Interaction of a photosensitizer methylene blue with various structural forms (cruciform, bulge duplex and hairpin) of designed DNA sequences

Interaction of a photosensitizer methylene blue with various structural forms (cruciform, bulge duplex and hairpin) of designed DNA sequences

Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716 Contents lists available at ScienceDirect Spectrochimica Acta ...

2MB Sizes 0 Downloads 2 Views

Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

Contents lists available at ScienceDirect

Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy journal homepage: www.elsevier.com/locate/saa

Interaction of a photosensitizer methylene blue with various structural forms (cruciform, bulge duplex and hairpin) of designed DNA sequences Mohan Kumar a,c, Mahima Kaushik b, Shrikant Kukreti a,⁎ a b c

Department of Chemistry, University of Delhi, Delhi, India Nano-bioconjugate Chemistry Lab, Cluster Innovation Centre, University of Delhi, Delhi, India Department of Chemistry, Shri Varshney College, Aligarh, Uttar Pradesh, India

a r t i c l e

i n f o

Article history: Received 26 May 2020 Received in revised form 3 July 2020 Accepted 4 July 2020 Available online 21 July 2020 Keywords: Cruciform DNA Bulge duplex DNA hairpin Inverted repeats Methylene blue Circular dichroism of DNA

a b s t r a c t Functionally important, local structural transitions in DNA generate various alternative conformations. Cruciform is one of such alternative DNA structures, usually targeted in genomes by various proteins. Symmetry elements in sequence as inverted repeats are the key factor for cruciform formation, facilitated by the presence of the AT-rich regions. Here, we used biophysical and biochemical techniques such as Gel electrophoresis, Circular dichroism (CD), and UV-thermal melting analysis to explore the structural status of the designed DNA sequences, which had potential to form cruciform structures under physiological conditions. The gel electrophoresis analysis revealed that the designed 53-mer DNA oligonucleotide sequence CR forms an intermolecular bulge duplex with flanking ends, while another sequence CRC adopts an intramolecular hairpin structure with flanking ends. Their equimolar complex (CRCRC) bestowed much-retarded migration due to the formation of a quite intriguing cruciform structure. CD studies confirmed that all the alternative structures (cruciform, bulge duplex, and hairpin with flanking ends) exhibit characteristics of B-DNA type conformation. A triphasic UV-thermal melting curve displayed by the complex formed by the equimolar ratio (CRCRC) is also suggestive of the formation of the cruciform structure. The interaction studies of CR, CRC, and their equimolar complex (1:1) with a photosensitizer methylene blue (MB) indicated that MB could not stabilize the discrete structures formed by CR and CRC sequences, however, the cruciform structure showed a quite significant increment in the melting temperature. Such studies facilitate our understanding of various secondary structures possibly present inside the cell and their interactions with drug/dye molecules. © 2020 Published by Elsevier B.V.

1. Introduction DNA is recognized as the storehouse of genetic information of all living organisms having distinct sequences; crucial for encoding proteins [1]. In addition to the canonical B-DNA, many alternative/unusual inter- and intramolecular conformations of DNA have been proposed, including cruciform, slipped mispaired structures, triplex, and quadruplex DNA, etc. [2,3]. The sequences, which consist of unsymmetrical inverted repeats, are usually known as quasipalindrome or imperfect palindrome [4]. Inverted repeats or palindromic sequences are prone to transform into recognized secondary or tertiary structures, such as hairpins, internal loops, bulges, and cruciform structures (Fig. 1) [5–7]. Generally, inverted repeats are found at the origin of DNA replication or near putative control regions of genes [8]. These unusual DNA structures play important biological roles by offering binding sites for various proteins and help in the regulation of many cellular processes. The interaction of hairpin with stem-loop binding protein helps to ⁎ Corresponding author at: Department of Chemistry, University of Delhi, Delhi, India. E-mail address: [email protected] (S. Kukreti).

https://doi.org/10.1016/j.saa.2020.118716 1386-1425/© 2020 Published by Elsevier B.V.

regulate the phosphorylation and prolyl isomerization process [9]. The palindromic stretch of one of the strands in double-stranded DNA induces a hairpin structure containing AT-rich loops, which are the specific targets for origin binding protein [10]. Cruciform is one of the alternative structures of DNA, which was proposed by Platt in 1955 and later by Gierer in 1966 [11,12]. The cruciform origin firmly relies on the base sequence and the presence of inverted repeats [13]. The formation of the cruciform structure takes place when the interstrand base pairing of DNA having inverted repeat gets transformed into intrastrand base pairs. Two different mechanisms were put forward for the formation of the cruciform structure, which vary in salt concentration, activation energy, and temperature [14]. Cruciform DNA plays a decisive role in many biological processes like gene regulation, DNA recombination, repair, and replication [15–17]. Cruciform structures are not thermodynamically favored in linear DNA, so these can be induced by providing heat or DNA supercoiling [18,19]. It is well reported that inverted repeat sequences are usually found in the promoter regions and site of replication of DNA, which lead to the possibility of cruciform structure formation at those sites [20]. Cruciform DNA is known to have less thermodynamic stability in comparison to regular duplex DNA [21].

