molecular weight marker.

185

fluorescence using 330 nm and 520 nm as excitation and emission wavelengths, respectively (Supplementary data, table and Fig. S1).

2.9. Statistical analysis Data was evaluated using descriptive statistics. Calibration was established using a linear regression model correlating BA concentration with fluorescence emission units (EU). Correlations were evaluated by means of the Pearson correlation test. Analysis of the biogenic amines produced by different bacterial isolated was completed using a one-way analysis of variance (ANOVA), Bartlett's test for equal variances and Bonferroni's multiple comparison test (pairs comparison). All above statistical analyses were carried out with a significance level (a) of 0.05 using GraphPad (San Diego, CA, USA) Prism 6.0 software.

3. Results and discussion

2.6. Species identification

3.1. Medium analysis and bacterial isolation

Following the protocol described by Lopez et al. (Lopez et al., 2003) the bacterial species were identified sequencing the PCR products obtained with WLAB primers (V4 and V5 regions of 16S rRNA) and rpoB (b subunit of RNA polymerase) primers. Amplicons were first purified using Wizard Genomic DNA Purification Kit (Promega, San Luis Obispo, CA, USA) and then sequenced with ABI PRISM 3100 Genetic Analyzer from Applied Biosystem (CA, USA). The sequences were compared with BLAST database (99% matching).

First all MLF samples were analyzed by scanning electron microscopy confirming the presence of yeasts and bacteria (bacilli and cocci). To achieve a comprehensive observation of MLF microbiota it was necessary to use different culture media in order to obtain pure cultures of bacterial cells (Barata, Malfeito-Ferreira, & Loureiro, 2012). Microbial count was performed using the serial dilution method observing that all culture media (Table 1) were adequate for bacterial isolation, however, the viable populations counts were lower (102e106 CFU mL1) than previous reports (106 a 109 CFU mL1) (Gonzalez-Arenzana, Santamaria, Lopez, Tenorio, & ~ a, Izquierdo, & Llanos Palop, 2010). Lopez-Alfaro, 2012; Ruiz, Sesen The highest counts were obtained for bacilli using MRS (3.2  105 CFU mL1) and LABW (2.0  106 CFU mL1) culture media (24 h of incubation). By means of four culture media, sixty-five colonies were isolated from MLF samples and based on their phenotypic and biochemical characteristics were preliminarily classified as lactic acid bacteria (cocci and bacilli). From both bacterial types, bacilli were found in all wineries (A-E) and they were the predominant species representing 65% of all bacterial isolated. Cocci isolation was limited to the use of MLO culture medium being detected in only three wineries (A, C, D). These results differ from previous studies, which report that cocci (Oenococcus) are the predominant species during MLF of Cabernet Sauvignon wines (Gonzalez-Arenzana, Santamaria, Lopez, & Lopez-Alfaro, 2013; Ruiz, Izquierdo, Sesena, & Palop, 2010). Regarding chemical analysis, MLF samples showed pH and alcohol strength values from 3.38 to 3.85 and between 9.1 and 14.4% v/v, respectively (Table 2). From both, according to the Pearson correlation test, only pH values showed a weak correlation with isolated bacterial count (r ¼ 0.372, a ¼ 0.05).

