Inhibition of T cell activation with a humanized anti-β1 integrin chain mAb

Inhibition of T cell activation with a humanized anti-β1 integrin chain mAb

Molecular Immunology, Vol. 32, No. 2, pp. 101-I 16, 1995 Copyright 0 1995 Elsevier Science Ltd 0161-5?390(94)BO146-4 INHIBITION MARIE-ALIX Printed...

2MB Sizes 0 Downloads 1 Views

Molecular Immunology, Vol. 32, No. 2, pp. 101-I 16, 1995 Copyright 0 1995 Elsevier Science Ltd

0161-5?390(94)BO146-4

INHIBITION

MARIE-ALIX

Printed in Great Britain. All rights reserved 0161-5890/95$9.50 + 0.00

OF T CELL ACTIVATION WITH A HUMANIZED ANTI-/31 INTEGRIN CHAIN mAb POUL,* MICHEL TICCHIONI,t ALAIN BERNARD? MARIE-PAULE LEFRANC*$

and

Moltculaire, *Laboratoire d’ImmunoGtnitique Mol&culaire, LIGM, Institut de G&tique UMR 9942, CNRS, Universitbs Montpellier I et II, Montpellier, France; and TINSERM U343, FacultC de MCdecine and Laboratoire d’Immunologie, Hapital de I’Archet, Nice, France (First received 9 July 1994; accepted in revised form 24 September 1994) Abstract-The murine anti-CD29 mAb K20 (Mu-K20) is known to bind to the @l chain of the human integrins and to inhibit activation and proliferation of T cells, implying an important potential for in vivo immunosuppression. However, use of K20 as an immunosuppressant drug would be impaired by the immunogenicity of mouse mAbs in man. We have therefore engineered K20 into (1) a mouse/human chimeric mAb (Ch-K20) that comprises the human K/Y1 C regions and the K20 V regions; and (2) a humanized mAb (Hu-K20) combining the complementarity-determining regions (CDRs) of the K20 mAb with human framework (FR) and K/Y1 C regions. Both chimeric and humanized Abs were able to reproduce a range of functional properties of the original mouse mAb K20 (Mu-K20), namely, specific binding of CD29, inhibition of T cell proliferation and elevation of second messenger phosphatidic acid (PA) induced via CD3 in a soluble form, and activation of T cell proliferation in a cross-linked form. When compared to Ch-K20, the avidity of Hu-K20 was only slightly reduced. This demonstrates the feasibility of a successful humanization performed on the sole basis of the primary amino acid sequence analysis of the original mouse antibody V regions. Key words: antibody engineering, integrin, T cell activation.

humanized

antibody,

INTRODUCTION Numerous data show that adhesion of T lymphocytes to extracellular matrix and/or other cells is essential in both their activation and migration. Among the cell surface molecules involved in adhesion functions, integrins are a/I heterodimeric transmembrane proteins mediating both cell-cell and cell-matrix interactions (Hynes, 1987; Ruoslahti and Pierschbacher, 1987). The integrin family has been divided into three main subfamilies according to the fi chain (for review see Hemler, 1990). The B 1 chain (CD29), which defined the VLA subfamily, is highly expressed on memory T cells (Sanders et al., 1988) and is implicated in different cellular functions. Indeed, T cell stimulation by phorbol esters, anti-CD3 or antiCD2 antibodies, increase the adhesion of the T cells to fibronectin which is a ligand of VLA-4 and VLA-5 and to laminin which is a ligand of VLA-6 (Nojima et al., 1990; Shimizu et al., 199Oa, 6). In addition, laminin $Author to whom correspondence should be addressed at: Laboratoire d’ImmunoG&tique Mol&ulaire, LIGM, IGMM, 1919 Route de Mende, B.P. 5051,34033 Montpellier cedex 1, France. Abbreviations: VLA, very late antigen; PA, phosphatidic acid; CDR, complementarity-determining region; CDC, complement-dependent cytotoxicity; FR, framework; PCR, polymerase chain reaction; bp, base pair; MFI, mean fluorescence index.

chimeric antibody,

immunosuppression,

(Shimizu et al., 1990a), fibronectin (Davis et al., 1990; Matsuyama et al., 1989; Nojima et al., 1990; Shimizu et al., 1990a) and vascular cell adhesion molecule 1, which is a second ligand of VLA-4 (Damle and Aruffo, 1991; Elites et al., 1990) can deliver a positive costimulatory activation signal within T cells via their VLA receptor. Interestingly, anti-81 mAbs like 4B4, K20, TS2/16 or A lA5, induce co-mitogenic proliferative signals on T lymphocytes in a cross-linked form (Yamada et al., 1991), and most of them, but not K20, also have positive signaling effects on T cell activation and proliferation in a soluble form (Groux et al., 1989). K20 is a mouse mAb that recognizes a particular epitope on human CD29, within residues 426-587 containing three epidermal growth factor repeats (Takada and Puzon, 1993). This epitope is different from those recognized by other known anti-CD29 mAbs like 4B4, TS2/16 or Al A5 mAbs, which are located within residues 207-218, a putative ligand binding region (Takada and Puzon, 1993). K20 was shown, in a soluble form, to block peripheral T cell activation and proliferation induced by an anti-CD3 antibody. This negative effect might be mediated by an increase of CAMP levels (Groux et al., 1989) or an inhibition of diacylglycerol and PA formation (Ticchioni et al., 1993). These in vitro functional effects of K20 make it a good candidate for therapeutic immunosuppression. The use of murine mAbs in immunotherapy is impaired by their 101

M.-A. POUL et al.

102

limited half-life in the circulation because patients raise Huet et al., 1986) were grown in the same medium as human anti-mouse antibodies (Levy and Miller, 1983; Jurkat cells. Miller et al., 1983), which precludes long-term treatCloning and sequencing of the V, and VH rearranged genes ments. To circumvent the problem of immunogenicity, from K20 cDNA some chimeric antibodies were genetically engineered Total RNA of K20 hybridoma was isolated by that combine the V regions of the mouse antibody, guanidium LiCl extraction (Sambrook et al., 1989). First responsible for the binding of the Ag, with the human strand cDNA was synthesized by priming 10 pg of total antibody C regions (Bouliane et al., 1984; Neuberger RNA with VKlFOR and VHl FOR oligonucleotides et al., 1985). These chimeric antibodies are expected to (Orlandi et al., 1989) specific for the 3’ end of light be less immunogenic than their murine counterpart, avoiding anti-isotypic antibodies (Bruggemann et al., kappa (V,) or heavy (V,) rearranged variable genes, 1989; LoBuglio et al., 1989). Moreover, the presence of respectively, and was used as template for PCR amplification of K20 rearranged variable genes with Taq human C regions lead to molecules with efficient effector functions such as complement and cell mediated lysis Polymerase (Perkin Elmer Cetus, Norwalk, CT). PCR amplification of K20 V, cDNA was performed with (Bruggemann et al., 1987). It is possible to reduce further VK 1BACK and VK 1FOR primers (Orlandi et al., 1989), the murine part of the chimeric antibody, decreasing therefore immunogenicity, without affecting specificity containing Pvu II and Bgl II cloning sites, respectively. and affinity for the antigen. The strategy is to identify the PCR and amplification of K20 V, cDNA was performed with VHlBACK and VHlFOR primers (Orlandi et al., amino acids present at the binding site that correspond 1989) containing Pst I and BstE II cloning sites, respectto the CDRs and those responsible for the conformation of the binding site. On the basis of correlations between ively. Primers are described in Table 1. PCR products were separated from oligonucleotides by 1.2% agarose antibody structure and amino acid primary sequence, Chothia et al. (Chothia and Lesk, 1987; Chothia et al., gel electrophoresis. A band at the expected size (about 1989, 1992) proposed that there is a small repertoire of 320 bp for V, and 360 bp for V,) was excised from the in SPIN-X microfuge (Costar, main chain conformations called canonical structures for gel, centrifuged extracted and at lease five of the six hypervariable loops (Ll, L2, L3, Cambridge, MA), phenol/chloroform ethanol precipitated. Restriction digests were then Hl and H2) and that the particular conformation adopted is determined by a few conserved key residues. performed with adequate restriction enzymes. K20 V, Winter’s group has genetically engineered humanized or gene was cloned in phage Ml 3VKPCRl (Orlandi et al., reshaped Abs which are human Abs in which the only 1989) (digested by Pvu II and Bcl I), and V, gene in murine amino acids present are those of the CDR and phage M13VHPCRl (Orlandi et al., 1989) (digested by those necessary for the conservation of the conformation Pst I and BstE II), to obtain M13VKK20PCRl and of the binding site (Jones et al., 1986; Riechmann et al., M 13VHK20PCR1, respectively (see Fig. 1A). Both phages contain Ig H chain promoter (P) and the leader 1988; Verhoeyen et al., 1988). sequence (L) from the mouse V47 unrearranged V, gene The aim of this work was to produce a recombinant K20 with potentially reduced immunogenicity and in addition to the inserted K20 rearranged V, or V, functional properties identical with the murine mAb K20 genes. Sequencing was done with T7 Polymerase (Pharmacia, France) with primers SEQVKFOR and (Mu-K20). We have engineered a chimeric K20 antibody SEQVHFOR primers (Table 1). Deduced amino acid (Ch-K20) and a humanized K20 antibody (Hu-K20). The specificity and avidity for CD29 of both engineered sequences of K20 V, and V, domains were analysed by antibodies and their in vitro biological effect on prolifercomparison to Kabat et al. (199 l), to define CDRs and ation and activation of T lymphocytes were analysed. FRs. Canonical structures of HI, H2, Ll, L2 and L3 and compared to those of Mu-K20. loops were predicted as defined by Chothia (1987, 1989, 1992). MATERIALS AND METHODS Cells and culture medium K20 hybridoma was grown in DMEM, supplemented