2

M. Kumar et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

the structural status of the designed DNA oligonucleotide sequences CR, CRC, and their equimolar ratio complex (CR·CRC) (Table 1). Further, their interaction with MB dye was studied to find out the binding mechanism of the same. Gel electrophoresis studies infer the molecularity (strandedness) of structures formed by CR (bulge duplex with flanking ends), CRC (hairpin with flanking ends), and CR·CRC complex (Cruciform structure with flanking ends), which were also confirmed by CD and UV-thermal melting analysis. There was hardly any interaction observed between MB with structures adopted by CR and CRC sequences, but an effective binding was observed with their cruciform structure formed in the equimolar ratio (CR·CRC). 2. Materials and method The DNA oligonucleotides, synthesized on the 1 μmol scale by Bio Basic Inc., Canada, were received as PAGE purified in the form of lyophilized powder. The oligomers were stored at −20 °C and were used further without any purification. Their purity was checked by carrying out denaturating gel electrophoresis in the presence of 7 M urea. The concentration of the oligonucleotides was determined spectrophotometrically by using the extinction coefficient (ɛ) calculated by the nearest neighbor method and measuring the absorbance at 260 nm. All the studied oligomers along with control size markers have been listed in Table 1. The stock solutions of the oligomers were prepared by directly dissolving the lyophilized powder in MilliQ water. All other chemicals were of analytical grade and were purchased from Sigma Chemicals. All samples were heated at 95 °C for 5 min and were slowly cooled to room temperature. Fig. 1. Cruciform Structure and its biological relevance.

2.1. Polyacrylamide gel electrophoresis (PAGE) These structures can be thermodynamically driven by perturbation in their structure through external twisting. The smooth formation of the cruciform structure of (A-T)34 sequence present in the Xenopus globin gene using molecular cloning had been reported long back [22]. It is well established that cruciform structures are targeted by many proteins, such as H1, H5 histones, HMG proteins, HU, p53 [23,24], 14-3-3 [25–27], DEK, IFI16 [28] and Rif 1 [29]. The studies of DNA and its interaction with various drug/dye molecules have been of profound interest for the researchers, as these serve the purpose to understand and design a new molecule for better efficacy [30,31]. Methylene blue (MB) (Fig. 2) is one of the important ligands, which has been extensively studied due to its specific properties [32–34]. MB is frequently used in photodynamic therapy because of its photosensitizing properties [35–37]. MB is a potent photosensitizer, as it triggers singlet oxygen (1O2) effectively, in contact with light and oxygen [38,39]. It is also suggested that MB is used to depress HIV, hepatitis B, and C in human blood plasma [40]. It was suggested that MB prefers groove binding in AT-rich sequences and intercalation in GCrich sequences [41]. Groove binding interaction of MB with AT-rich DNA does not get affected by the change in ionic strength, while intercalation mode is favored by the low ionic strength of the solution [42]. At high salt concentration, MB might interact with DNA via intercalation as well as peripheral binding [43]. In this work, we have used polyacrylamide (PAGE) electrophoresis, circular dichroism (CD), and UV-thermal melting studies to investigate

For checking the purity of DNA sequences, denaturatingpolyacrylamide gel electrophoresis was performed. 7 M urea was used as denaturant in samples, gel and tank buffer. Gel was run at around 200 V for facilitating the denaturation of samples. Tracking dye orange G and visualization agent stains all was used during the process. Similarly, during non-denaturating (native) gel electrophoresis, DNA samples were prepared in 20 mM sodium cacodylate buffer (pH 7.4) and 0.1 mM EDTA containing 100 mM NaCl. The final volume of the sample in the buffer was 20 μL. For native gel experiments, the samples were heated at 95 °C for 5 min and slowly cooled to room temperature. DNA samples were incubated at 4 °C for 2 h before loading onto 15% polyacrylamide gel. The polyacrylamide gel was preequilibrated at 4 °C for about 1 h. The gel had the same conditions as that of samples. Tank buffer contained 1× TBE with the same concentration of NaCl and EDTA. The tracking dye was Orange G with glycerol. The gels were run at a constant voltage of 65 V in a cold room (4 °C). After electrophoresis, the gel was stained with the Stains-All solution and visualized under white light and photographed by Alphaimager 2200 (Alpha Infotech Corpn.). 2.2. Circular dichroism spectroscopy For understanding about conformations adopted by studied DNA sequences, CD spectroscopy was used. The CD spectra were recorded on JASCO J-815 spectrophotometer (calibrated with D-Camphor sulphonic acid) using a quartz cuvette of 1.0 cm path length, at wavelength 200–320 nm, 1 nm data pitch with a response time of 1 s. Average of accumulation of three scans at a speed of 100 nm/min were recorded. Data were collected in units of millidegrees versus wavelength and were normalized to the total DNA strand concentration. 2.3. Temperature-dependent UV-spectroscopy

Fig. 2. The chemical structure of Methylene blue (MB).