2.7. Aminogenic capacity of lactic acid bacteria isolated from MLF Aminogenic capacity of each bacterial isolate was studied using a synthetic medium previously described by Bover-Cid (Bover-Cid & Holzapfel, 1999). MRS (pH 5.0) and MLO (pH 4.8) media were supplemented with 0.1% w/v of each amino acid precursor: L-histidine monohydrochloride (Hist 98%), L-tyrosine (Tyro 98%), Llysine monohydrochloride (Lys 98%), L-ornithine monohydrochloride (Orn 98%), L-arginine (Arg 99%), and the cofactor pyridoxal-5-phosphate (5 mg L1) (Bover-Cid & Holzapfel, 1999). Both activation cultures were autoclaved at 121  C for 10 min to avoid amino acids denaturation. LAB strains were sub cultured seven times and incubated under microaerophilic and anaerobic conditions for 2e4 days at 28 and 37  C, respectively. Growth cultures (1 mL) were centrifuged at 15000  g for 5 min and the supernatant was filtered through a 13 mm PVDF sterile syringe filter (0.22 mm) and stored at 20  C until analysis. 2.8. BA determination by high performance liquid chromatography BA were determined following the method reported by Henríquez-Aedo et al. (Henríquez-Aedo et al., 2012) with some modifications. Chromatography was carried out on Merck Hibar Purospher C18 column (250 mm  4.6 mm, 5 mm) set at 45  C using a binary mobile phase composed of acetonitrile (A) and 10 mM ammonium formate pH 7 (B). The gradient program applied was the following: 0 min. 35% A; 12 min. 55% A; 16 min. 70% A; 18 min. 70% A (isocratic step); 25 min. 80% A; 27 min. 100% A; 35 min. 100% A (isocratic step); 37 min. 35% A and 45 min. 35% A (condition column). The best relation between backpressure, resolution and analysis time was achieved at a flow rate of 0.8 mL min1, with which a complete separation and column reconditioning/equilibration was accomplished in 45 min. Detection was performed by

Table 2 Chemical and microbiological analysis of MLF samples. Vineyard

pH

Alcoholic strength % (v/v)

A B C D E

3.85 3.38 3.61 3.72 3.64

9.1 11.0 9.3 14.4 11.0

Nd: no detected.

Medium/Bacterial count (log CFU mL1) MRS

ATB

LABW

MLO

4.6 3.6 5.5 4.6 4.3

4.1 3.9 4.1 3.1 Nd

5.2 6.3 5.3 3.8 4.0

4.4 Nd 2.5 4.7 Nd

186

K. Henríquez-Aedo et al. / LWT - Food Science and Technology 68 (2016) 183e189

3.2. Molecular identification of lactic acid bacteria Different species can exhibit similar phenotypic characteristics and the same fermentation profile (Ribereau-Gayon, 2000), therefore, it is necessary to apply more precise and reliable identification methodologies such as molecular based methods to describe the bacterial ecology of wines (Gonzalez-Arenzana, Lopez, Santamaria, & Lopez-Alfaro, 2013; Gonzalez-Arenzana et al., 2012; Guerrini, Mangani, Granchi, & Vincenzini, 2002). The most reported ones are denaturing gradient gel electrophoresis (DGGE) (Renouf, Claisse, & Lonvaud-Funel, 2006), random amplified polymorphic DNA (RAPD) (Reguant & Bordons, 2003) and restriction fragment length polymorphism (RFLP) (Claisse et al., 2007). Wine bacterial diversity has been mainly studied through 16S rRNA gene amplification (Rodas, ~ a, Ferrer, & Pardo, 2003; Ruiz, Izquierdo, et al., 2010; Ruiz, Sesen et al., 2010; Sanchez et al., 2010; Spano, Lonvaud-Funel, Claisse, & Massa, 2007), but other genes like rpoB (encodes the b subunit of bacterial RNA polymerase) have arisen as surrogate markers. This gene presents a high variability between species, which facilitates the discrimination between closely-related ones (Renouf, Claisse, Miot-Sertier, & Lonvaud-Funel, 2006). rpoB gene has already been used for wine lactic acid bacteria identification and even when its use has not been well documented, it seems that it could be an adequate alternative to 16S rRNA. The sixty-five colonies isolated from MLF samples were subjected to RFLP assay. Bacilli colonies (n ¼ 42) were amplified using rpoB1 and rpoB2 primers producing an amplicon of 306 bp. This PCR product was digested with HinfI restriction enzyme observing the same fragmentation pattern (101 and 205 bp) in all digested amplicons (n ¼ 42). Since with HinfI enzyme it was not possible to observe different digestion patterns, a second restriction enzyme (MseI) was utilized. After enzymatic digestion, the same pattern composed of three bands (51, 65 and 165 bp) was observed in all digested amplicons (Fig. 1). Therefore a third restriction enzyme (AciI) was used, but also produced the same fragmentation pattern (113, 103 and 43 bp) for all digested amplicons. Cocci isolates (n ¼ 23) were amplified with WLAB1 y WLAB2 primers; producing a single PCR product of 400 bp. This amplicon was digested by the same restriction enzymes used for bacilli colonies, applying the same protocols. The digestion with Hinfl enzyme produced only one amplicon of 350 bp., which was observed in all digestion amplicons. MseI restriction enzyme generated two major bands, one of 249 bp and another thicker band that gathered three fragments of 38, 41 and 45 bp, both major bands were observed in all samples. With AciI enzyme the same fragment pattern was also observed (26, 35, 36, 43, 104 and 113 bp.) in all samples. As described above, even when the digestion process itself was successful, none of these enzymes were adequate to

