Identification of enterotoxigenic Escherichia coli isolates: a comparison of PCR, DNA hybridization, ELISA and bioassays

Identification of enterotoxigenic Escherichia coli isolates: a comparison of PCR, DNA hybridization, ELISA and bioassays

Journal of Microbiological Methods, 17 (1993) 181 191 181 © 1993 Elsevier Science Publishers B.V. All rights reserved 0167 - 7012/93/$06.00 MIMET 00...

666KB Sizes 1 Downloads 142 Views

Journal of Microbiological Methods, 17 (1993) 181 191

181

© 1993 Elsevier Science Publishers B.V. All rights reserved 0167 - 7012/93/$06.00 MIMET 00558

Identification of enterotoxigenic Escherichia coli isolates: a comparison of PCR, DNA hybridization, ELISAs and bioassays I. Blomrn, S. Lrfdahl, T.A. Stenstrrm and R. Norberg Department of Bacteriology, The National Bacteriological Laboratory, Stockholm, Sweden (Received 27 January 1992; revision received 26 October 1992; accepted 27 October 1992)

Summary PCR was compared to DNA hybridization, ELISAs and bioassays for the identification of enterotoxigenic Escherichia coli. Seventy E. coli strains of human and porcine origin were examined for heat-stable toxin (STI) and heat-labile toxin (LT). Hybridization was performed with two commercial alkaline phosphatase-conjugated oligonucleotide probes and two longer PCR-amplified radioactive probes. The adrenal cell test and the infant mouse test were used as reference methods. The LT PCR and hybridization using the radioactive LT probe detected all strains of both human and porcine origin, while the LT specific oligoprobe and the LT ELISA detected 62% and 59% of the strains, respectively. The agreement of the results of the different STI assays was generally higher for human than porcine isolates. The radioactive probe and the ELISA, with detection levels of 100% and 95%, respectively, correlated best to the bioassay for the detection of the human STI strains. PCR and the STI specific oligoprobe however, detected only 80% and 75%, respectively. The corresponding figures for the porcine STI isolates were considerably lower. A great variation was demonstrated among the genes for STI among the isolates of both origin. It was concluded that the PCR was a fast and reliable method for the identification of LT. The STI PCR did not, however, fulfil the desired criteria, probably due to the variability in the STI genes. It was also concluded that DNA hybridization using probes of at least 322 bases for LT and 175 bases for STI is useful for the verification of cultivated samples.

Key words: Bioassay; Enzyme-linked immunosorbent assay (ELISA); Enterotoxigenic; Escherichia coli; Polymerase chain reaction (PCR); Probe

Introduction Enterotoxigenic strains of Escherichia coli (ETEC) are an important cause of diarrhoea in humans, especially in developing countries. ETEC produce either heat-labile enterotoxin (LT), or heat-stable enterotoxin (ST), or both toxins. Correspondence to." S. L6fdahl, Department of Bacteriology, The National Bacteriological Laboratory, S-105 21 Stockholm, Sweden.

182 LT consists of 2 subunits, of which the Tox B subunit binds to eucaryotic cellsurface receptors (GM 1) and facilitates the entry of the Tox A subunit, into the cell [1]. Toxins produced by both human (LTh) and porcine (LTp) strains are closely related immunologically. The different genes for LT (elt) have a D N A homology higher than 95% [2]. Heat-stable toxins produced by E. coli are classified in two main groups, STI and STII. Different types of STI have been identified diverging in amino acid (18-47 residues) and nucleotide sequences. The sequences of the STI genes (estA) vary in the following way: estA4 of human origin and estA 1 of bovine origin have a homology of 70%, while estA4 and estA2, both of human origin, have a homology of 93% [3]. Plasmids that harbour both elt and estA genes tend to be highly related to each other whereas plasmids carrying only estA genes are heterogeneous [1]. Production of LT has been detected by G M 1 ganglioside ELISAs [4,5] and by its cytopathic effect on Y 1 adrenal cells [6]. ST1 has been detected by the infant mouse test [7], or by ELISAs with the toxin [8,9] or antibodies [10] as the solid phase. In recent years several DNA hybridization assays for the detection of LT and STI have been described using various radioactive-labeled DNA probes [4,11 14]. 32p-labeled probes have been compared to nonradioactive probes labeled with biotin [2,15], alkaline phosphatase [16-19] and digoxigenin [20]. Polynucleotide probes have been compared to oligonucleotide probes [12,14,16]. Radioactive RNA probes have been investigated as well [21,22]. The sensitivities and the specificities of these assays have shown considerable variation. The polymerase chain reaction (PCR) technique allows for a direct determination of specific D N A sequences. The technique is rapid, highly specific and extremely sensitive [23]. Recently this method has been applied for the identification of LT [2426]. Frankel et al. [27] utilised the PCR method for the simultaneous detection of LT, STI and Shigella in faeces. This paper describes an evaluation of PCR for the detection of enterotoxigenic E. coli strains compared with D N A hybridization using two commercial, alkaline phosphatase-conjugated (AP) oligonucleotide probes and two longer radioactive probes. In addition these tests were evaluated against GM1 ganglioside ELISA and Y 1 adrenal cell tests for the detection of LT, and competitive ELISA and the infant mouse test for the detection of STI. Materials and Methods