UV-thermal denaturation experiments of oligonucleotide sequences were performed on a UV-2450 PC Shimadzu UV–Visible

M. Kumar et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

3

Table 1 DNA oligonucleotide sequences and marker used in this work. S. no

Sequence name

Sequence

Molar extinction coefficient (ε) (M−1 cm−1)

1.

CR

474,700

2.

CRC

d-AACTTCAACTTTTTTGGGGAGGGGTTTTTCC CCTCCCCATTTTAGCTCCTCAG d-CTGAGGAGCTTTTTTAATTAATTATTTTTTA ATTAATTATTTTAGTTGAAGTT

Control size marker 1.

PAL-48

d-CTTGAGCTTGAGCTTGAGCTTGAGCTCAAG CTCAAGCTCAAGCCTCAAG

450,900

spectrophotometer equipped with a Peltier thermo-programmer, TMS PC-8(E) 200 and interfaced with a Pentium IV computer for data collection and analysis. Stoppered quartz cuvettes of 1 cm optical path length with 110 μL volume were used for measurements. The samples were prepared by taking the desired strand concentration. After that, they were heated at 95 °C for 5 min followed by slow cooling and then kept overnight at 4 °C. The temperature versus absorbance profiles was recorded at 265 nm wavelength by heating the samples from 20 °C to 95 °C at a rate of 0.5 °C/min. The thermal melting temperature (T M ) was determined from the peak of the first derivative of the thermal denaturation profile generated by the computer. 3. Results and discussion 3.1. Structural Status of the DNA sequences 3.1.1. Polyacrylamide gel electrophoresis (PAGE) Studies Before performing native PAGE gel electrophoresis experiments, the denaturating gel electrophoresis of all the studied DNA sequences was carried out in the presence of 8 M urea. The purity and size of oligonucleotide sequences under examination was confirmed by using denaturating conditions with the help of PAL48 as size marker. Fig. 3 (a) displays the denaturating gel electrophoretogram of CRC (Lane 1), CR (Lane 2), and PAL48 (Lane 3). Under denaturating conditions, size marker PAL48 (Lane 3) migrated as unstructured species having mobility equivalent to 48-mer sequence, which had comparative mobility with 53-mer CR and CRC sequences. It was observed that all the sequences moved as a single band as expected, thereby, confirming the purity of the sequences.

Fig. 3. a. 20% Denaturating PAGE mobility pattern of the oligonucleotide sequences Lane 1: CRC (1 μM), Lane 2: CR (1 μM), Lane 3: PAL48 in 1× TBE and 100% formamide; b. 15% Native PAGE mobility pattern of oligonucleotide sequences. Lane 1: PAL-48, lane 2: CR (1 μM), lane 3: CRC (1 μM), lane 4: CR·CRC complex (1 μM).