with 10% (v/v) FCS, 100mg streptomycin/l and 100,000 units penicillin/ 1. The NSO cell line, a myeloma which does not produce endogenous Ig chain due to an abolition of H chain transcription and a defect in the K transcript (Foote and Winter, 1992) was grown in DMEM supplemented with 10% (v/v) FCS, 100mg sodium pyruvate/l and antibiotics as above. The CD29 highly expressing human T cell line, Jurkat, was grown in RPM1 1640, prepared in our laboratory, supplemented with 10% (v/v) FCS, 2 mM glutamine and antibiotics as above. T lymphocytes (purified from peripheral blood as previously described;

Production of F(ab) K20

PCR amplification of K20 V, gene was performed on template M13VKK20PCRl with the primer pair VKZBACK and VK3FOR containing Sac I and Xho I cloning sites, respectively (Table 1). The amplification product was cloned in the procaryotic expression vector pSWF(ab) (Hoogenboom et al., 1991) digested by Sac I and Xho I to obtain pSWl F(ab)(VKK20). V, was cloned first because K20 V, gene contains a Sac I restriction site. K20 V, gene was excised from Ml 3VHKZOPCRl by a BstE II total digestion and Pst I partial digestion (there is an internal Pst I site in VHK20). A fragment containing the complete K20 V, was isolated and cloned in pSWlF(ab)(VKK20) to obtain pSW 1F(ab)(VKK20_VHK20) or pSW 1F(ab)-

I

Hind III pstl EastEn

Ml3VHKZOPCRl

PSI

1

BamHI

\

2

Fig. 1 (A).

~

VKZBACK

(Table I)

pSWlF(ab)(VKK20-VHK20)

&imers

or SEOVKFOR

Sequencing with SEOVHFOR

-

‘2

~~

f

VK3FOR

3 Control of the expression of F(ab)K20

Tmnsfection in E. cdi JMlOl

XhoI

~

M13VKK2OF’CRl

“Hi

M.-A. POUL et al.

104

(contains human Fl VH rearranged gene)

Pst I VHIBACK I_ 7,

Pvu II

Hind III

VHIFoR

EMI BamH1

Hind 111

(“;

Pstl B&II

BamHI

e-1

M13VKPCRl

Ml3VHFlPCRl

(contains a humanized VK gene with human REI FRs and mouse CDRs)

I

I

I

Mutagenesis using

VKMUTCDRl VKIvlUTCDR2 VKMUTCDR3 (Table I)

Mutagenesis using VHMUTCDRl VHMUTCDR2 VHMUTCDR3 (Table I)

Fig. I (B).

Table 1. Ohgonucleotides used for amplification, cloning, sequencing and mutagenesis, of the V, and Vu genes described in the text Oligonucleotide use

Name

Sequence Cloning site

Amplification and cloning

Sequencing

Mutagenesisd

VK 1BACK” VK I FOR” VH 1BACKb VH 1FORb VK2BACK’ VK3FOR’

GAC ATT CAG CTG ACC CAG TCT CCA GGT AGA CTC CAG CTT GGT CCC AG GT(C/G) (A/C)A(A/G) CTG CAG(C/G)AG TC(A/T) GG TGA GGA GAC GGT GAC CGT GGT CCC TTG GCC CCA G GAC ATT GAG CTC ACC CAG TCT CCA CCG TTT GAT CTC GAG CTT GGT CCC

SEQVKFOR SEQVHFOR

GGCCTCTTCGCTATTACG AGCTGAATAGAAGAGAGAG

VKMUTCDRl VKMUTCDR2 VKMUTCDR3 VHMUTCDRl VHMUTCDRZ

CC ATC ACC TGG Aag GCa AGC caa gAC ATt aAC AAg TAt aTa GCT TGG TAC CAG CA AAG CTG ATC cgt TAC ACa tCa Aaa CTa Gag tea GGT GTG CCA AGC CC TAC TAC TGC Cta tag Tat Tat Aat ctt --- tGG ACG TTC GGC CAA G GA TAC ACC TTC ACT gaC TAc taT ATa age TGG GTG CGC CAG GAG TGG ATG GGA aGG ATt tAt ccT GGa AgT GGT aAT ACt ttc Tat aat gAG AAa TTC aAG GGC AGA GTC ACC TAT TAC TGT GCG A-- --- --- -tt tat tat ggt agt ggT GAC TAC TGG GGC

VHMUTCDR3

Pvu II Bgl II Pst I BstE II Sac I Xho I

“Amplification and cloning of V, genes in M13VKPCRl. ‘Amplification and cloning of Vu genes in M13VHPCRl and in pSWlF(ab). ‘Amplification and cloning of V, genes in pSWI F(ab). dOligonucleotides used for the mutagenesis are inverse and complementary to those indicated in the Table. The nucleotides corresponding to the CDRs of the humanized genes are underlined. Those initially existing in the VKREI/D1.3 gene in M13VKPCRl or in the VHF1 gene in M13VHPCRI are in capitals. Those changed by the mutagenesis are in small letters. Dots represent nucleotides which are deleted by mutagenesis from the matrix genes.

Humanization Hind III

Pvu II

of an anti-VLA(j

105

1) integrin mAb

BamH I

C P

VKK20

L

P

VK from M13VKK20PCRl

Hind III

Vr from Ml3HuVKK20PCRl

BamH I HUCK

Pvu II

HuVKK20

L

Hind 111

Pvu II

BclI BatnH I HuCK

pSVhyg-VKKZO-HuCK

c

Transfection in NSO cells Production of Humanized K20 Ab (Hu-K20)

Transfection in NSO cells Production of Chime& K20 Ab (Ch-K20)

Hind III

Pst I

Hind III

BstE II BamH I

pSVgpt-VHK20-HuCyl

1

Pst I

BstE II BamH I

pSVgpt-VHK20-HuCyl

HuCyl

Hind III BamH 1

~i;------i/ pSVgpt-HuCyl I Pvu I

Hind III

Pst 1

Bsa II BamH I

+-Y-k!VH from Ml3VHK20PCRl

Hind III

PstI B&II

Bat&II

-+-%&P L VH from M13HuVHK20PCRl

Fig. 1. (A) Cloning of the V, and V, rearranged genes from K20 cDNA (in Ml3VKKZOPCRl and Ml3VHKZOPCRl) and production of F(ab)KZO from pSWlF(ab)K20 transfected in E. coli JMlOl. P, promoter; L, leader; PelB, gene of a bacterial leader peptide (Hoogenboom et al., 1991).