Bacterial strains and cultivation A total of 70 strains of E. coli were examined for the detection of LT and STI toxins. Forty-nine of these strains were originally isolated from humans and the remaining 21 E. coli were porcine isolates. The strains to be examined were kept frozen at - 7 0 ° C and cultivated on blood agar at 37°C overnight. The isolates were inoculated in 2 ml of a glucose containing tryptone-yeast extract medium [28] and grown with shaking (150 rpm) at 37c~C overnight. The bacteria were centrifuged (3500 x g) for 20 min. The supernatant fractions were tested for the production of LT by GM 1 ELISA and the adrenal cell test and for STI by competitive ELISA and the infant mouse test.

183

L T genes Tox A 5' e l t A 3 ATGAAAAATATAACTTT•ATTTTTTTTATTTTATTAGCATCGCCATTATATGCAAATGGCGACAAATTATACCGTGCTGA•TCTAGACC•CCAGATGAA

AI

G

eltA3 A T A A A A C G T A1

T••GGAGGTCTTATGC••AGAGGGCATAATGAGTA•TT•GATAGAGGAACT•AAATGAATATTAATCTTTATGATCA•GC•A•AGGAAC T / T///

eltA3 ACAAACCGGCTTTGTCAGATATGATGACGGATATGTTTCCACTTCTcTTAGTTTGAGAAGTGCTCACTTAGCAGGACAGTCTATATTATCAGGATATTC A1 A eltA3

CACTTACTATATATAT

A1 / eltA3 A1

GTTATAGCGACAGCACCAAATATGTTTAATGTTAATGATGTA

C

/////////

TTAGGCGTATACAGCCCTCACCCATATGAACAGGAGGTT

A

/

TCTGCGTTAGGTGGAATACCATATTCTCAGATATATGGATGGTATCGTGTTAATTTTGGTGTGATTGATGAACGATTACATCGTAACAGGGAATATAGA

eltA3 A1

GACCGGTATTACAGAAATCTGAATATAGCTCCGGCAGAGGATGGTTACAGATTAGCAGGTTTCCCACCGGATCACCAAGCTTGGAGAGAAGAACCCTGG OLIGO-PROBE ................... C ...... eltA3 ATTCATCATGCACCACAAGGTTGTGAAGATTCATCAAGAACAATTACAGGTGATACTTGTAATGAGGAGACCCAGAATCTGAGCACAATATATCTCAGG A_!I C eltA3 A1

AAATATCAATCAAAAGTTAAGAGGCAGATATTTTCAGACTATCAGTCAGAGGTTGACATATATAACAGAATTCGGAATGAATTATGA G G

Tox B 5' ...... PRIMER-L ...... eltB3 AATTCGGAATGAATTATGAATAAAGTAAAATGTTATGTTTTATTTACGGCGTTACTATCCT•TCTATGTGCATACGGAGCTCCCCAGTCTATTACAGAA B2 G T C T A A eltB3 B2

CTATGTTCGGAATATCGCAAcACACAAATATATACGATAAATGACAAGATACTATCATATACGGAATCGATGGCAGGCAAAAGAGAAATGGTTATCATT A

eltB3 A•ATTTAAGAG•GGCGCAA•ATTT•AGGTCGAAGTC•CGGGCAGTCAACATATAGACTCC•AAAAAAAAGCCATTGAAAGGATGAAGGACACATTAAGA B2 ~Y A G ...... PRIMER-R ..... eltB3 ATCAcATATcTGACCGAGACCAAAATTGATAAATTATGTGTATGGAATAATAAAAcCCCCAATTCAATTGCGGCAATCAGTATGGAAACCTAG B2 A