517,500

PAGE is used to monitor and differentiate between various structures adopted by DNA oligonucleotides. The structural status of oligomers can easily be determined by comparing their mobility with control size markers in native PAGE gels. The gel electrophoretogram in Fig. 3 (b) displays 15% native PAGE of the structural status adopted by individual strands CR (lane 2), CRC (lane 3) and their complex of equimolar ratio CR·CRC (lane 4) at one μM strand concentration in 20 mM sodium cacodylate buffer (pH 7.4) containing 0.1 mM EDTA, and 0.1 M NaCl. The control size marker PAL-48 (lane 1) showed two bands; the upper band corresponds to 96-mer perfect duplex and the lower band was of the 48-mer oligomer. It was observed that the 53-mer CR sequence (lane 2) showed a single band with comparative mobility to the two bands of the marker PAL-48. On comparing it with the mobility of control size marker bands, the size of the CR oligomeric structure was expected to be of a flexible bimolecular structure. The gel band of CR is moving much slower than the expected band of a single strand, which suggests the formation of possibly an intermolecular bulge duplex [44]. Therefore, the suggested structure here could be a duplex with flanking ends. The flanks at the end provide flexibility to migrate the structure with ease in the gel matrix. On the other hand, the gel band of oligomer CRC (lane 3) is shown to migrate faster than the CR band. Also, it moved slightly above the lower band of PAL-48. This oligomeric structure could be a compact intramolecular folded structure, possibly a hairpin with flanking ends. It is well documented that hairpins move equivalent to half of their linear duplex size [45,46]. Thus, it is proposed that this band (lane 3) is due to the formation of a hairpin structure with unpaired flanking ends. An equimolar addition of CR and CRC (1:1) i.e. CR·CRC complex (lane 4) showed only a single band, which was expected to move comparable to their duplex i.e. 106-mer. Surprisingly, the band showed highly retarded mobility, as compared to the upper 98-mer band of the PAL-48 sequence. Such highly retarded band of CR·CRC complex (lane 4) is suggestive of the formation of a tetramolecular cruciform type structure, formed by the association of four strands. It has already been demonstrated that the electrophoretic mobility of the DNA structure containing cruciform is much slower than their usual mobility [47]. The careful look of the sequences CR and CRC reveals the presence of complementary regions on both the oligomers. The hydrogen bonding association of flanking segments of the hairpins gives rise to two additional arms, developing into a Cruciform topology (Fig. 8). From gel analysis, it can be concluded that the CR sequence exists in bulge duplex with flanking ends, while CRC adopts a hairpin with flanking end. The CR·CRC complex facilitates the formation of the cruciform with flanking ends at the studied experimental solution conditions. 3.1.2. UV-Thermal melting studies Thermal denaturation experiments record the sample absorbance at 260 nm wavelength as a function of temperature. The temperature at which half of the DNA strands melt into single strands is known as the melting temperature (TM) of DNA. TM is obtained by measuring the midpoint of the melting curve. Thermal melting profiles of oligomers CR, CRC, and CR·CRC complex in 20 mM sodium cacodylate buffer (pH 7.4) containing 100 mM NaCl and 0.1 mM EDTA are displayed as

4

M. Kumar et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

Fig. 4. The melting curve of the CR sequence was found to be monophasic and the melting temperature, measured by their first derivative was found to be 76 °C. Such high melting temperature for the CR sequence was already expected, as it is showing a single band in the native PAGE gel, which suggested that it forms a secondary structure with retarded mobility. We have proposed a bulge duplex having four T4 loops and two T5 internal loops along with flanking ends. The effect of the loop on the stability of the DNA hairpin structure was reported, where the order of their stability was T loop N C loop N G loop N A loop [48]. The stability of this structure even in the presence of internal loops/bulges is attributed to the presence of a large number of GC bonds. The monophasic melting curve of the CRC sequence showed a 43 °C melting temperature. This melting is attributed to the hairpin structure with flanking ends. Both CR and CRC sequences are 53-mer but, the observed melting temperature of CR bulge duplex was found to be higher than CRC hairpin. The low melting temperature of the CRC sequence is due to the presence of more AT base pairs in the hairpin structure and the presence of flanking ends. Imperfect inverted repeat sequences can easily form hairpin and bulge duplex structures [49]. The mobility status of CRC on the native PAGE gel was found to be unimolecular and faster than CR. It had suggested an intramolecular compact structure as hairpin having unpaired flanking ends. The possible fraying through the flanking ends correlates with the lower melting temperature of CRC shown in UV-thermal curves (Fig. 4). The sample of CR·CRC complex demonstrated a triphasic curve (Fig. 4) with melting temperatures at 42, 59, and 76 °C. The lower and upper melting temperature values are almost similar to what has been obtained from individual UV-thermal profiles of CR and CRC sequences. The melting transition in between obtained at 59 °C is possibly due to the paired flanking duplex regions (the linear arms) found in the suggested cruciform structure. Based on the gel and thermal melting analysis, the formation of DNA cruciform structure at physiological buffer conditions had been suggested. 3.1.3. CD studies CD is a very sensitive technique to study the conformational polymorphism exhibited by the nucleic acids and proteins. This method is commonly used to monitor various conformations adopted by oligonucleotides, in particular solution conditions. An extensive literature survey of the major (A, B, C & Z) forms of DNA [50] suggested that the Bform of DNA shows positive (275 nm) and negative peak (245 nm) of equal amplitude, due to base stacking and right-handed helicity respectively [51,52]. The CD spectra of both the sequences (CR and CRC) and their complex (CR·CRC) at 2 μM strand concentration in 20 mM sodium cacodylate buffer (pH 7.4) containing 100 mM NaCl and 0.1 mM EDTA were recorded (Fig. 5). The CD profiles of CR, CRC, and CR·CRC complex showed a common positive band at 220 nm and another positive peak at 270, 274, and 272 nm respectively. A negative peak is also observed for CR (240 nm), CRC (248 nm), and CR·CRC complex (244 nm). All oligomers displayed characteristics of B-DNA like structures. The

Fig. 5. CD spectra of CR, CRC, and CR·CRC complex at 2 μM oligomer concentration.