(B) Construction of humanized K20 V, and V, genes (in Ml3HuVKK20PCRl and M 13HuVHK20PCRl). (C) Production of chimeric (Ch-K20) and humanized K20 (Hu-K20) mAbs. E, enhancer (see Materials and Methods for details). K20. The construction was checked by sequencing and used to transfect E. coli JMlOl bacteria. Transfected bacteria were grown overnight at 37°C under catabolic repression in LB medium complemented with 1 mM glucose. Then they were diluted at l/100 and grown in

LB medium-O.1 mM glucose at 37°C up to A, = 0.5, where IFTG 1 mM was added. An overnight shaking incubation was then performed at 30°C. Before collecting the supematant, cultures were stored at 4°C for 48 hr to obtain maximal diffusion of F(ab)KZO out of the

106

M.-A. POUL et al.

periplasm. Supernatant was analysed on 15% SDS-PAGE under reducing conditions. Western blot was revealed with peroxidase-conjugated anti-human ti Ab (Caltag, San Francisco, CA) or with rabbit antihuman IgGl (H chain specific) Abs (Dakopatts, Denmark) followed by a mouse peroxidase-conjugated anti-rabbit Abs (Sigma, St Louis, MO). Construction of humanized K2O V, and VH genes Ml 3VKPCRl contains a humanized V, gene which comprises FRs of the human K myeloma protein REI and grafted CDRs of D1.3 mouse mAb (Verhoeyen et al., 1988). The FRs of the V, gene were used to construct the humanized K20 V, gene. Three oligonucleotides, corresponding to the K20 V, CDRs 1, 2 or 3, respectively, were designed to replace each of the D1.3 V, CDRs by those of K20 V,. These oligonucleotides also comprised 12 additional nucleotides at the 5’ end and at least 12 nucleotides at the 3’ end, with a final C or a G, which are complementary to the immediate neighborhood of the CDR to be replaced (see Table 1). The FRs of the human Fl V, gene (EMBL accession number X 17675) were used to construct the reshaped K20 V, gene. The Fl V, gene was amplified from the M13mpl8VHFlRF vector (Milili et al., 1991) using the VHlBACK and VHlFOR primers. The PCR product was digested with Pst I and BstE I1 and cloned into M 13VHPCRl. Three oligonucleotides were designed as above to replace each of the Fl V, CDRs by those of K20 V, (Table 1). Three rounds of mutagenesis were used and done as recommended by Kundle (1985) to obtain M 13HuVKK20PCR 1 and M 13HuVHK20PCRl (Fig. 1B). K20 humanized V, or V, genes, designated as HuVKK20 and HuVHK20, were checked by sequencing with SEQVKFOR and SEQVHFOR primers, respectively (Table 1). They were cloned in pSWlF(ab) to obtain F(ab)Hu-K20 expression in E. coli JM 10 1 (same methodology as above for the production of F(ab)K20 (Fig. 1A)). Production of chimeric and humanized K20 antihod?> The Hind III-BamH I fragments carrying the K20 V, gene from M 13VKK20PCR 1 and the humanized K20 V, gene from M13HuVKK20PCR 1 were cloned into a pSVhyg expression vector (pSVhyg-HuCK) containing the human IGKC gene (HuCK) and the IGH intron enhancer (E) (described by Orlandi et al., 1989) to obtain pSVhyg-VKK20-HuCK and pSVhyg-HuVKK20-HuCK, for the production of chimeric and humanized K chains, respectively. The Hind III-BamH I fragments carrying the K20 V, gene from M 13VHK20PCR1, and the humanized K20 V, gene from M13HuVHK20PCRl were cloned into a pSVgpt expression vector (pSVgpt-HuCy 1) containing the genomic human IGHGl gene (HuCyl), and the IGH intron enhancer (described by Orlandi et al., 1989) to obtain and pSVgpt-VHK20-HuCy 1 PSVgPtHuVHKZO-HuCy 1, for the production of chimeric and humanized H chains, respectively (Fig. 1C). Kappa and H chain constructs were introduced sequentially into

NSO cells by electroporation with a Bio-Rad Gene Pulser (Bio-Rad Labs, Richmond, CA). NSO cells were washed with PBS and 10’ cells were resuspended in 0.5 ml of DMEM, mixed with 10 pg of Pvu I linearized ti chain expression vector at room temperature. Parameters of electroporation were 960 mF, 250 V, TC: 30 ms. Stably transfected cells were selected on the basis of drug resistance and antibody secretion. Briefly, selection was applied 24 hr later (0.4 g hygromycine/ 1, Sigma) and cells were grown in 24-well plates (2 x lo4 cells per well). Two weeks later, supernatant of cells resistant to hygromycine were screened for K chain secretion by ELISA. Ninety-six U-well microtitre plates (Nunc, Rockilde, Denmark) were coated for 1 hr at 37°C with goat anti-human kappa Abs (Caltag) (10 pgg/ml in PBS), then blocked with 1% (w/v) BSA in PBS for 30 min at 37°C. Fifty microliter portions of culture supernatant were allowed to react for 1 hr at 37°C. After washing with PBS, adsorbed k’ chain was quantified with goat peroxidase-conjugated anti-human kappa Abs (Caltag) as described by the manufacturer. Cells from wells giving the strongest signals were cloned by limiting dilution in selective medium. The ELISA screening was repeated, and the cell lines giving the strongest signals retained for transfection by the H chain expression vector. Pou I linearized H chain expression vector (10 pg) was transfected following the same procedure as above except that medium was complemented with 0.25 g xanthine/ 1, 0.8 mg mycophenolic acid/l (Sigma) and 0.2 g hygromycin/l for selection. For ELISA screening of the double transfectants, a similar procedure as above was used except that microtitre plates were coated with rabbit anti-human IgG (H chain specific) Abs (Dakopatts) and revelation was done with alkaline phosphatase-conjugated anti-rabbit Igs (H chain specific) Abs (Dakopatts). Supernatants were also analysed by Western blotting, with the same Abs as for F(ab) detection. After cloning, cell lines giving the strongest signals were retained for large-scale growth for chimeric (Ch-K20) and humanized (Hu-K20) mAb production, respectively, in selection medium with 5% FCS. Culture supernatant was precipitated with 50% (w/v) of ammonium sulfate. Precipitate was resuspended in PBS, desalted by gel filtration with PDlO columns (Pharmacia). and applied on an anti-human IgG (H chain specific)-Agarose column (Sigma). The column was equilibrated, charged and eluted as recommended by the manufacturer. Protein concentration of eluted fractions was assayed by Bradford microassay (Bio-Rad) and fractions containing proteins were checked on a 10% SDS-PAGE with protein standards (Amersham, U.K.) to control purity. An ultraviolet spectrum was taken to ascertain concentration. Fractions of interest were concentrated with Centricon 100 (Amicon, Danvers, MA). Immunojuorescence

staining of jixed cells

Multiwell slides (Flow Labs, Irvine, U.K.) with poly-L Lysine (MW >400,000, Sigma) in PBS, 30 min at room temperature, and deionized water. Jurkat T cells were washed

were coated at 0.5 mg/ml washed with twice in PBS

Humanization of an anti-VLA(/?l) integrin mAb and resuspended in PBS at a density of 10’ cells/ml. One drop of resuspended cells was loaded on wells and slides were incubated at 37°C in wet atmosphere for 30 min. Cells were fixed by immersion in methanol at - 20°C for 15 min, then washed with PBS. PC12 cells, graciously provided by Dr J.-B. Lazaro (CRBM, France), were fixed as described elsewhere (Girard et al., 1992). Culture supernatant or purified antibodies were applied for 1 hr at room temperature. Cells were washed and then incubated with goat FITC-anti-human IgG Abs (Jackson Immunoresearch Labs, Inc., West Grove, PA) or goat FITC-anti-mouse kappa Abs (Southern Biotechnology Associates, Inc., Birmingham, AL) diluted in PBS-3% (w/v) BSA, 30 min at 37°C. After washing in PBS, slides were examined under fluorescence optics. Binding measurement

For simple binding measurement, Jurkat cells (lO’/ml in PBS 0.1% sodium azide) were incubated for 15 min at 4°C with various concentrations of Hu-K20, Ch-K20 or irrelevant human IgGl Abs, diluted in staining medium (0.1% sodium azide in PBS), then revealed with FITCanti-human IgG Abs, 15 min at 4°C. Cells were washed three times between each step, fixed in 0.1% paraformaldehyde before analysis on a FACScan (Becton Dickinson, Mountain View, CA). Forward and right-angle scatter were set in order to exclude dead cells and debris. As a reference, Mu-K20 binding on Jurkat cells was analysed with FITC-Mu-K20. Tests of inhibition of binding of FITC-Mu-K20 or FITC-4B4 mAbs were performed by incubating cells with a competitor antibody (Mu-K20, Hu-K20, Ch-K20,4B4 or irrelevant antibody) at various concentrations after incubation with FITC-Mu-K20 mAb at a constant concentration (this concentration was chosen as the minimum concentration giving maximal saturation and determined in the first experiment) or FITC-4B4 mAb. 4B4, FITC-4B4 mAbs (mouse IgGl), and FITC-K20 were from Coulter Immunology (Hialeah, FL). T cell proliferation