Fig. 1. Alignment of various sequences of LT genes. The Tox A subunit in human (ellA3) and porcine (eltA1) E. coli strains was described by Yamamoto et al. [28]. The sequences of the Tox B subunit in human (eltB2) and porcine (eltB1) strains as described by Leong et al. [29] are compared to the sequence of LTh as described by Yamamoto et al. [30], (eltB3). The locations of the 26-mer oligoprobe and the primers used in the PCR are indicated. The amplified sequence used as radioactive probe includes the two primers and the sequence in between. The start codons are underlined and deletions in the ellA1 gene are symbolized by slashes (/). The gaps in the eltA3 gene demonstrates insertions in the ellA1 gene. Primers and probes Published nucleotide sequences o f the toxin genes and the locations o f the probes and the primer pairs are shown in Figs. 1 and 2 [27,29-32]. The LT primers were chosen according to Olive [24]. The ST primers were selected from the sequence o f the estA4 gene [32] with the intent to amplify most o f the coding region o f this short gene, and make amplification possible o f at least human STI isolates. Both the LT and the STI primer pairs were synthesized in a Gene assembler (Pharmacia). The radioactive D N A probes were simultaneously produced and labeled by P C R amplification o f the. elt gene and the est gene. The LT probe (322 bp), complementary to the Tox B subunit gene, was derived from an E. coli isolate (ETEC 3692) o f human origin. The STI probe (175 bp) was amplified from a human E. coli strain (ETEC 264). The S N A P ® Hybridization Systems (Du P o n t / N E N ) used consisted o f alkaline phosphatase-labeled (AP) synthetic oligonucleotide probes. Both SNAP-oligonucleotides (STI 25-mer, and LT 26-mer) were complementary to the respective m R N A strands. The LT oligoprobe allowed for hybridization with the Tox A subunit gene.

184 STI

genes

5' estA4 TGATTTTGATTCAAATGTTC GTGGATGC CATGTTCCGGAGGTAATATGAAGAAATCAATATTATTTATTTTT A3 G / A2 T A C AG T A CCG AATC A C A ACAACATGA G C A GCT G G GCA estA4

...... PRIMER-L ....... CTTTCTGTATTGTCTTTTTCACCTTTC GCTCAGGATGCTAAAC

A_! A A

A estA4

C AGTAGAGTCTTCAAAAGAAAAAATCAC

A

C

A2

CTAGAATC

C CC CT

AAA

TAG

TCAA

G

T

G

C T

C

G

TGTAACATTGCAAAAAAAAGTAATAAAAGTGGTCCTGAAAGC

T T

AT GAATAGTAGCAAT

Aj A2 A~ T estA4

G GA T

G

G TG

T T

A G C AC G G

A AAAAAT

C A

AT

C

CATT

.... OLIGO-PROBE ........ =..... PRIMER-R ....... TACTGCTGTGAATTGTGTTGTAATCCTGCTTGTACCGGGTGCTATTAATAATA

Aj A2 A1

C T

C C

G T

A

TC T

A C AG GC

Fig. 2. Alignment of the sequences of the STI genes estA1, 2, 4 as described by Stieglitz et al. [31] and the sequence of estA3 as described by Moseley et al. [32]. The estA1 gene was isolated from a bovine E. coil strain and the estA2-4 genes from human strains. The start codon is underlined and the locations of the primers and the 25-mer oligoprobe used in this study are indicated. The radioactive probe includes the two primers and the sequence in between. Deletions are indicated by slashes (/). The overlap of the oligoprobe and primer R is indicated by the equal sign (=).