achieve a differentiation at species level within bacterial groups. All bacilli colonies showed the same restriction pattern on polyacrylamide gel (data not shown), the same situation was observed for cocci colonies. Thus, it was preliminarily inferred that both type of isolated colonies, bacilli and cocci, belong to only two bacterial species. The identification of these species was carried out sequencing nine randomly selected colonies of each bacterial type using an ABI PRISM 3100 Genetic Analyzer from Applied Biosystem. The results indicated that Bacilli colonies correspond to Lactobacillus rhamnosus species (99%) and that the cocci shaped colonies correspond to Oenococcus oeni species (99%) (Table 3). To the best of our knowledge this is the first time that L. rhamnosus has been reported during the vinification process. After identification, both bacterial species were studied according to winery and predominance. L. rhamnosus was isolated from all wineries (A-E) and O. oeni was only isolated from three wineries A, C and D. Regarding bacterial count, L. rhamnosus was the predominant species in all wineries, except in winery A where 67% of isolated viable bacteria corresponded to O. oeni (Fig. 2). Only this result is concordant with previous studies (Gonzalez-Arenzana, Lopez, et al., 2013; GonzalezArenzana, Santamaria, et al., 2013; Ruiz, Izquierdo, et al., 2010; Ruiz, ~ a, et al., 2010). Considering wineries and bacterial count reSesen sults, it is possible to conclude that L. rhamnosus was the predominant species during MLF of Chilean Cabernet Sauvignon wines. This is uncommon as most reports about MLF microbiota describe O. oeni as the predominant species. L. rhamnosus has been previously described as associated with cheese production (Bove, De Dea Lindner, Lazzi, Gatti, & Neviani, 2011) but it has never been isolated or related to wine elaboration/vinification. Although more studies are required, L. rhamnosus could be preliminarily considered as an endemic species of these viticultural regions, and maybe national, because it was isolated from all wineries sampled, which are located in different Chilean geographical regions (north, center and south). 3.3. BA production by lactic acid bacteria BA content has been studied in several foods because it may cause undesirable effects such as hypotension, hypertension, nausea, vomitting, diarrhea, migraines, heart palpitations, kidney failure, anaphylactic shock and death (Anli & Bayram, 2009; Shalaby, 1996). In the case of wine consumption, these effects could be more severe due to the concomitant intake of ethanol, which reduces/inhibits the activity of monoamine oxidase and diamine oxidase, enzymes responsible for BA metabolism. The principal BA reported in wines are 2-phenylethylamine (2-Phe), putrescine (Put), cadaverine (Cad), histamine (His), tyramine (Tyr),

Fig. 1. rpoB PCR-RFLP assay of LAB bacilli species (BM2, BM4, ML9 and SM9) applying HinfI (fragmentation pattern 101 and 205 bp (A)) and MseI (51, 65 and 165 bp (B)) restriction enzymes.