To test the effect of soluble anti-CD29 mAbs, culture of T lymphocytes was performed in 96-well culture plates (Nunc), each well containing 0.5 x lo5 cells in a final volume of 0.2 ml of culture medium. Wells were coated with anti-CD3 mAb (X35, mouse IgG2a) (A. Martin, CTS, Rennes, France), 10 pg/ml in calcium- and magnesium-free PBS, by an overnight incubation at 4°C. After washing three times with PBS, cells were added and cultured in medium plus rIL-2 10 ng/ml (a gift from Glaxo Institute for Molecular Biology, Geneva, Switzerland) and anti-CD29 mAb (4B4, Mu-K20, HuK20 or Ch-K20) or irrelevant mouse IgG2a (Sigma) (lOpg/ml). Cells were incubated at 37°C in a 5% humidified atmosphere for 4 days and 1 PCi [3H]-TdR (2 Ci/mmol; CEA, Gif sur Yvette, France) was added for 18 hr more of culture. Cells were harvested using a semi-automatic cell harvester (Skatron, Lier, Norway) and thymidine incorporation was measured in a liquid scintillation counter (Beckman Instrument, Fullerton,

107

CA). To test the effect of the mAbs in a cross-linked form, after coating of X35, an additional overnight incubation at 4°C was performed with the different anti-CD29 mAbs or irrelevant mouse IgG2a (10 pg/ml) before adding cells (without rIL-2). Measurement of phosphatidic acid synthesis

Jurkat cells (5 x lo6 cells/ml) were labelled to isotopic equilibrium in the following buffer (pH 7.4, 137 mM NaCl, 2.7 mM KCl, 1 mM Na*HPO,, 25 mM glucose, 20 mM HEPES, 0.1% BSA, 1 mM CaCl, and 1 mM MgCI,) at 37°C in the presence of 1 pCi/ml of tritiated [5,6,8,9,11,12,14,1 5-3H]arachidonic acid (180 to 220 Ci/mmol) (Amersham) during 18 hr. Cells were washed twice and resuspended in PL buffer. Five hundred microliters of cells were used for each assay. Cells were activated with anti-CD3 mAb (2 pgg/ml) with or without anti-CD29 mAb (5 p g/ml). After 1,2 or 5 min of incubation at 37°C cells were centrifuged, supernatant was discarded and lipids were extracted and analysed by thin layer chromatography on LK6D Silicagel plates (Whatman, Clifton, NJ) in a solvent system composed of chloroform/methanol/acetic acid/water (75/45/12/3). Lipid spot radioactivity was measured by using a Berth01 automatic TLC linear analyser. Complement-dependent

cytotoxicity assay

CD29 positive target cells (thymocytes or Jurkat cells) were incubated at 37°C with Mu-K20, Hu-K20 or Ch-K20 (5 pg/ml). After 30 min, rabbit complement (Behring, Germany) or fresh human AB serum (as a source of human complement) was added at 37°C for 30 min. At this time, cells were stained in Trypan Blue and the ratio of dead cells to the total number of cells was evaluated. Culture medium, irrelevant human IgGl, anti-CDla D47 mAb (murine IgGl) (Gelin et al., 1986) and anti-CD29 4B4 mAb were used as controls. Measurement of C Iq binding

Jurkat cells were incubated with 5 pgg/ml of test Ab for 20 min on ice, and cells were washed in ice-cold PBS and incubated with fresh ice-cold human AB serum (d = 5) for 20 min. After washing in ice-cold PBS, the cells were incubated for 20 min with sheep FITC-anti-human Clq Abs (d = 50) (Dakopatts). Unbound anti-Clq was removed by washing cells in PBS and cells were analysed on a Becton Dickinson FACScan. RESULTS Cloning and sequencing of the If, and VH rearranged genes from K20 cDNA

Rearranged V, and V, rearranged genes from K20 cDNA were amplified by PCR and cloned into phages M13VKPCRl and M13VHPCRI (Fig. 1A). Two independent clonings of two distinct amplifications from cDNA-mRNA hybrids were done to detect possible cloning of unspecific V, and V,, and eventual mistakes of the Taq Polymerase. Cloning of the K20 rearranged

M.-A. POUL et al.

108

(A) 1

2

D

I

FRI Q

L

T

Q

S

P

25 I

S

SLSASLGGKVTITCKA GACATC~ACCCAGTCTCCATCCTCACTGTCTGCATCTCTGGGAGGCAAAGTCACCATCACTTGCAACMCA ----.pvu ~~_______) primer VKll33CK

CHRl

33

FR2 48 49 E P G KG PRLLIRY I I SQDINKYIAWYQH AOCCAAGACATTAACAAGTATATAOCTTGGTACCAACACGAGCCTGGAAAAGGTCCTAGGCTGCTCATACGTTAC 71 64 FR3 CDR2 I P S R F SGSGSGRDYSFSI TSKLESGI ACATCAAAACTAOAaTCAGGCATCCCATCAAGGTTCAGTGGAAGTGGGTCTGGGAGAGATTATTCCTTCAGCATC IATYYCLQ I SNLEPED AGCAACCTGGAGCCTGAAGATATTGCAACTTATTACTGTC 4

9oCDIW 94 YYNLWTFGGG GTTCGGTGGAGGG JK~

vlcv TKLEIKRK ACCAAGCTGGBgl ---___.

---

ACGTAAGT IIIBcl

I

_-_)

primer VKIFOR

(B) 1

FRI

QVQLQESGTELVRPGASVKLSCKAS C GGTCCAACTGCAGGAGTC 8_-----.,,, i---__?g GGACTGAGCT~GTGAGGCCTGGGGCTTCAGTTGTCGGCTTCT sac 1 primer VHlBACK FR2 4 CDRl 34 26 27 29 SWVKQRPGQGLEWIAR 4 I GYTFTDYYI I GGCTACACTTTCACTGACTACTATATAAOCTGGGTGAAACAGAGGCCTGGACAGGGACTTGAGTGGATTGCAACK: CDRZ: 54 55 52a FYNEKFKG I Y PGSGNT ATTTATCCTOOMGTOOTMTACTTTCTACAAFOAOAAATCGTCC

71

12

I KATLTAETS Pst I

FR3 S L T S E D S SNTAYMQLS TCCAACACTGCCTACATGCAGCTCAGCAGCCTGACATCTGAGGACTCTGCTGTCTATTTCTGTGC VH

CDR3 G

GGTAG

S

IIB

*ACTA~

DPL16

I TTVTVSS YIW G Q G CTACTGGGGCCAAGGGACCACGGTCACC __-_____----&tE II

JH~

GTCTCCTCAG ._---__ w

primer VHlFOR

Fig. 2. Sequences of the V, (A) and V, (B) rearranged genes from K20 cDNA. CDRs are in bold characters, primers of amplification and corresponding amino acids are in italics. Residues mentioned in the text are numbered following Kabat numbering (Kabat et al., 1991). Pvu II and Bgl II (V,), Pst I and BstE II (V,) cloning sites, as well as the internal K20 V, Sac I and K20 V, Pst I sites are underlined. The VH-D-J rearrangement in K20 occurred with (i) the deletion of two nucleotides at the 3’ end of the V, gene, four at the 5’ end of the D segment, six at the 3’ end of the D segment, and seven at the 5’ end of the J segment, respectively, and (ii) the addition of one nucleotide (T) and two (GG) at the V-D and D-J junctions, respectively.

Vu gene needed two steps because this gene contains an internal Pst I site in addition to the Pst I cloning site. Six V, and six V, clones of each independent cloning showed identical sequences designated as VHK20 and VKK20, respectively (Fig. 2). The VKK20 deduced amino acid sequence shows that the V, gene belongs to murine V,V subgroup and is joined to J, 1 (Kabat et al.. 1991). The analysis of the FR revealed no particular residues but Arg49 was found at the end of FR2, instead of the usual Tyr49 in murine V,V subgroup. The CDR3 is particularly short because of the absence of Pro95 As defined by Chothia (1987) Ll has a canonical structure of type II, L2 of type I, and L3 is atypical because of the absence of Pro95 in CDR3 (Table 2). The VHK20

sequence shows that the VH gene belongs to murine V,IIB subgroup, the D segment is DFL16 and the J, segment is J,2 (Kabat et al., 1991). There is an Ala in position 49 (at the end of FR2) instead of a usual Gly in murine V,IIB subgroup, and in position 72 (FR3) there is a Glu instead of the usual Asp. The FR3 is shorter than the usual V, FR3, as a result of Arg94 absence. The CDR3 is particularly short, with only eight amino acids. Residues at the key sites indicate that Hl canonical structure may be of type I or atypical because of the absence of Arg94. The size of the H2 loop and the nature of the residue in position 52a, which is a proline (Table 2) define the canonical structure of the H2 loop as a type II (Chothia et al., 1992). The H2 loop probably

Humanization of an anti-VLA(/_?l)integrin mAb

109

Table 2. Localization and nature of residues involved in Ll, L2, L3, Hl and H2 loop canonical structures” Canonical structure

Type of canonical structure

Gene aa position

Ll

L2

L3

Hl

H2

29 CDRl I I I

33 CDRl I I I

MuVKK20 VKREI HuVKK20

2 FRl I I I

25 CDRl A A A

MuVKK20 VKREI HuVKK20

48 FR2 I I I

64 FR3 G G G

90 CDR3 MuVKK20 VKREI HuVKK20

95 CDR3 -

: Q

P -

MuVHK20 VHF1 HuVHK20

26 FRl G G G

21 FRl Y Y Y

29 FRl F F F

34 CDRl I M I

MuVHK20 VHF1 HuVHK20

52a CDR2 P G P

54 CDR2 s N s

55 CDR2 G G G

71 FR3 A R R

71 FR3 Y F F

II II II

atypical I atypical 94 FR3 R -

I or atypical I I or atypical

II

III II

“Types of canonical structures as defined by Chothia et al. (1989, 1992). Numbering is according to Kabat et al. (1991). packs against

the residue

at site 71 (Tramontano

et al.,

1990), Ala in the case of K20.