difference in their peaks is probably due to the presence of more GC and AT contents present in the CR and CRC respectively. 4. Interaction studies of structures adopted by designed DNA sequences with methylene blue (MB) 4.1. UV-Thermal melting studies The interaction studies of MB dye with DNA have been done using thermal melting experiments. The oligomers are incubated overnight with MB at different ratios of 1:5 and 1:10. The melting temperature of the structures formed by CR and CRC oligomer does not change at both the ligand concentrations (Data not shown). On analysis, it may be suggested that the bulged duplex and hairpin with flanking ends formed by CR and CRC oligomers respectively do not interact with MB significantly. However, the thermal melting curves of CR·CRC complex in the presence of MB are quite interesting (Fig. 6). The lower and upper-temperature transitions of cruciform were not affected by the addition of MB, while the middle-temperature transition due to paired flanking ends at 59 °C (Fig. 4), showed a significant change. When the ligand (MB) concentration was set to five times to the DNA concentration, the transition temperature at 59 °C (Fig. 4) gets shifted right to 62 °C (Fig. 6) and a further fivefold increase in ligand concentration shifted the TM to 69 °C [53]. This increase in melting temperature in addition to MB confirmed the stabilization of the cruciform structure. This might be probably due to the interaction of MB with the Watson-Crick base pairs in the linear arms of the cruciform structure. We have proposed the hypothetical models for the structure formed by the sequences CR, CRC, and CR·CRC complex (Fig. 8).

Fig. 4. Thermal denaturation profiles (-■-) and UV-melting derivatives (-●-) of oligomer CR, CRC, and CR·CRC complex at wavelengths 265 nm.

M. Kumar et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

5

Fig. 6. Thermal denaturation profiles (-■-) and UV-thermal melting derivative (-●-) of oligomer CR·CRC complex with ligand methylene blue in 1:5 (a) and 1:10 (b) ratio, at wavelengths 265 nm.

Interaction studies of MB and DNA oligomers were also performed in sodium cacodylate buffer (pH 7.4) containing 0.1 mM EDTA and 100 mM NaCl. The CR, CRC, and CR·CRC complex samples were incubated with MB in the ratio 1:5 and 1:10 for 24 h. The CD spectra obtained from the incubated samples are shown in Fig. 7. There is very less or negligible change observed in the case of CR, while a small change is shown in the CD spectrum of CRC on adding 1:5 MB, which remains unchanged at higher concentrations. The MB dye is also shown to interact with CR·CRC complex (the cruciform structure). Here, the changes in peaks are very prominent. The CD spectra of CR·CRC complex in the presence of various concentrations of MB show changes both in negative and positive bands. The intensity of the positive peak at 272 nm is remarkably increased with the addition of MB; signifying that MB could increase the base stacking of the cruciform structure. The same has also been confirmed by thermal melting spectra, showing that MB stabilizes the Watson-crick base pairs (Fig. 6). The negative band at 245 nm is also intensified after the addition of MB, indicating the increase in the right-handedness of the DNA.

pairs. On the contrary, the hairpin structure formed by the CRC sequence showed lesser stability (TM 43 °C), which may be because it consisted of almost all A-T bonds only. Further, fraying ends decrease the stability of this intramolecular hairpin structure. Most interesting is the tetramolecular cruciform structure adopted by the CR·CRC complex. On careful analysis, it was observed that this cruciform structure showed two completely different types of arms, one side having almost all G-C bonds, while another side has All A-T bonds only. These two arms are expected to melt like bulge duplex and hairpin structure adopted by CR and CRC sequences, which coincides with the upper (TM 76 °C), and lower (TM 43 °C) temperature transition of the triphasic melting curve of CR·CRC complex. The middletemperature transition (TM 59 °C) of the same had been attributed to the duplex arms on another side of the cruciform junction structure having 6 G-C and 4 A-T at one side and same on the other side too. All these structures confirmed the B-form of DNA conformation through CD studies. Photosensitizer dye MB is shown to have maximum effect on cruciform structure, which may be because the cruciform structure has both G-C and A-T base pairs in abundance, which are required for better binding with MB, as already reported in the literature.

5. Proposed hypothetical models

6. Biological relevance

Based on all the experimental data collected using gel-electrophoresis, UV-thermal melting, and circular dichroism studies, the following structures are proposed for the studied CR, CRC, and an equimolar ratio of CR·CRC sequences (Fig. 8). CR sequence has been proposed to adopt an intermolecular bulge duplex type structure, having flanking bases at both ends. It shows a very high melting temperature (TM 76 °C), which is because of the presence of 18 G-C and 6 A-T base

It is important to study various secondary structures adopted by DNA sequences to understand the functions performed by them inside the living cells. Cruciform structures are formed by the sequences which have perfect or imperfect inverted repeats in the DNA sequences in eukaryotes and bacteria. It is well known that inverted repeats play a significant biological role, as binding sites for dimeric proteins in the linear form of DNA [54].