K. Henríquez-Aedo et al. / LWT - Food Science and Technology 68 (2016) 183e189

187

Table 3 Species identification by 16S rRNA or rpoB genes PCR-products sequencing. Isolates

Base pairs

Species

ID (%)

Query coverage (%)

Accession number

B6 B8 B10 BM2 BM4 HM8 ML9 SM8 SM9

397 396 395 268 301 290 282 278 278

Oenococcus oeni Oenococcus oeni Oenococcus oeni Lactobacillus rhamnosus Lactobacillus rhamnosus Lactobacillus rhamnosus Lactobacillus rhamnosus Lactobacillus rhamnosus Lactobacillus rhamnosus

99 99 99 99 99 99 99 99 99

100 100 100 100 100 100 96 98 98

LC071842.1 LC071842.1 LC071842.1 AP011548.1 AP011548.1 AP011548.1 AP011548.1 AP011548.1 AP011548.1

ATCC ATCC ATCC ATCC ATCC ATCC

53103 53103 53103 53103 53103 53103

ID: identities.

Fig. 2. Distribution and predominance of bacterial genotypes.

spermine (Spm) and spermidine (Spd). These BA come from two main sources, grapes (considered natural) and the vinification process (associated with microbial activity). In grapes Spm, Spd and Put are mainly found (Bover-Cid, Iquierdo-Pulido, Marine-Font, & Vidal-Carou, 2006), which are commonly reported at low concentrations except when vines suffer stressful conditions (AncinAzpilicueta et al., 2008; Souza et al., 2005). His, Cad, Tyr and 2Phe are related with microbial activity and their formation occurs mainly during alcoholic and malolactic fermentations (Anli & Bayram, 2009; Beneduce et al., 2010). Even when several factors affect the final BA content in wines, e.g. amines content in grapes and must (Sass-Kiss, Szerdahelyi, & Hajos, 2000), maceration (Martin-Alvarez, Marcobal, Polo, & Moreno-Arribas, 2006) amino acids concentration (Herbert, Cabrita, Ratola, Laureano, & Alves, 2006), grape variety (Marques, Leitao, & Romao, 2008), etc., the nature of the lactic acid bacteria responsible for MLF exerts a major influence on BA formation and thus, the levels observed are highly dependent on their aminogenic capacity (Ancin-Azpilicueta et al., 2008; Lerm, Engelbrecht, & du Toit, 2010; Martin-Alvarez et al., 2006). Therefore the detection of bacteria with this capacity is relevant in order to estimate the possibility of BA formation during vinification (Spano et al., 2010). Accordingly, the BA formation capacity of all sixty-five isolated colonies was studied to evaluate their potential to produce His, Cad, Tyr, 2-Phe, Spm, Spd and Put. All the bacterial isolated showed aminogenic capacity, with clear differences between bacterial species (Fig. 3), L. rhamnosus (10.97e28.61 mg L1) presented significantly higher BA formation capacity than O. oeni (3.31e6.64 mg L1). The type of BA formed also showed some differences, even when both species produced all BA; only L. rhamnosus species produced histamine, which is one of the most important BA due to its toxicological risk. The histamine-producing capacity of O. oeni species is not well-defined, Coton et al. (Coton, Rollan, Bertrand, & Lonvaud-Funel, 1998) and

Fig. 3. Box and whisker plot of biogenic amines formation by Lactobacillus rhamnosus and Oenococcus oeni.