PCR Strains to be examined by PCR were diluted in distilled water to contain 500 bacteria and were boiled for 5 min to lyse the cells. The PCR reaction mixture used contained 50 m M KC1, 10 mM Tris HCI (pH 8.3), 2.5 mM MgCI2, 200 #M each of the dNTPs, 1.25 U of Taq polymerase (Cetus) and 0.1 pM of the STI primers or 0.4 kLM of the LT primers. A drop of mineral oil was added on top, and the tubes were initially heated to 94°C for 5 rain to denaturate the DNA. Denaturation, annealing and extension were programmed for a total of 30 cycles. One cycle for LT amplification was performed at 92°C for 30 s, 55°C for 30 s and 72°C for 1 rain, respectively. The corresponding STI cycle was 92°C for 1 min, 50°C for 30 s and 65°C for 1 min. The amplified D N A was analysed by agarose gel electrophoresis. Isolates which gave amplified D N A fragments of the correct sizes (LT 322 bp, and STI 175 bp) were regarded as positive. When labeling probes during amplification the concentrations of dNTPs were lowered to 6.25/~M and 65% of the dCTPs were replaced with [e-32p]dCTP (0.825 /~M). Unincorporated nucleotides were separated using Nick columns (Pharmacia) according to the manufacturer.

DNA hybridization At colony hybridization the test organisms were spotted onto 47 mm circular nitrocellulose membranes (Sartorius) and incubated on blood agar plates for 4 h at 37°C, Membranes processed with radioactive probes were handled as described earlier [34]. Hybridization was performed in 6 × SSC (1 × SSC = 0.15 M NaC1 and 0.015 M sodium citrate, pH 7.2) at 65°C and 54°C for the identification of LT and STI, respectively. Washings were performed at the same temperatures in 0.2 × SSC for LT probes and 2 × SSC for STI probes. Hybridization was detected by autoradiography. Hybridization and detection using the AP oligoprobes were performed according

185 to the manufacturer. Hybridization was accomplished at 50°C for both oligoprobes in 5 x SSC and membranes were washed in 1 x SSC at 40°C and at 50°C for the detection of LT and STI, respectively. The detection kit contained a substrate which formed a colored blue precipitate in the presence of alkaline phosphatase.

ELISAs The G M 1 ELISA was performed as described by Svennerholm and Holmgren [5]. Monoclonal antibody, mouse-anti-LTh, was used for the detection. Spectrophotometrical results A405 of > 0.09 were regarded as positive. Prior to competitive ELISA the STI-supernatants were neutralized with polyclonal antibodies (rabbit anti-STIa), in several dilutions at room temperature for 30 min. Microtiter wells were coated with 5 units of STIa (Sigma). The neutralized supernatants (100 pl) were added to each coated well and incubated at 37°C for 90 min. Rinse and detection were performed as described by Scotland et al. [9]. The results were calculated as follows: 1 - (A405 sample/An05 mean of negative controls). Positive results gave an A405 of > 0.60 in all dilutions. Bioassays The adrenal cell test was performed according to Sack and Sack [6]. As a control the toxins were neutralised by polyclonal antibodies (rabbit anti-LTp.). Strains which were neutralized and which gave >/ 50% rounding of the adrenal cells were regarded as positive strains. The infant mouse test was performed as described by Dean et al. [7]. Results

Identification of L T-strains Seventy E. coli strains were examined for the presence of the LT gene by PCR and colony hybridization, and for LT production by GM1 ELISA and the adrenal cell test. Colony hybridization was performed by using an AP oligonucleotide and a 32p_ labeled PCR derived fragment as D N A probes. Regarding the bioassay as the reference method, the results of these assays are compared in Table 1. There was a total agreement of the results obtained by PCR and hybridization using the radioactive probe when both human and porcine isolates were studied. One strain, negative in the adrenal cell test, was identified by both these methods. The AP oligoprobe failed to detect eight human strains and the ELISA nine human strains thus detecting only 72% and 69%, respectively. None of the five porcine strains were identified by any of these tests, thus further reducing the detection level. Identification of STI-strains The 70 E. coli strains were also examined for the presence of STI production and the estA gene. The infant mouse test was used as the reference method and compared to competitive ELISA, PCR and colony hybridization (Table 2). The agreement of the results of the different assays was generally higher for human than porcine isolates. Twenty out of 49 human isolates gave a positive reaction in the reference method. The radioactive probe identified all these strains and one additional strain.

186 TABLE 1 Comparison of the different assays for the identification of LT in 49 E. coli strains of human, and 2l of porcine origin No. of strains

Adrenal cell test

PCR

32p D N A fragment

AP oligo

ELISA

H u m a n origin 13 8 7

+ + +

+ + +

+ + +

+ +

+

-

+

+

+

+

1 1

19 Porcine origin 5 16

-

+

+

-

-

-

+ -

+ -

+ -

The ELISA failed to detect one of these strains but identified the same additional isolate as the 32p-labeled probe. Both the PCR analysis and the AP oligoprobe failed to identify four of the above strains and furthermore, another

strain. Thus,

these methods

detected

respectively. The specificity of PCR oligoprobe

was 97%

80%

the AP oligoprobe and 75%

omitted

of the human

was 100% and corresponding

yet

strains,

figure for the AP

as this test identified one strain negative in the other assays.