4.2. CD Studies

Fig. 7. CD spectra of CR, CRC, and CR·CRC complex oligomer concentration of 2 μM and methylene blue with a different ratio 1:5 and 1:10.

6

M. Kumar et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

Fig. 8. Proposed models for CR (Bulge Duplex with flanking ends), CRC (Hairpin with flanking ends), and CR·CRC complex (Cruciform with flanking ends).

Due to the immobile structure and slow kinetics of cruciform, an ambiguity persisted about their functional existence in vivo [55]. Though, several reports later proved the evidence for the formation of a cruciform in vivo [56,57]. DNA sequences having AT-rich stretch are likely to form these structures in vivo much faster than sequences with GCrich inverted repeats due to their faster kinetics [58,59]. At present, cruciform structures are considered to be vital in diverse cellular processes such as DNA replication, gene expression, DNA repair, and recombination [60–63]. The distinct conformations of cruciform are dependent on environmental conditions, resolved with atomic force microscopy [64,65]. Circular plasmid DNA with negative superhelical density comprises a cruciform structure in vitro as well as in vivo [66]. Many proteins can specifically recognize cruciform structures, which are important for many biological processes. The protein synthesis in E. coli was shown to be inhibited due to the formation of a cruciform structure by (AT)n-d (AT)n dinucleotide [67]. These structures are also associated with the evolution of many diseases, including certain types of cancers [68]. The promoter region of the gene consists of inverted repeats, which are capable of transforming into cruciform structures in vivo. Numerous

proteins are documented such as BRCA1 protein and PARP-1, which can preferentially bind to cruciform structures [69,70]. Mammalian Rif1 protein's role in DNA replication and replication fork restart is crucial. It is found that it has a specific domain that is functional only after recognizing cruciform structures [29]. The rhodium complex [Rh(4,7-diphenyl-phen)3]3+ binds to a cruciform structure. Upon photoactivation, it produces cleavage at specific AT-rich sites of neighboring stems of the minor cruciform pBR322 [71]. Targeting cruciform structure with various ligands would be helpful for a better understanding of their mechanism, leading to some possible solutions for curing diseases. This study also discussed various secondary structures adapted (hairpin and bulge with flanking ends and cruciform having bulges) and their interactions with a photosensitizer methylene blue. 7. Conclusions Herein, we performed native PAGE, CD, and UV-thermal melting experiments to explore the structural status of the designed DNA

M. Kumar et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

oligonucleotide sequences. CD experiments exhibited that all the oligomers at physiological pH, adapt B-form DNA structure. The gel experiments revealed that the oligomers showed a single band, suggesting the formation of a single structural species. On correlation with other biophysical techniques, the slow-moving single band of CR was suggested because of the presence of bulge duplex with flanking ends. It was further confirmed by thermal melting analysis, showing the melting temperature at 76 °C. The fast-moving band of CRC implied the presence of a hairpin with flanking ends with a thermal melting value of 46 °C. The low melting temperature is due to the presence of AT-rich stem. The unusually slowmoving single band of CR·CRC complex in gel electrophoresis is due to its tetramolecular cruciform having flanking ends. The formation of cruciform is further supported by a triphasic melting curve obtained in UVthermal melting experiments. Quite interestingly, this cruciform structure is suggested to have all G-C rich stem at one end, and all A-T rich stem at another. Another two stems/arms showed a combination of G-C and A-T bonds. Further, the interaction of MB dye having photosensitizing properties confirmed that while dye does not effectively bind to bulge duplex and hairpin structures formed by CR and CRC respectively, it prefers to interact with Watson-Crick base-paired cruciform structure. Keeping in mind all the discussed experimental results, the hypothetical models have been proposed (Fig. 8) for the suggested structures, illustrating the detailed view of bulge duplex with flanking ends, hairpin with flanking ends, and cruciform structure with flanking ends for CR, CRC, and CR·CRC complex oligomers respectively. However, to confirm the structural status of designed studied sequences, another specific study would be needed. CRediT authorship contribution statement Mohan Kumar:Data curation, Writing - original draft, Validation, Software.Mahima Kaushik:Writing - original draft, Writing - review & editing.Shrikant Kukreti:Supervision, Conceptualization, Validation, Writing - review & editing. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgments The authors are thankful to the University of Delhi for its Research & Development Grants. Financial support by the Council of Scientific and Industrial Research, India (CSIR grant number: 09/45(1214)/2012EMR-I) to Mohan Kumar is also acknowledged. References [1] B. Zakeri, T.K. Lu, DNA nanotechnology: new adventures for an old warhorse, Curr. Opin. Chem. Biol. 28 (2015) 9–14. [2] M.L. Bochman, K. Paeschke, V.A. Zakian, DNA secondary structures: stability and function of G-quadruplex structures, Nat. Rev. Genet. 13 (2012) 770–780. [3] M. Kaushik, S. Kaushik, K. Roy, A. Singh, S. Mahendru, M. Kumar, S. Chaudhary, S. Ahmed, S. Kukreti, A bouquet of DNA structures: emerging diversity, Biochem. Biophys. Rep. 5 (2016) 388–395. [4] S. Kukreti, H. Kaur, M. Kaushik, A. Bansal, S. Saxena, S. Kaushik, R. Kukreti, Structural polymorphism at LCR and its role in beta-globin gene regulation, Biochimie 92 (2010) 1199–1206. [5] E.M. Moody, P.C. Bevilacqua, Thermodynamic coupling of the loop and stem in unusually stable DNA hairpins closed by CG base pairs, J. Am. Chem. Soc. 125 (2003) 2032–2033. [6] J. Wen, H. Duan, F. Bejarano, K. Okamura, L. Fabian, J.A. Brill, D. Bortolamiol-Becet, R. Martin, J.G. Ruby, E.C. Lai, Adaptive regulation of testis gene expression and control of male fertility by the Drosophila hairpin RNA pathway, Mol. Cell. 57 (2015) 165–178. [7] J. Xie, R. He, Q. Su, P.W. Tai, H. Ma, J. Li, G. Gao, 9. rAAV designs harboring DNA secondary structures with high thermal stabilities produce heterogenic viral genome populations, Mol. Ther. 24 (2016) S5.