Landete et al. (J.M. Landete, Ferrer, & Pardo, 2005) found O. oeni strains with histamine-forming capacity, in contrast, MorenoArribas et al. (M. Moreno-Arribas, Polo, Jorganes, & Munoz, 2003) and Garai et al. (Garai, Duenas, Irastorza, & Moreno-Arribas, 2007), isolated strains without this capacity. Two reasons could explain these contradictory results: i) BA production is associated with specific strains rather than particular species (Garai et al., 2007), and ii) histidine decarboxylase genes might be located in unstable plasmid being lost during bacterial cultures (Lucas, Claisse, & Lonvaud-Funel, 2008). Tyr and 2-Phe were produced for both species at very low levels (<1 mg/L); this tyramine- and phenylethylamine-forming capacity is being observed for the first  María Landete, Pardo, & Ferrer, 2007; V. time in O. oeni species (Jose Moreno-Arribas, Torlois, Joyeux, Bertrand, & Lonvaud-Funel, 2000). With these results it is possible to indicate that L. rhamnosus strains are the main strains responsible for BA formation in the five wineries studied. Additionally, all isolated colonies were classified according to their aminogenic capacity in order to select those with lower BA production. Six colonies, three L. rhamnosus and three O. oeni strains (Fig. 4) were chosen as potential autochthonous MLF culture starter. Our research group is currently carrying out the required experiments to study their applicability. 4. Conclusions The bacterial ecology of Chilean Cabernet Sauvignon wines during MLF and its relation with BA formation is being reported for the first time in this study. The principal LAB found were L. rhamnosus and Oenococcus oeni. Contrarily to previous studies about MLF microbiota, the predominant species was L. rhamnosus, which, to the best of our knowledge, has previously been described in other food items but not in wine. Considering that L. rhamnosus

188

K. Henríquez-Aedo et al. / LWT - Food Science and Technology 68 (2016) 183e189

Fig. 4. Biogenic amines profile produced by potential MLF culture starter. Each bar indicates the mean ± standard error of the mean.

was detected in wineries from different geographical viticultural regions, it could be preliminarily considered as an endemic species. Both species showed aminogenic capacity, however L. rhamnosus produced significantly higher BA concentrations than O. oeni, as well as a histamine-forming capacity, thus being the principal species responsible for biogenic amines formation in the five wineries studied. Further experiments are currently being carried out to study the potential of L. rhamnosus and O. oeni as MLF starter cultures. Acknowledgments This work is part of Karem Henríquez-Aedo thesis to obtain the degree of Doctor in Science and Analytical Technology from the University of Concepcion, Chile. The authors want to thank to the National Commission for Scientific and Technological Research (CONICYT) of the Chilean Government for the doctoral scholarship granted. This work was financially supported by National Fund for Scientific and Technological Development (FONDECYT) project N 1131080, CONICYT project Nº 78111204, INNOVA Biobio project Nº10 CH S2 719 F11 and the University of Concepcion. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.lwt.2015.12.003. References Ancin-Azpilicueta, C., Gonzalez-Marco, A., & Jimenez-Moreno, N. (2008). Current knowledge about the presence of amines in wine. Critical Reviews in Food Science and Nutrition, 48(3), 257e275. http://dx.doi.org/10.1080/ 10408390701289441. Anli, R. E., & Bayram, M. (2009). Biogenic amines in wines. Food Reviews International, 25(1), 86e102. http://dx.doi.org/10.1080/87559120802458552. Barata, A., Malfeito-Ferreira, M., & Loureiro, V. (2012). The microbial ecology of wine grape berries. International Journal of Food Microbiology, 153(3), 243e259. http://dx.doi.org/10.1016/j.ijfoodmicro.2011.11.025. Beneduce, L., Romano, A., Capozzi, V., Lucas, P., Barnavon, L., Bach, B., et al. (2010). Biogenic amine in wines. Annals of Microbiology, 60(4), 573e578. http:// dx.doi.org/10.1007/s13213-010-0094-4. Bove, C. G., De Dea Lindner, J., Lazzi, C., Gatti, M., & Neviani, E. (2011). Evaluation of genetic polymorphism among Lactobacillus rhamnosus non-starter Parmigiano Reggiano cheese strains. International Journal of Food Microbiology, 144(3), 569e572. http://dx.doi.org/10.1016/j.ijfoodmicro.2010.11.017. Bover-Cid, S., & Holzapfel, W. H. (1999). Improved screening procedure for biogenic amine production by lactic acid bacteria. International Journal of Food Microbiology, 53(1), 33e41. http://dx.doi.org/10.1016/s0168-1605(99)00152-x. Bover-Cid, S., Iquierdo-Pulido, M., Marine-Font, A., & Vidal-Carou, M. C. (2006). Biogenic mono-, di- and polyamine contents in Spanish wines and influence of a limited irrigation. Food Chemistry, 96(1), 43e47. Capozzi, V., Russo, P., Beneduce, L., Weidmann, S., Grieco, F., Guzzo, J., et al. (2010). Technological properties of oenococcus oeni strains isolated from typical southern Italian wines. Letters in Applied Microbiology, 50(3), 327e334. http://