TABLE 2 Comparison of the assays for the identification of STI in 49 E. coli strains of h u m a n and 21 of porcine origin No. of strains H u m a n origin 14 l

Infant mouse

PCR

32p D N A fragment

AP oligo

ELISA

+

+

+

+

+

+

+

+

+

-+

1

+

+

+

--

4

+

-

+

-

+

1

-

-

+

-

+

+

-

+ +

1

-

.

27

Porcine origin 4 3 2

-

.

-

.

.

.

+ + +

+ --

+ + -

-+ +

-

1

+

-

+

-

-

1

+

-

-

-

+

1

-

-

-

+

+

1

+

.

1

-

-

+

-

-

2

-

-

-

+

-

5

.

.

.

.

.

.

.

.

187

A

a

e 6 X SSC

2 x SSC

0.2

x SSC

a

b

a

b

a

b

C

d

c

d

c

d

e

e

Fig. 3. (A) Colony hybridization using a JZP-labeledSTI specific probe and three circular membranes containing the following E. coil isolates: (a) 29 human isolates, (b) 19 human and 7 porcine isolates (the top rows consist of 14 different colonies of a single strain), (c) two human and 14 porcine isolates. The positive control strain (ETEC 264) is indicated by arrows. (B) Dot-blot hybridization of the five strains of E. coli. Washing was performed at 54°C in 6 × SSC, 2 x SSC and 0.2 x SSC as noted. (a) Negative control; (b) human isolate; (c) human isolate; (d) porcine isolate; (e) human isolate (ETEC 264). A disagreement of the results of the methods occurred within the group of porcine isolates. Twelve porcine isolates were positive in the reference method out of which the AP oligoprobe only detected five. This test also detected strains that were negative according to the other methods. The P C R failed to identify eight of the 12 positive isolates. However, the P C R did not identify isolates negative in the reference method. A m o n g the porcine isolates the ELISA as well as the radioactive probe detected 8 out of 12 strains positive in the infant mouse test. Hybridization by using the 32p-labeled P C R derived probe demonstrated a great variability in signals among both the human and the porcine isolates (Fig. 3A). The strains of porcine origin gave much weaker signals (the spot above the positive control and the weak spot at the bottom left of filter b and the eight weak spots on filter c) than the human isolate from which the probe was derived, and generally also weaker than most human strains included in this study (filter a and b, and the two leftmost spots on filter c). Likewise, five h u m a n strains negative in P C R and by the AP oligoprobe showed weaker hybridization (Fig. 3A, filter a). These strains carried the LT gene as well and m a y thereby harbour identical plasmids. An experiment was performed to find out the reasons for the signal variation. Dotblots on nitrocellulose membranes were prepared in triplicates with five strains of E. coli. Aliquots containing 5 x l 0 7 cfu were applied by aspiration using a vacuum

188 manifold. After hybridization with an STI probe the filters were washed at 54"C in different salt concentrations. (Fig. 3B). Strain ETEC 264, from which the STI probe was derived by PCR, was included in this experiment. At 6 × SSC one negative and four positive signals (two strong, including strain 264, and two weak) were obtained. As the salt concentration was decreased the strong signals were consistent while the weaker were reduced. This indicates that the difference in signal was due to sequence heterogeneity and probably not to the copy number of the plasmid carrying the gene. Strains carrying both elt and estA genes A total of 15 strains of human origin were identified by both the Y1 adrenal cell test and the infant mouse assay. The radioactive probes detected all these and one additional strain which was negative in the infant mouse test, the STI PCR and the STI oligoprobe. The LT PCR identified all 16 isolates while the ST! PCR failed in five cases (see above). The STI oligoprobe failed to detect these five strains and a further one, the LT oligoprobe identified 12 of the 16 isolates. The LT and STI ELISA identified 11 and 15 of these strains respectively. Discussion