Expression of a F(ab)K20

that recognizes CD29

Before undertaking the reshaping of VHK20 and VKK20, a fragment antibody F(ab)K20 was expressed in E. coli JM 101, in order to confirm that we indeed cloned the K20 rearranged V genes. VHK20 and VKK20 were cloned into the procaryotic expression vector pSWlF(ab) (see Materials and Methods and Fig. 1A). The resulting pSWlF(ab)K20 vector was transfected in E. coli JMlOl, secretion of F(ab)K20 was induced with IPTG. Supernatant was analysed on 15% SDS-PAGE under reducing conditions. Staining of Western blot with anti-human CK or Cy antibodies revealed, in both cases, a unique band, corresponding to the K chain or to the truncated H chain, respectively (data not shown). Supematant was then tested by immunofluorescence for the binding of CD29 on Jurkat or on PC12 fixed cells. Staining with F(ab)K20 was effective and identical with that obtained with Mu-K20 (not shown). Altogether, these data confirmed that the correct variable genes had been isolated.

Reshaping of the K20 variable genes

VKK20 and VHK20 nucleotide and deduced amino acid sequences were compared extensively with all human V, and Vu genes of Genbank and EMBL data bases and analysed with Kabat compendium (Kabat et al., 1991). For VKK20 (murine V,V subgroup), the best homology was found with the human V, I subgroup, and the protein REI V, FRs, present in phage Ml3VKPCR1, were good potential candidates for the construction of HuVKK20. Indeed, VKREI is a representative of human V,I subgroup, and canonical structures of the CDRs loops of VKREI are identical to those of VKKZO (Table 2). We designed a humanized gene, HuVKK20, with the three CDRs and Arg49 coming from VKK20 and the other FR residues from VKREI (Fig. 3A). For VHKZO, the best homology was found with the human Vu1 subgroup, VHF1 (EMBL accession number Xl 7675) was chosen for the construction of HuVHK20 because it is a representative of this subgroup (no extraneous residues are found at any site) and it has a similar Hl loop as VHKZO, except for residue 94 (absent in VHKZO, and Arg in VHFl). VHF1 was not entirely suitable, even if the H2 loop has the same size as that of VHKZO, because the residue at

M.-A. POUL

110

et al.

(A) MuVKK20 VKREI HuVKK20

FR2 CDRl FRl D~QLTQSPSSLSASLGGKYT~T~KASQDINKYIA~EPGK&'RL . . . . . . . . . . . . ..V.DR.....Q.....I...N...QK...A.K. . . . . . . . . . . . . ..V.DR...................QK...A.K.

MuVKK20 VKREI HuVKK20

49 CDR2 FR3 LIRYTSKLESG~PSRFSGSGSGRDXS~S~SN~EPE~IA~LQYY ..YJZA.N.QA.V..........T.FT.T..S.Q.........Q..Q . . . . . . . . . ..V..........T.FT.T..S.Q.............

MuVKK20 VKREI HuVKK20

CDR3 NL-WTEGGaKLEIKRK S.PY.. .Q.._VV.... . . . . . ..Q...VV....

(B) MuVHK20 VHF1 HuVHK20

FRl CDRl [email protected]&QRPGQG~E ... ..Q....VKK......V..........L.AMH..R.A ... ..Q....VKK......V.................R.A

MuVHK2 VHF1 HuVHK20

49 FR3 CDR2 ~IYPGSGNTPYNEWKG~T~T&E~SSNTAYMQLSS~TSEjJSA .MGW.NG.N.E.KSSQ..Q.RV.I.RD..AS.V..E....R...T. .MG.................RV.I.RD..AS.V..E....R...T.

MuVHK20 VHF1 HuVKK20

VYFCA-I --YYGSG-DYWGOGTTVTVSS I.Y..RDRWQPWYF.T........... I.Y.........................

FR2 ...... ......

7172

93

CDR3

Fig. 3. Comparison of the amino acid sequences of (A) murine VKK20 (MuVKK20), human VKREI human VHF1 and and humanized VKK20 (HuVKK20), (B) murine VHKZO (MuVHK20), humanized VHK20 (HuVHK20). The dots represent amino acids that are identical to those of MuVKK20 (A) or MuVHK20 (B). Packing (non-solvent exposed) residues, defined by Padlan (1990), are underlined. CDRs are in bold characters.

71 is Arg, whereas it is Ala in VHK20 (Table 2). It is the size of the residue at position 71 which mainly determines the position of the H2 loop relative to the FRs (Tramontano et al., 1990). However, no human V, I gene was found with, at the same time, a Hl loop of type I, a H2 loop of type II and Ala at position 71. The residue Arg94 was deleted in HuVHK20 construction since its position, near the CDR3, could significantly affect the Ag binding. In contrast, Gly49, Arg71 and Asp72 in VHF1 (Ala49, Ala71 and Glu72 are found in VHK20) were conserved because their substitution might enhance the immunogenicity of the humanized antibody. VHF1 gene in phage Ml 3mp18y Fl (kindly provided by C. Schiff) was sequenced completely. The sequence was identical to that published (Milili et al., 1991), with the exception of three nucleotides in the CDRl (GCT AE, instead of CCT AAT) that introduce two changes at positions 33-34 in the predicted amino acid sequence (Ala Met instead of Pro Asn), but with no implications for the construction of HuVHK20. We designed a HuVHK20 gene with CDRs coming from VHK20 and FR residues from VHF1 (but with Arg94 deleted) (Fig. 3B). Mutagenic oligonucleotides (Table 1) position

were designed as described in Materials and Methods and was mutagenesis performed to obtain M 13HuVKK20PCR 1 and M 13HuVHK20PCR 1 phages. The K20 humanized genes, HuVKK20 and HuVHK20, were checked by sequencing and cloned in pSW 1F(ab) to obtain F(ab)Hu-K20 expression in E. coli JM 101. Culture supernatants were tested for immunofluorescence staining of Jurkat and PC12 cells (not shown). Staining was positive and identical to that obtained with Mu-K20, indicating that reshaping of the V regions of K20 had not dramatically modified the binding to the CD29. Production of chimeric and humanized K20 antibodies The murine K20 V, and V, genes from M 13VKK20PCR 1 and M 13VHK20PCR 1, respectively, and the humanized K20 V, and V, genes from M 13HuVKK20PCRl and M 13HuVHK20PRC 1, respectively, were then cloned in eucaryotic expression vectors containing human C, or C;., genes in order to produce the chimeric (Ch-K20) and the humanized (Hu-K20) mAbs (Materials and Methods and Fig. 1C). Stable NSO transfectants were generated. Kappa chain

Humanization

of an anti-VLA( fi 1) integrin mAb

expression vectors were first transfected and clones with the best yield (3 pg/ml of K chain secreted in culture medium as detected by ELISA) were transfected with H chain expression vector. The highest producing clones yielded 5 vg/ml of mAb secreted in culture medium. Electrophoresis on a 10% SDS-PAGE under reducing conditions of the purified mAbs revealed two bands at 27 kD and 52 kD for the K chain and the H chain, respectively and confirmed correct purification (Fig. 4A). We obtained 2mg of purified antibody per liter of culture. Binding properties of Hu-K20

and Ch-K20

The ability of the chimeric (Ch-K20) and humanized (Hu-K20) K20 mAbs to bind the CD29+ Jurkat cell line