dx.doi.org/10.1111/j.1472-765X.2010.02795.x. Claisse, O., Renouf, V., & Lonvaud-Funel, A. (2007). Differentiation of wine lactic acid bacteria species based on RFLP analysis of a partial sequence of rpoB gene. Journal of Microbiological Methods, 69(2), 387e390. http://dx.doi.org/10.1016/ j.mimet.2007.01.004. Coton, E., Rollan, G., Bertrand, A., & Lonvaud-Funel, A. (1998). Histamine-producing lactic acid bacteria in wines: early detection, frequency, and distribution. American Journal of Enology and Viticulture, 49(2), 199e204. De Man, J. C., Rogosa, M., & Sharpe, M. E. (1960). A medium for the cultivation of lactobacilli. Journal of Applied Bacteriology, 23, 130e135. Garai, G., Duenas, M. T., Irastorza, A., & Moreno-Arribas, M. V. (2007). Biogenic amine production by lactic acid bacteria isolated from cider. Letters in Applied Microbiology, 45(5), 473e478. http://dx.doi.org/10.1111/j.1472765X.2007.02207.x. ~ oz, R. (2012). Does Oenococcus oeni produce histamine? Garcia-Moruno, E., & Mun International Journal of Food Microbiology, 157(2), 121e129. http://dx.doi.org/ 10.1016/j.ijfoodmicro.2012.05.013. Garvie, E. I. (1967). Leuconostoc oenos sp. Journal of General Microbiology, 48, 431e438. Gerbaux, V., Villa, A., Monamy, C., & Bertrand, A. (1997). Use of lysozyme to inhibit malolactic fermentation and to stabilize wine after malolactic fermentation. American Journal of Enology and Viticulture, 48(1), 49e54. Gonzalez-Arenzana, L., Lopez, R., Santamaria, P., & Lopez-Alfaro, I. (2013a). Dynamics of lactic acid bacteria populations in Rioja wines by PCR-DGGE, comparison with culture-dependent methods. Applied Microbiology and Biotechnology, 97(15), 6931e6941. http://dx.doi.org/10.1007/s00253-013-4974y. Gonzalez-Arenzana, L., Santamaria, P., Lopez, R., & Lopez-Alfaro, I. (2013b). Indigenous lactic acid bacteria communities in alcoholic and malolactic fermentations of Tempranillo wines elaborated in ten wineries of La Rioja (Spain). Food Research International, 50(1), 438e445. http://dx.doi.org/10.1016/ j.foodres.2012.11.008. Gonzalez-Arenzana, L., Santamaria, P., Lopez, R., Tenorio, C., & Lopez-Alfaro, I. (2012). Ecology of indigenous lactic acid bacteria along different winemaking Processes of Tempranillo red wine from La Rioja (Spain). Scientific World Journal, 1e7. http://dx.doi.org/10.1100/2012/796327. Guerrini, S., Mangani, S., Granchi, L., & Vincenzini, M. (2002). Biogenic amine production by oenococcus oeni. Current Microbiology, 44(5), 374e378. http:// dx.doi.org/10.1007/s00284-001-0021-9. Henríquez-Aedo, K., Vega, M., Prieto-Rodríguez, S., & Aranda, M. (2012). Evaluation of biogenic amines content in chilean reserve varietal wines. Food and Chemical Toxicology, 50(8), 2742e2750. http://dx.doi.org/10.1016/j.fct.2012.05.034. Herbert, P., Cabrita, M. J., Ratola, N., Laureano, O., & Alves, A. (2006). Relationship between biogenic amines and free amino acid contents of wines and musts from Alentejo (Portugal). Journal of Environmental Science and Health Part BPesticides Food Contaminants and Agricultural Wastes, 41(7), 1171e1186. Landete, J. M., Ferrer, S., & Pardo, I. (2005). Which lactic acid bacteria are responsible for histamine production in wine? Journal of Applied Microbiology, 99, 580e586. Landete, J. M., Pardo, I., & Ferrer, S. (2007). Tyramine and phenylethylamine production among lactic acid bacteria isolated from wine. International Journal of Food Microbiology, 115(3), 364e368. http://dx.doi.org/10.1016/ j.ijfoodmicro.2006.10.051. Lerm, E., Engelbrecht, L., & du Toit, M. (2010). Malolactic fermentation: the ABC's of MLF. South African Journal of Enology and Viticulture, 31(2), 186e212. Lonvaud-Funel, A. (1995). Microbiology of the malolactic fermentation: molecular aspects. Fems Microbiology Letters, 126, 209e214. Lonvaud-Funel, A. (2001). Biogenic amines in wines: role of lactic acid bacteria. Fems Microbiology Letters, 199(1), 9e13. Lopez, I., Ruiz-Larrea, F., Cocolin, L., Orr, E., Phister, T., Marshall, M., et al. (2003). Design and evaluation of PCR primers for analysis of bacterial populations in wine by denaturing gradient gel electrophoresis. Applied and Environmental Microbiology, 69(11), 6801e6807. http://dx.doi.org/10.1128/aem.69.11.68016807.2003. Lucas, P. M., Claisse, O., & Lonvaud-Funel, A. (2008). High frequency of histamineproducing bacteria in the enological environment and instability of the histidine decarboxylase production phenotype. Applied and Environmental Microbiology, 74(3), 811e817. Marques, A. P., Leitao, M. C., & Romao, M. V. S. (2008). Biogenic amines in wines: Influence of oenological factors. Food Chemistry, 107(2), 853e860. http:// dx.doi.org/10.1016/j.foodchem.2007.09.004. Martin-Alvarez, P. J., Marcobal, A., Polo, C., & Moreno-Arribas, M. V. (2006). Influence of technological practices on biogenic amine contents in red wines. European Food Research and Technology, 222(3e4), 420e424. Moreno-Arribas, M., Polo, M., Jorganes, F., & Munoz, R. (2003). Screening of biogenic amine production by lactic acid bacteria isolated from grape must and wine. International Journal of Food Microbiology, 84(1), 117e123. http://dx.doi.org/ 10.1016/s0168-1605(02)00391-4. Moreno-Arribas, V., Torlois, S., Joyeux, A., Bertrand, A., & Lonvaud-Funel, A. (2000). Isolation, properties and behaviour of tyramine-producing lactic acid bacteria from wine. Journal of Applied Microbiology, 88(4), 584e593. Pineda, A., Carrasco, J., Pena-Farfal, C., Henriquez-Aedo, K., & Aranda, M. (2012). Preliminary evaluation of biogenic amines content in Chilean young varietal wines by HPLC. Food Control, 23(1), 251e257. http://dx.doi.org/10.1016/ j.foodcont.2011.07.025. Reguant, C., & Bordons, A. (2003). Typification of Oenococcus oeni strains by