7

[8] T. Boulikas, Common structural features of replication origins in all life forms, J. Cell. Biochem. 60 (1996) 297–316. [9] M. Zhang, T.T. Lam, M. Tonelli, W.F. Marzluff, R. Thapar, Interaction of the histone mRNA hairpin with stem–loop binding protein (SLBP) and regulation of the SLBP– RNA complex by phosphorylation and proline isomerization, Biochem. 51 (2012) 3215–3231. [10] M. Kaushik, S. Kukreti, Structural polymorphism exhibited by a quasipalindrome present in the locus control region (LCR) of the human β-globin gene cluster, Nucleic Acids Res. 34 (2006) 3511–3522. [11] A. Gierer, Model for DNA and protein interactions and the function of the operator, Nature 212 (1966) 1480–1481. [12] J.R. Platt, Possible separation of intertwined nucleic acid chains by transfer-twist, Proc. NatI. Acad. Sci. U.S.A. 41 (1955) 181. [13] O. Limanskaia, A. Limanskiĭ, Distribution of potentially hairpin-loop structures in the genome of bovine retroviruses, Vopr. Virusol. 54 (2009) 27–32. [14] A.I. Murchie, D.M. Lilley, The mechanism of cruciform formation in supercoiled DNA: initial opening of central basepairs in salt-dependent extrusion, Nucleic Acids Res. 15 (1987) 9641–9654. [15] M. Kaushik, A. Singh, M. Kumar, S. Chaudhary, S. Ahmed, S. Kukreti, Structurespecific ligand recognition of multistranded DNA structures, Curr. Top. Med. Chem. 17 (2017) 138–147. [16] A.L. Mikheikin, A.Y. Lushnikov, Y.L. Lyubchenko, Effect of DNA supercoiling on the geometry of holliday junctions, Biochem. 45 (2006) 12998–13006. [17] A. Dayn, S. Malkhosyan, S.M. Mirkin, Transcriptionally driven cruciform formation in vivo, Nucleic Acids Res. 20 (1992) 5991–5997. [18] A.S. Krasilnikov, A. Podtelezhnikov, A. Vologodskii, S.M. Mirkin, Large-scale effects of transcriptional DNA supercoiling in vivo, J. Mol. Biol. 292 (1999) 1149–1160. [19] K. van Holde, J. Zlatanova, Unusual DNA structures, chromatin and transcription, Bioessays 16 (1994) 59–68. [20] C.E. Pearson, H. Zorbas, G.B. Price, M. Zannis-Hadjopoulos, Inverted repeats, stemloops, and cruciforms: significance for initiation of DNA replication, J. Cell. Biochem. 63 (1996) 1–22. [21] G.W. Gough, D.M. Lilley, DNA bending induced by cruciform formation, Nature 313 (1985) 154–156. [22] D.R. Greaves, R.K. Patient, D.M. Lilley, Facile cruciform formation by an (AT) 34 sequence from a Xenopus globin gene, J. Mol. Biol. 185 (1985) 461–478. [23] E.B. Jagelská, V. Brázda, P. Pečinka, E. Paleček, M. Fojta, DNA topology influences p53 sequence-specific DNA binding through structural transitions within the target sites, J. Biochem. 412 (2008) 57–63. [24] E.B. Jagelská, H. Pivoňková, M. Fojta, V. Brázda, The potential of the cruciform structure formation as an important factor influencing p53 sequence-specific binding to natural DNA targets, Biochem. Biophy. Res. Commun. 391 (2010) 1409–1414. [25] V. Brázda, J. Čechová, J. Coufal, S. Rumpel, E.B. Jagelská, Superhelical DNA as a preferential binding target of 14-3-3γ protein, J. Biomol. Str. Dyn. 30 (2012) 371–378. [26] M. Callejo, D. Alvarez, G.B. Price, M. Zannis-Hadjopoulos, The 14-3-3 protein homologues from Saccharomyces cerevisiae, Bmh1p and Bmh2p, have cruciform DNAbinding activity and associate in vivo with ARS307, J. Biol. Chem. 277 (2002) 38416–38423. [27] M. Zannis-Hadjopoulos, W. Yahyaoui, M. Callejo, 14-3-3 cruciform-binding proteins as regulators of eukaryotic DNA replication, Trends Biochem. Sci. 33 (2008) 44–50. [28] H.