The purpose of this study was to select methods for the direct detection of enterotoxigenic strains and for the identification of ETEC strains both among single isolates and among other colonies on screening filters (e.g. membrane filtered environmental samples). Considering direct detection, the PCR technique would be the method of choice. We chose to evaluate PCR and D N A hybridization for the identification of cultured isolates and the latter for the screening of membrane filters. These methods, which detect the toxin genes, were compared to immunological techniques and bioassays that detect the toxins and their functions, respectively. The PCR detected 100% and 80% of the LT and STI strains, respectively, when regarding E. coli isolates of human origin. However, this figure decreased to 66% when the porcine isolates were included as ST! was studied. The higher sensitivity for LT detection was apparently a consequence of a higher D N A homology between the genes of the LT producing E. eoli isolates. This was also confirmed by the results of the D N A hybridization. The radioactive LT probe in contrast to the STI probe had no obvious variations in hybridization signals. The STI strains of human origin were less variable than the porcine isolates as four of the latter did not hybridize with the radioactive probe. These findings were in agreement with published sequences [32,33] of several estA genes (Fig. 2). The radioactive STI probe demonstrated a weaker signal when hybridizing to isolates not amplified by the PCR. The oligonucleotide probe did not identify any of these strains. The LT oligonucleotide probe failed to hybridize with several strains identified by both the longer probe and by the PCR. Hybridization by using oligonucleotides of these sizes (25-26 bases) are more susceptible to single base alterations than both the PCR and longer D N A probes. It has been shown that PCR primers accept mismatches but the last three nucleotides at the 3' end of the primer are the most crucial for successful extension [35]. A comparison between the sequence of the elt gene in E. coli isolates of human and porcine origin demonstrated minor base substitutions and

189 deletions spread randomly over the entire gene (Fig. 1). The oligoprobe in the SNAP hybridization kit, however, demonstrated one basepair substitution compared with both published sequences (Fig. 1). This mismatch may be critical for the hybridization at the high stringency recommended by the manufacturer. Some of the false negative results using the AP oligoprobes may also be explained by the limited sensitivity and specificity associated with the detection system. This system is based upon a coloured precipitate of a substrate formed by the single alkaline phosphatase molecule on each oligonucleotide, in contrast to the multiple labeling in the PCR derived probe. The PCR amplification was as successful as the hybridization with the radioactive probe. Both detected all LT strains identified by the bioassay plus one further strain. This result might indicate the fact that though the gene was present, there was no detectable expression of an active toxin. Identification of STI by DNA hybridization using the 32P-labeled probe and the ELISA corresponded well (100% and 95% isolates, respectively, were detected). Including the porcine isolates, however, the equivalent values diminished to 88% and 84% respectively. This again may be explained by the variability of the STI toxin gene. The LT ELISA failed to identify 9 of 29 adrenal cell positive human isolates and all five porcine isolates. The inability to detect the porcine strains was apparently due to the fact that a monoclonal antibody against LT emanating from a human isolate was used in this assay. The use of polyclonal antibodies may enhance the degree of detection of the ELISA. It was concluded from the results of this study that PCR for LT would fulfil the desired detection criteria while the sensitivity of STI PCR was not acceptable. It might be possible to establish a more useful PCR by finding primers complementary to conserved regions within or outside the estA gene. The primers used in this study were selected in order to get a PCR product included within a 216 bp HpalI fragment, which is specific for the estA gene as previously shown by Moseley et al. [33]. Moreover, Nishibuchi et al. [13] found a conserved region in the STI gene closely related to the enteroxicity. This region is located within the 216 bp HpalI fragment. It was also concluded that DNA hybridization using probes of at least 322 bases for LT and 175 bases for STI can be recommended for the verification of cultivated samples. In this study the use of these probes were combined with radioactive labeling and autoradiography for the detection. However, alternative labeling detection systems e.g. digoxigenin and chemiluminescence would probably also work.

Acknowledgement We thank Dr. Saleem Abaas and Gunnel Sigstam for supplying porcine test organisms and antibodies. We also thank Karin Jacobsson for excellent technical assistance. This work has been supported by the Swedish Council for Forestry and Agricultural Research, Grant 0591/89 L134.

References 1 Betley,M.J., Miller,V.L. and Mekalanos,J.J. (1986) Geneticsof bacterial enterotoxins.Annu. Rev. Microbiol. 40, 577-605.