111

was analysed by immunofluorescence staining (Fig. 4B). Hu-K20 stained with a lower efficacy than Ch-K20. The titration curves of antibodies were fitted to a sigmoid curve and the concentration to achieve 50% of saturation of MFI was determined to be 0.5 pg/ml for Ch-K20, and 1.2 lug/ml for Hu-K20. Thus, the avidity of Hu-K20 is only slightly reduced since the concentration required for Hu-K20 to give the 50% of binding is only 2.5 times more than that of Ch-K20. In competition experiments, Hu-K20 and Ch-K20 were shown to reduce the binding of FITC-Mu-K20 as well as Mu-K20 itself, for identical concentrations, while 4B4 and irrelevant human IgG1 were ineffective (not shown). On the contrary, none of the K20 Abs were able to inhibit the binding of FITC-4B4 (not shown). 4B4 is an anti-CD29

A kD

M

a

b

c

d

-

Ch-K2 I

Fig. 4. Characterization of the Ch-K20 and Hu-K20 mAbs. (A) 10% SDS-PAGE of purified Ch-K20 and Hu-K20 Abs. The Mu-K20 (lane a), Ch-K20 (lane b), Hu-K20 (lane c) mAbs and human IgGl (lane d) were reduced and electrophoresed with protein standards (M). The position of heavy (H) and light (L) chains are indicated by arrows. (B) Fluorescence of CD29+ cells (Jurkat) stained with Mu-K20, Ch-K20 or Hu-K20 mAbs. Mu-K20 was coupled with FITC. Hu-K20 and Ch-K20 binding was revealed with FITC-anti-human IgG Abs. Negative control (irrelevant human IgGl) gave no staining (not shown). Results are expressed as a % relative to maximal MFI.

M.-A. POUL et al.

112

mAb that recognizes a different epitope than K20 (Takada and Puzon, 1993). Altogether, these data suggest that Hu-K20 and Ch-K20 recognize the same epitope on CD29 as Mu-K20.

(10 yg/ml) and rIL-2 (10 ng/ml) (Fig. 5A). For an identical concentration (10 pgg/ml), soluble Hu-K20 and Ch-K20 inhibited T cell proliferation induced by antiCD3 mAb and rIL-2 at the same level as Mu-K20, while irrelevant mouse IgG2a did not. Cross-linked Hu-K20 and Ch-K20 mAbs both reproduced the enhancing effect of Mu-K20 and 4B4 on T cell proliferation (Fig. 5B). Note that cross-linked anti-CD3 mAb alone induced a weak proliferation compared to the combination of cross-linked anti-CD3 and anti-CD29 (K20,4B4) mAbs.

Effect of Hu-K20 and Ch -K20 on T lymphocyte prolifer ation

Once these experiments revealed positive binding of recombinant antibodies, we further investigated whether they would reproduce functional in vitro effects of K20 on T cells. Mu-K20 mAb was shown to strongly inhibit T lymphocyte proliferation when present in a soluble form (Groux et al., 1989) while in a cross-linked form, it was shown to have a comitogenic effect with anti-CD3 mAb on T lymphocytes (Yamada et al., 1991). An anti-proliferative effect of soluble Hu-K20 and Ch-K20 was observed when we tested their effect on purified T lymphocytes activated with cross-linked anti-CD3 mAb

Inhibitory eflect of Hu-K20 and Ch-K20 on phosphatidic acid level on activated Jurkat cells

Soluble Mu-K20 was shown to reduce PA level in Jurkat and CD4+ T cells stimulated via CD3 (Ticchioni et al., 1993). In order to investigate whether Hu-K20 was able to produce the same effect at identical concentrations, phospholipids of Jurkat cells were

A

cross-linked antiCD3 X35 + rIL-2 soluble effector antibody

+

+ IgG2a

irr

+

+

Mu-K20

Hu-K20

+

+

Ch-K20

4B4

60000

cross-lied

-

anti-CD3 X35 cross-linked effector mAb

-

+

+

+

IgG2a irr Mu-K20 Fig. 5 (A and B).

+

+

+

HwK20

Ch-K20

4B4

Humanization

-20

! 0

1

of an anti-VLA(/?l)

integrin mAb

113

I 2

3

4

5

6

time after addition of soluble effector antibodies (min)

soluble anti-CD3 X35 soluble

+

+

Mu-K20

f

Hu-K20

+

Ch-K20

effctor antibody Fig. 5. Functional properties of the Hu-K20 and Ch-K20 mAbs. (A) Inhibitory effect of soluble Hu-K20 and Ch-K20 mAbs on proliferation of purified T lymphocytes. Lymphocytes were stimulated for 4 days with cross-linked anti-CD3 X35 mAb (10 pg/ml) and rIL-2 (10 ng/ml) in the presence of soluble Mu-K20, Hu-K20, Ch-K20 mAbs, another anti-CD29 (4B4) mAb or an irrelevant mouse IgG2a (10 pg/ml). (B) Activating effect of cross-linked Hu-K20 and Ch-K20 mAbs on proliferation of purified T lymphocytes. Lymphocytes were stimulated with cross-linked anti-CD3 mAb X35 (10 pg/ml) and cross-linked Mu-K20, Hu-K20, Ch-K20, 4B4 mAbs or irrelevant mouse IgG2a (10 pg/ml). In (A) and (B) proliferation was quantified at day 4 by measurement of [)H]TdR incorporation. (C) Inhibitory effect of Hu-K20 mAb on phosphatidic acid (PA) level in Jurkat cells activated oiu CD3. Jurkat cells were radiolabelled to isotopic equilibrium with tritiated arachidonic acid, and activated with anti-CD3 mAb X35, Hu-K20 or X35 + Hu-K20. The level of PA was measured at various time intervals between 0 and 5 min. Results are expressed as a percentage of variation relative to unactivated control cells. (D) Comparison of the inhibitory effect of the Mu-K20, Hu-K20 and Ch-K20 on PA level on Jurkat cells activated via CD3. The PA level was measured 1 and 2 min (left and right column, respectively) after addition of the effector antibodies. Results are expressed as a percentage of variation relative to unactivated control.

labeled to isotopic equilibrium

acid. PA level was measured addition

of effecters

(Fig.

with tritiated arachidonic as a function of time after 5C). It was dramatically

reduced when stimulation was done with anti-CD3 additioned with Hu-K20 compared with anti-CD3 alone. Identical results to Mu-K20 were observed with both Hu-K20 and Ch-K20 (Fig. 5D).

Complement-dependent assays

cytotoxicity

and C lq binding

In a standard toxicity assay with rabbit serum, as well as with fresh human serum, Hu-K20 and Ch-K20 (human IgGl), as well as Mu-K20 (mouse IgGZa) or 4B4 (mouse IgGl) mAbs, did not mediate CDC on thymocytes or on Jurkat cells while the positive control

M.-A. POUL et al.

114

anti-CDla (mouse IgGl) mAb D47 did (data not shown). In a Clq binding experiment, all mAbs did not bind or bound very weakly the C 1q, while anti-CD 1a did so strongly (not shown). DISCUSSION We successfully restructured an anti-CD29 mAb K20 into a humanized mAb able to reproduce a range of K20 functional properties, namely, specific binding of CD29, inhibition of T cell proliferation in a soluble form, activation of T cell proliferation in a cross-linked form, and inhibition of elevation of second messenger PA induced during T cell activation uiu CD3. Hu-K20 is ineffective in CDC on thymocytes and on Jurkat cells, even if human IgGl isotype is supposed to be able to support that effector function (Bruggemann et al., 1987; Jefferis, 1990) and that CDC was shown to be positive with humanized CAMPATH-I (human IgGl), the first mAb humanized used for a therapeutic purpose (Riechmann et al., 1988). However, Clq binding of Jurkat cells incubated with either Ch-K20, Hu-K20, Mu-K20 or 4B4 anti-CD29 mAbs was ineffective. It has been proposed that the localization and the amount of Ag on the membrane should be a parameter of the efficiency of CDC on a given cell type (Waldmann, 1989). In a CDC experiment, a humanized anti-CD18 mAb did not mediate CDC and did not bind Clq, as well as its rat counterpart (IgG2b) (Sims rt al., 1993). We propose that the /I 1 subunit of integrins may not have an adequate distribution of expression to mediate CDC. Humanized K20 mAb avidity for CD29 was only slightly decreased compared to that of the chimeric K20 mAb. Its specificity was conserved as (1) it recognizes the same epitope on CD29; and (2) Mu-K20, Ch-K20 and HuK20 were colocalized and exhibited equivalent staining and intensity on Jurkat or PC1 2 cells. This demonstrates the feasibility of humanization on the sole basis of primary amino acid sequence of V domains of the original murine mAb. To conserve the functional Ag binding site, amino acids of the CDRs and those in the immediate neighborhood of the CDRs have to be conserved in the restructured mAb, as well as key amino acids responsible for the canonical structures of the loops. Moreover, “unusual” residues need also to be conserved because they might affect the conformation of the binding site. Finally, the residues predicted to be involved in the interdomain contact, whose positions are conserved between species (Padlan, 1991), have to be retained. To reduce the immunogenicity of the murine V regions, expected solvent exposed residues (which can be approximated by their individual fractional solvent accessibility value (Padlan, 1990)) have to be replaced by typical residues of the more homologous human subgroup, whose FR domains are chosen for the humanization. Human sequences with the highest degree of identity were examined for the above criteria and specially for the conservation of canonical structure of the loops. In the case of K20 V regions, we found human