K. Henríquez-Aedo et al. / LWT - Food Science and Technology 68 (2016) 183e189 multiplex RAPD-PCR and study of population dynamics during malolactic fermentation. Journal of Applied Microbiology, 95(2), 344e353. Renouf, V., Claisse, O., & Lonvaud-Funel, A. (2006a). rpoB gene: a target for identification of LAB cocci by PCR-DGGE and melting curves analyses in real time PCR. Journal of Microbiological Methods, 67(1), 162e170. http://dx.doi.org/ 10.1016/j.mimet.2006.03.008. Renouf, V., Claisse, O., Miot-Sertier, C., & Lonvaud-Funel, A. (2006b). Lactic acid bacteria evolution during winemaking: use of rpoB gene as a target for PCRDGGE analysis. Food Microbiology, 23(2), 136e145. http://dx.doi.org/10.1016/ j.fm.2005.01.019. res dans le stockage agroRibereau-Gayon, R. (2000). Les explosions de poussie quences alimentaire: Les risques d'accident catastrophique et leurs conse dicales. M me edecine de Catastrophe - urgences collectives, 3(1), 13e20. http:// dx.doi.org/10.1016/S1279-8479(0010.1016/S1279-8479(00)88827-8. Rodas, A. M., Ferrer, S., & Pardo, I. (2003). 16S-ARDRA, a tool for identification of lactic acid bacteria isolated from grape must and wine. Systematic and Applied Microbiology, 26(3), 412e422. Ruiz, P., Izquierdo, P. M., Sesena, S., & Palop, M. L. (2010a). Selection of autochthonous Oenococcus oeni strains according to their oenological properties and vinification results. International Journal of Food Microbiology, 137(2e3), 230e235. http://dx.doi.org/10.1016/j.ijfoodmicro.2009.11.027. ~ a, S., Izquierdo, P. M., & Llanos Palop, M. (2010b). Bacterial biodiversity Ruiz, P., Sesen and dynamics during malolactic fermentation of Tempranillo wines as determined by a culture-independent method (PCR-DGGE). Applied Microbiology and Biotechnology, 86, 1555e1562. Sanchez, A., Rodriguez, R., Coton, M., Coton, E., Herrero, M., Garcia, L. A., et al. (2010). Population dynamics of lactic acid bacteria during spontaneous malolactic fermentation in industrial cider. Food Research International, 43(8), 2101e2107. http://dx.doi.org/10.1016/j.foodres.2010.07.010.