190 2 Bialkowska-Hobrzanska, H. (1987) Detection of Escherichia coli by dot blot hybridization with biotinylated DNA probes. J. Clin. Microbiol. 25, 338 343. 3 Maas, R., Silva, R.M., Gomes, T.A., Trabulsi, L.R. and Maas, W.K. (1985) Detection of genes for heat-stable enterotoxin I in Escherichia coli strains isolated in Brazil. Infect. lmmun. 49, 46- 51. 4 Sommerfelt, H., Svennerholm, A., Kalland, K.H., Haukanes, B. and Bjorvatn, B. (1988) Comparative study of colony hybridization with synthetic oligonucleotide probes and enzyme-linked immunosorbent assay for identification of enterotoxigenic Escherichia coli. J. Clin. Microbiol. 26, 530-534. 5 Svennerholm, A. and Holmgren, J. (1978) Identification of Escherichia coli heat-labile enterotoxin by means of a ganglioside immunosorbent assay (GM1-ELISA) procedure. Curr. Microbiol. 1, 19-23. 6 Sack, D.A. and Sack, R.B. (1975) Test for enterotoxigenic Escherichiu coli using YI adrenal cells in miniculture. Infect. Immun. 11, 334-336. 7 Dean, A.G., Ching, Y., Williams, R.G. and Harden, L.B. (1972) Test for Escherichia coli enterotoxin using infant mice: application in a study of diarrhoea in children in Honolulu. J. Infect. Dis. 125, 407 411. 8 Lockwood, D.E. and Robertson, D.C. (1984) Development of a competitive enzyme-linked immunosorbent assay (ELISA) for Escherichia coli heat-stable enterotoxin (STa). J. Immunol. Methods 75, 295 307. 9 Scotland, S.M., Willshaw, G.A., Said, B., Smith, H.R. and Rowe, B. (1989) Identification of Escherichia coli that produces heat-stable enterotoxin STA by a commercially available enzyme-linked immunoassay and comparison of the assay with infant mouse and DNA probe test. J. Clin. Microbiol. 27, 1697 1699. ~'1 Klipstein, F.A., Engert, R.F., Houghten, R.A. and Rowe, B. (1984) Enzyme-linked immunosorbent assay for Escherichia coli heat-stable enterotoxin. J. Clin. Microbiol. 19, 798 803. 11 Echeverria, P., Taylor, D.N., Seriwatana, J., Chatkaeomorakot, A., Khungvalert, V., Sakuldaipeara, T. and Smith, R.D. (1986) A comparative study of enterotoxin gene probes and tests for toxin production to detect enterotoxigenic Escherichia coli. J. Infect. Dis. 153, 255-260. 12 Echeverria, P., Taylor, D.N., Seriwatana, J. and Moe, C. (1987) Comparative study of synthetic oligonucleotide and cloned polynucleotide enterotoxin gene probes to identify enterotoxigenic Escherichia coli. J. Clin. Microbiol. 25, 10(~109. 13 Nishibuchi, M., Murakami, A., Arita, M., Jikuya, H., Takano, J., Honda, T. and Miwatani, T. (1989) Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli. J. Clin. Microbiol. 27, 2272 2276. 14 Sommerfelt, H., Kalland, K.H., Raj, P., Moseley, S.L., Bhan, M.K. and Bjorvatn, B. (1988) Cloned polynucleotide and synthetic oligonucleotide probes used in colony hybridization are equally efficient in the identification of enterotoxigenic Escherichia coli. J. Clin. Microbiol. 26, 2275 2278. 15 Kirii, Y., Danbara, H., Komase, K., Arita, H. and Yoshikawa, M. (1987) Detection of enterotoxigenic Escherichia coli by colony hybridization with biotinylated enterotoxin probes. J. Clin. Microbiol. 25, 1962-1965. 16 Bopp, C.A., Threatt, V.L., Moseley, S.L., Wells, J.G. and Wachsmuth, 1.K. (1990) A comparison of alkaline phosphatase and radiolabelled gene probes with bioassays for enterotoxigenic Escherichia coli. Mol. Cell. Probes 4, 193 203. 17 Medon, P., Lanser, J.A., Monckton, P.R., Li, P. and Symons, R.H. (1988) Identification of enterotoxigenic Escherichia coli isolates with enzyme-labeled synthetic oligonucleotide probes. J. Clin. Microbiol. 26, 2173 2176. 18 Nishibuchi, M., Arita, M., Honda, T. and Miwata, T. (1988) Evaluation of a nonisotopically labeled oligonucleotide probe to detect the heat-stable enterotoxin gene of Escherichia coli by DNA colony hybridization test. J. Clin. Microbiol. 26, 784-786. 19 Seriwatana, J., Echeverria, P., Taylor, D.N., Sakuldaipeara, T., Changchawalit, S. and Chivoratanond, O. (1987) Identification of enterotoxigenic Escherichia coli with synthetic alkaline phosphatase-conjugated oligonucleotide DNA probes. J. Clin. Microbiol. 25, 1438-1441. 20 Sommerfelt, H., Grewal, H.M.S. and Bahan, M.K. (1990) Simplified and accurate nonradioactive polynucleotide gene probe assay for identification of enterotoxigenic Escherichia coli. J. Clin. Microbiol. 28, 49-54. 21 Chityothin, O., Sethabuthr, O., Echeverria, P., Taylor, D.N., Vongsthongsri, U. and Tharavanij, S. (1987) Detection of heat-stable enterotoxigenic Escherichia coli by hybridization with an RNA