V genes VKREI and VHF1 with 72% and 61% of identity with MuVKK20 and MuVHK20, respectively. Since no crystal structure data or customized molecular modeling were available for these V genes, we followed a strategy based on the analysis of the primary amino acid sequence. We identified residues involved in canonical structures of the CDRs loops (Table 2). These residues are all packing (non-solvent exposed) residues, excepted Ile2 in Ll Loop (whose nature is imposed by the cloning method of K20 V,) and Gly26 in Hl loop (which is therefore totally conserved in both human and mouse V, genes). We did not need to graft all packing residues (as recommended by Singer (Singer et al., 1993)) to conserve a functional Ag binding site in the humanized K20 mAb. HuVKK20 and HuVHK20 exhibit only 85% and 74% packing-residue identity with MuVKK20 and MuVHK20, respectively, but share identical CDRs and key amino acids responsible for the canonical structures for the CDR loops. We propose that this strategy is both suitable for the conservation of avidity and optimal for potential reduction of immunogenicity of a humanized K20 Ab. Indeed, there is a high percentage of identity between the humanized K20 V regions and the human V regions chosen for the humanization (87% between the V, regions and 79% between the V, regions) and 99% of identity between the corresponding FRs (from HuVKK20 and VKREI, and VHK20 and VHFl, respectively). We substituted only one residue in VKREI FR, and deleted one in VHF1 FR, for the construction of Hu-K20. Without structural data, no humanization can be exactly predicted without a significant risk of loss of avidity. For this reason, we first produced humanized F(ab)K20 in an E. coli expression system, which is faster than production of total Ab in myeloma cells, to validate the choice of human FRs. This rapid expression allowed us to determine that our choice of human FRs was correct for the conservation of the binding of CD29. The detection of a high degree of identity between human and mouse FRs will become easier because more human V genes are sequenced. It can be seen that in general, best interspecies identity is found between V, domains, which is consistent with the fact that the V, domain, which is more variable, is supposed to support specificity of the binding of the Ag in a more significant way than the V, domain (Kabat and Wu, 1991). It has been shown that some mouse V regions share identical FRs with human V regions (Wu and Kabat, 1991). Moreover, mouse and human V genes have a limited set of identical canonical structures (Chothia and Lesk, 1987) and residues involved in interdomain contact are conserved in both species (Padlan, 1991). As a consequence, successful humanization should not require human V, and V, FRs coming from a single Ab, as conformation of V, and V, domains in the binding site are independent or only depend on a few conserved residues. This is corroborated by the fact that the conformation of the Ag binding site is not affected by changing the FRs of the parental mAb into FRs sharing the same canonical loops.

Humanization of an [email protected] 1) integrin mAb The characterization of the antibody response to some humanized mAbs showed that it was exclusively antiidiotypic (anti-CDRs), as antiglobulins were completely neutralized by both original and humanized mAbs (Hakimi et al., 1991; Singer et al., 1993). Nevertheless, little data are available concerning immunogenicity of humanized Abs compared to that of chimeric ones. Comparison of immunogenicity of chimeric and humanized K20 in the human, which is our next objective, should give interesting information. Hu-K20 will join the family of humanized monoclonal antibodies for immunotherapy. Some of them can potentially inhibit in tci~o cell/cell or cell/extracellular matrix interactions like anti-CD18 mAbs (Sims et al., 1993; Singer et al., 1993). Others, like K20, directly inhibit T cell activation and proliferation like anti-CD3 (Woodle er al., 1992), anti-CD4 (Gorman et al., 1991), anti-IL2R (Queen et al., 1989) or CAMPATH- (Riechmann et al., 1988) mAbs. K20 does not enhance or inhibit the binding of known ligands of VLA on T cells but it might interfere with a region critical for signal transduction through /I1 integrins, within residues 426-587, a cysteine-rich region (Takada and Puzon, 1993). An additional hypothesis is that K20 could mimic a natural immunosuppressor ligand of /I1 (Groux et al., 1989). These properties indicate that K20 is a potentially useful agent for therapeutic immunosuppression. Acknowledgements-We are very grateful to C. Pelassy and C. Aussel for phospholipid measurements, and P. Dariavach for helpful discussions. We thank Greg Winter for the M13VKPCRl and M13VHPCRl phages, the eucaryotic plasmids for expression of the recombinant mAbs and the NSO cell line, S. Ward for the pSWlF(ab) plasmid, C. Schiff for the M13mp18yFl phage, J.-B. Lazaro for the PC12 cells. This work was supported by funds from the Centre National de la Recherche Scientifique, the Ministere de la Recherche et de 1’Enseignement Superieur, the Universitt Montpellier II and the Association pour la Recherche sur le Cancer. REFERENCES Bouliane G. L., Hozumi N. and Shulman Production of a functional chimaeric antibody. Nature 312, 643-646.

M. J. (1984) mouse/human

Bruggemann M., Williams G. T., Bindon C. I., Clark M. R., Walker M. R., Jefferis R., Waldmann H. and Neuberger M. S. (1987) Comparison of the effector functions of human immunoglobulins using a matched set of chimeric antibodies. J. exp. Med. 166, 1351-1361. Bruggemann M., Winter G., Waldmann H. and Neuberger M. S. (1989) The immunogenicity of chimeric antibodies. j. exp. Med. 170, 2153-2157.

Chothia C. and Lesk A. M. (1987) Canonical structures for the hypervariable regions of immunoglobulins. J. mofec. Biof. 1%,901-917. Chothia C., Lesk A. M., Gherardi E., Tomlinson I. M., Walter G., Marks J. D., Llewelyn M. B. and Winter G. (1992) Structural repertoire of the human VH segments. J. molec. Biol. 227, 799-817. Chothia C., Lesk A. M., Tramontano A., Levitt M., Smith G. S., Air G., Sheriff S., Padlan E. A., Davies D., Tulip W. R., MlMM 3*,*-ll

115

Colman P. M., Spinelli S., Alzari P. M. and Poljak R. J. (1989) Conformations of immunoglobulin hypervariable regions. Nature 342, 877-883.

Damle N. K. and Aruffo A. (1991) Vascular cell adhesion molecule 1 induces T-cell antigen reception-dependent activation of CD4 +T lymphocytes. Proc. natn. Acad. Sci. U.S.A. 88, 6403-6407. Davis L. S., Oppenheimer M. N., Bednarczyk J. L., McIntyre B. W. and Lipsky P. E. (1990) Fibronectin promotes proliferation of naive and memory T cells by signaling through both the VLA-4 and VLA-5 integrin molecules. J. Immun. 145, 785-793. Elites M. J., Osbom L., Takada Y., Crouse C., Luhowskyj S., Hemler M. E. and Lobb R. R. (1990) VCAM-I on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA+fibronectin binding site. Cell 60, 577-584. Foote J. and Winter G. (1992) Antibody framework residues affecting the conformation of the hypervariable loops. J. molec. Biol. 224, 487-499. Gehn C. L., Boumsel L. and Bernard A. (1986) Control of cell proliferation within the human thymus. A very limited thymocyte sub-population generates a suppressive activity. Eur. J. Immun. 16, 1209-1276. Girard F., Strausfeld U., Cavadore J. C., Russell P. R., Fernandez A. and Lamb N. J. C. (1992) cdc25 is a nuclear protein expressed constitutively throughout the cell cycle in nontransfotmed mammalian cells. J. Cell Biof. 118,785-794. Got-man S. D., Clark M. R., Routledge E. G., Cobbold S. P. and Waldmann H. (1991) Reshaping a therapeutic CD4 antibody. Proc. natn. Acad. Sci. U.S.A. 88, 4181-4185. Groux H., Huet S., Valentin H., Pham D. and Bernard A. (1989) Suppressor effects and cyclic AMP accumulation by the CD29 molecule of CD4+ lymphocytes. Nature 339, 152-154. Hakimi J., Chizzonite R., Luke D. R., Familletti P. C., Pilson R. S., Weber D. V., Spence C., Mondini L. J., Tsien W., Levin J. L., Gallati V. H., Kom L., Waldmann T. A., Queen C. and Benjamin W. R. (1991) Reduced immunogenicity and improved pharmacokinetics of humanized anti-Tat in cynomolgus monkeys. J. Immun. 174, 1352-1359. Hemler M. E. (1990) VLA proteins in the integrin family: structures, functions, and their role on leukocytes. A. Rev. Immun. 8, 365-400. Hoogenboom R. H., Griffiths A. D., Johnson K. S., Chiswell D. J., Hudson P. and Winter G. (1991) Multi-subunit proteins on the surface of filamentous phage: methodologies for displaying antibody (Fab) heavy and light chains. Nucleic Act& Res. 19, 4133-4137. Huet S., Wakasugi H., Strekers G., Gilmour J., Boumsell L. and Bernard A. (1986) T cell activation via CD2 T, gp50: the role of accessory cells in activation resting T cells via CD2. J. Immun. 137, 1420-1428. Hynes R. Q. (1987) Integrin/ a family of cell surface receptors. Ceil 48, 549-554. Jefferis R. (1990) Structure-function relationships of IgG subclasses. In The Human IgG Subclasses: Molecular Analysis of Structure, Function and Regulation (Edited by Shakib F.), p. 98. Pergamon Press, Oxford. Jones P. T., Dear P. H., Foote J., Neuberger M. S. and Winter G. (1986) Replacing the complementarity-determining regions in a human antibody with those from a mouse. Nature 321, 522-525. Kabat E. A. and Wu T. T. (1991) Identical V region amino acid sequences and segments of sequences in antibodies of