189

Sass-Kiss, A., Szerdahelyi, E., & Hajos, G. (2000). Study of biologically active amines in grapes and wines by HPLC. Chromatographia, 51, S316eS320. Shalaby, A. R. (1996). Significance of biogenic amines to food safety and human health. Food Research International, 29(7), 675e690. Souza, S. C., Theodoro, K. H., Souza, E. R., da Motta, S., Beatriz, M., & Gloria, A. (2005). Bioactive amines in Brazilian wines: types, levels and correlation with physicochemical parameters. Brazilian Archives of Biology and Technology, 48(1), 53e62. Spano, G., Lonvaud-Funel, A., Claisse, O., & Massa, S. (2007). In vivo PCR-DGGE analysis of Lactobacillus plantarum and Oenococcus oeni populations in red wine. Current Microbiology, 54(1), 9e13. http://dx.doi.org/10.1007/s00284-0060136-0. Spano, G., Russo, P., Lonvaud-Funel, A., Lucas, P., Alexandre, H., Grandvalet, C., et al. (2010). Biogenic amines in fermented foods. European Journal of Clinical Nutrition, 64, S95eS100. http://dx.doi.org/10.1038/ejcn.2010.218. Versari, A., Parpinello, G. P., & Cattaneo, M. (1999). Leuconostoc oenos and malolactic fermentation in wine: a review. Journal of Industrial Microbiology & Biotechnology, 23(6), 447e455. Weiler, H. G., & Radler, F. (1970). Milchs€ aurebakterium aus wein und von €ttern. Zentralblatt für Bakteriologie, Parasitenkunde, InfektionskrankRebenbla heiten und Hygiene, 124, 707e732. Wu, J. J., Ma, Y. K., Zhang, F. F., & Chen, F. S. (2012). Biodiversity of yeasts, lactic acid bacteria and acetic acid bacteria in the fermentation of “Shanxi aged vinegar”, a traditional Chinese vinegar. Food Microbiology, 30(1), 289e297. http:// dx.doi.org/10.1016/j.fm.2011.08.010. ~ iga, M., Pardo, I., & Ferrer, S. (1993). An improved medium for distinguishing Zún between homofermentative and heterofermentative lactic acid bacteria. International Journal of Food Microbiology, 18(1), 37e42. http://dx.doi.org/10.1016/ 0168-1605(9310.1016/0168-1605(93)90005-2.