191 transcript probe. J. Clin. Microbiol. 25, 1572 1573. 22 Saez-Llorens, X., Guzman-Verduzco, L.M., Shelton, S., Nelson, J.D. and Kupersztoch, Y.M. (1989) Simultaneous detection of Escherichia coli heat-stable and heat-labile enterotoxin genes with a single RNA probe. J. Clin. Microbiol. 27, 1684-1688. 23 Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A. (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487491. 24 Olive, D.M. (1989) Detection of enterotoxigenic Escherichia coli after polymerase chain reaction amplification with a thermostable DNA polymerase. J. Clin. Microbiol. 27, 261 265. 25 Furrer, B., Candrian, U. and Lfithy, J. (1990) Detection and identification of E. coli producing heatlabile enterotoxin type I by enzymatic amplification of a specific DNA fragment. Lett. Appl. Microbiol. 10, 31 34. 26 Victor, T., Du Toit, R., Van Zyl, J., Bester, A.J. and Van Helden, P.D. (1991) Improved method for the routine identification of toxigenic Escherichia coli by DNA amplification of a conserved region of the heat-labile toxin A subunit. J. Clin. Microbiol. 29, 158 161. 27 Frankel, G., Giron, J.A., Valmassoi, J. and Schoolnik, G.K. (1989) Multi-gene amplification: simultaneous detection of three virulence genes in diarrhoeal stool. Mol. Microbiol. 3, 1729-1734. 28 Jansson, P.-E., Lindberg, A., Lindberg, B. and Wollin, R. (1981) Structural studies on hexose region of the core in lipopolysaccharides from Enterobacteriaceae. Eur. J. Biochem. 115, 571-577. 29 Yamamoto, T., Tamura, T. and Yokota, T. (1984) Primary structure of heat-labile enterotoxin produced by Escherichia coli pathogenic for humans. J. Biol. Chem. 259, 5037-5044. 30 Leong, J., Vinal, A.C. and Dallas, W.S. (1985) Nucleotide sequence comparison between heat-labile toxin B-subunit cistrons from Escherichia coli of human and porcine origin. Infect. Immun. 48, 73 -77. 31 Yamamoto, T. and Yokota, T. (1983) Sequence of heat-labile enterotoxin of Escherichia coli pathogenic to humans. J. Bacteriol. 155, 728 733. 32 Stieglitz, H., Cervantes, L., Robledo, R., Fonseca, R., Covarrubias, L., Bolivar, F. and Kupersztoch, Y.M. (1988) Cloning, sequencing, and expression in Ficoll-generated minicells of an Escherichia coli heat-stable enterotoxin gene. Plasmid 20, 42 53. 33 Moseley, S.L., Hardy, J.W., Huq, M.I., Echeverria, P. and Falkow, S. (1983) Isolation and nucleotide sequence determination of a gene encoding a heat-stable enterotoxin of Escherichia coli. Infect. Immun. 39, 1167-1174. 34 Reizenstein, E., Morfeldt, E., Gilljam, G., Hallander, H.O. and Lffdahl, S. (1990) A DNA hybridization test for the detection of Bordetella in nasopharyngeal specimens. Mol. Cell. Probes 4, 211 221. 35 Sommer, R. and Tautz, D. (1989) Minimal homology requirements for PCR primers. Nucl. Acids Res 17, 6749.