116

M.-A. POUL

different specificities. Relative contribution of VH and VL genes, minigenes, and complementaity-determining regions to binding of antibody-combining sites. J. Immun. 174, 1709-1719. Kabat E. A., Wu T. T., Perry H. M., Gottesman K. S. and Foeller C. (1991) Sequences of Proteins of Immunological Interest, US Dept of Health and Human Services, Public Health Services, National Institutes of Health. Bethesda, MD. Kundle T. A. (1985) Rapid and efficient site-specific mutagenesis without phenotype selection. Proc. natn. Acad. Sci. U.S.A. 82, 488-493. Levy R. and Miller R. A. (1983) Biological and clinical implications of lymphocytes hybridomas: tumor therapy with monoclonal antibodies. A. Rev. Med. 34, 107. LoBuglio A. F., Wheeler R. H., Trang J., Haynes A., Rogers K., Harvey E. B., Sun L., Ghrayeb J. and Khazaeh M. B. (1989) Mouse/human chimeric monoclonal antibody in man: kinetics and immune response. Proc. natn. Acad. Sci. U.S.A. 86, 4220-4224. Matsuyama T., Yamada A., Kay J., Yamada K. M., Akiyama S. K., Schlossman S. F. and Morimoto C. (1989) Activation of CD4+ cells by fibronectin and anti-CD3 antibody. A synergistic effect mediated by the VLA-5 fibronectin receptor complex. J. exp. Med. 170, 1133-l 148. Milih M., Fougereau M., Guglielmi P. and Schiff C. (1991) Early occurrence of immunoglobulin isotype switching in human fetal liver. Molec. Immun. 28, 753-761. Miller R. A., Oseroff A. R., Stratte P. T. and Levy R. (1983) Monoclonal antibody therapeutic trials in seven patients with T-cell lymphoma. Blood 62, 988-988. Neuberger M. S., Williams G. T., Mitchel E. B., Jouhal S. S., Flanagan J. G. and Rabbitts T. H. (1985) A hapten specific chimaeric IgE antibody with human physiological effector function. Nature 314, 268-270. Nojima Y., Humphries M. J., Mould A. P., Komoriya A.. Yamada K. M., Schlossman S. F. and Morimoto C. (1990) VLA4 mediates CD3-dependent CD4+ T cell activation via the CSl alternatively spliced doman of fibronectin. J. e.rp. Med. 172, 1185-l 192. Orlandi R., Gussow D. H., Jones P. T. and Winter G. (1989) Cloning immunoglobulin variable domains for expression by the polymerase chain reaction. Proc. natn. Acad. Sci. U.S. A. 86, 3833-3837. Padlan E. A. (1990) On the nature of antibody combining sites: unusual structural features that may confer on these sites an enhanced capacity for binding ligands. Proteins 7, 112-124. Padlan E. A. (1991) A possible procedure for reducing the immunogenicity of antibody variable domains while preserving their ligand-binding properties. Molec. Immun. 28, 489-498. Queen C., Schneider W. P., Selick H. E., Payne P. W., Landolfi N. F., Duncan J. F., Avdalovic N. M., Levitt M.. Junghans R. P. and Waldmann T. A. (1989) A humanized antibody that binds to the interleukin 2 receptor. Proc. natn. Acad. Sci. U.S.A. 86, 10029-10033. Riechmann L., Clark M., Waldmann H. and Winter G. (1988) Reshaping human antibodies for therapy. Nature 332, 323-327. Ruoslahti E. and Pierschbacher M. D. (1987) New perspectives in cell adhesion: RGD and integrins. Science 238, 491-497.

et al.

Sambrook J., Fritsch E. F. and Maniatis T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, NY. Sanders M. E., Makgoba W. M., Sharrow S. O., Stephany D., Springer T. A., Young H. A. and Shaw S. (1988) Human memory T lymphocytes express increased levels of three cell adhesion molecules (LFA-3, CD2, and LFA-1) and three other molecules (YCHLl, CDw29, and Pgp-I) and have enhanced IFN-7 production. J. Immun. 140, 1401-1407. Shimizu Y., Van S. G., Horgan K. J. and Shaw S. (1990a) Costimulation of proliferative responses of resting CD4 + T cells by the interaction of VLA-4 and VLA-5 with fibronectin or VLA-6 with laminin. J. Immun. 145, 59-67. Shimizu Y., Van S. G., Horgan K. J. and Shaw S. (19906) Regulated expression and binding of three VLA (beta 1) integrin receptors on T cells. Nature 345, 250-253. Sims M. J., Hassal D. G., Brett S., Rawan W., Lockyer M. J., Angel A., Lewis A. P., Hale G., Waldmann H. and Crowe J. S. (1993) A humanized CD18 antibody can block function without cell destruction. J. Immun. 151, 2296-2308. Singer I. I., Kawka D. W., DeMartino J. A., Daugherty B. L., Elliston K. O., Alves K., Bush B. L., Cameron P. M., Cuca G. C. and Davies P.. Forrest M. J., Kazakis D. M., Law M. F.. Lenny A. B., MacIntyre D. E., Meurer R., Padlan E. A.. Pandya S., Schmidt J. A., Seamans T. C., Scott S., Silberklang M.. Williamson A. R. and Mark G. E. (1993) Optimal humanization of 1B4, an anti-CD18 murine monoclonal antibody, is achieved by correct choice of human V-region framework sequences. J. Immun. 150, 28442857. Takada Y. and Puzon W. (1993) Identification of a regulatory region of integrin /I 1 subunit using activating and inhibiting antibodies. J. biol. Chem. 268, 17597-17601. Ticchioni M., Aussel C., Breittmayer J. P., Manie S., Pelassy C. and Bernard A. (1993) Suppressive effect of T cell proliferation via the CD29 molecule. The CD29 mAb 1 “K20” decreases diacylglycerol and phosphatidic acid levels in activated T cells. J. Immun. 151, 119-127. Trdmontano A., Chothia C. and Lesk A. M. (1990) Framework residue 71 is a major determinant of the position and conformation of the second hypervariable region in the VH domains of immunoglobulins. J. molec. Biol. 215, 175-182. Verhoeyen M., Milstein C. and Winter G. (1988) Reshaping human antibodies: grafting an antilysozyme activity. Science 239, 1534-l 536. Waldmann H. (1989) Manipulation of T-cell responses with monoclonal antibodies. A. Rev. Immun. 7, 407444. Woodle E. S., Thistlethwaite J. R., Jolliffe L. K., Zivin R. A., Collins A., Adair J. R., Bodmer M., Athwal D., Alegre M. L. and Bluestone J. A. (1992) Humanized 0KT3 antibodies: successful transfer of immune modulating properties and idiotype expression. J. Immun. 148, 2756-2763. Wu T. T. and Kabat E. A. (1991) Possible use of similar framework region amino acid sequences between human and mouse immunoglobulins for humanizing mouse antibodies. Molec. Immun. 29, 1141-l 146. Yamada A., Nojima Y., Sugita K., Dang N. H., Schlossman S. F. and Morimoto C. (1991) Cross-linking of VLA/CD29 molecule has a co-mitogenic effect with anti-CD3 on CD4 cell activation in serum-free culture system. Eur. J. Immun. 21, 319-325.