-g. Hu, H. Illges, C. Gruss, R. Knippers, Distribution of the chromatin protein DEK distinguishes active and inactive CD21/CR2 gene in pre-and mature B lymphocytes, Int. Immun. 17 (2005) 789–796. [29] R. Sukackaite, M.R. Jensen, P.J. Mas, M. Blackledge, S.B. Buonomo, D.J. Hart, Structural and biophysical characterization of murine rif1 C terminus reveals high specificity for DNA cruciform structures, J. Biol. Chem. 289 (2014) 13903–13911. [30] C.F. Yang, P.J. Jackson, Z. Xi, I.H. Goldberg, Recognition of bulged DNA by a neocarzinostatin product via an induced fit mechanism, Bioorg. Med. Chem. 10 (2002) 1329–1335. [31] H. Junicke, J.R. Hart, J. Kisko, O. Glebov, I.R. Kirsch, J.K. Barton, A rhodium (III) complex for high-affinity DNA base-pair mismatch recognition, Proc. Natl. Acad. Sci. 100 (2003) 3737–3742. [32] M. Ortiz, A. Fragoso, P.J. Ortiz, C.K. O'Sullivan, Elucidation of the mechanism of single-stranded DNA interaction with methylene blue: a spectroscopic approach, J. Photochem. Photobiol. A 218 (2011) 26–32. [33] Z. Hu, C. Tong, Synchronous fluorescence determination of DNA based on the interaction between methylene blue and DNA, Analyt. Chimica Acta 587 (2007) 187–193. [34] E.T. Wahyuni, D.H. Tjahjono, N. Yoshioka, H. Inoue, Spectroscopic studies on the thermodynamic and thermal denaturation of the ct-DNA binding of methylene blue, Spectrochim. Acta A 77 (2010) 528–534. [35] E. Farjami, R. Campos, E.E. Ferapontova, Effect of the DNA end of tethering to electrodes on electron transfer in methylene blue-labeled DNA duplexes, Langmuir 28 (2012) 16218–16226. [36] C. Tong, Z. Hu, J. Wu, Interaction between methylene blue and calfthymus deoxyribonucleic acid by spectroscopic technologies, J. Fluores. 20 (2010) 261–267. [37] P. Vardevanyan, A. Antonyan, M. Parsadanyan, M. Shahinyan, L. Hambardzumyan, Mechanisms for binding between methylene blue and DNA, J. Appl. Spectrosc. 80 (2013) 595–599. [38] H.-C. DeFedericis, H.B. Patrzyc, M.J. Rajecki, E.E. Budzinski, H. Iijima, J.B. Dawidzik, M.S. Evans, K.F. Greene, H.C. Box, Singlet oxygen-induced DNA damage, Radiat. Res. 165 (2006) 445–451. [39] S.N. Kassam, A.J. Rainbow, Deficient base excision repair of oxidative DNA damage induced by methylene blue plus visible light in xeroderma pigmentosum group C fibroblasts, Biochem. Biophys. Res. Commun. 359 (2007) 1004–1009.

8

M. Kumar et al. / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy 242 (2020) 118716

[40] L. Hambardzumyan, Effect of DNA GC-content on interaction with methylene blue, Proc. of the Yerevan State Univ, Chem. Biol. (2015) 45–49. [41] R. Rohs, H. Sklenar, Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation, J. Biomol. Str. Dyn. 21 (2004) 699–711. [42] R. Rohs, H. Sklenar, R. Lavery, B. Röder, Methylene blue binding to DNA with alternating GC base sequence: a modeling study, J. Am. Chem. Soc. 122 (2000) 2860–2866. [43] E. Tuite, B. Norden, Sequence-specific interactions of methylene blue with polynucleotides and DNA: a spectroscopic study, J. Am. Chem. Soc. 116 (1994) 7548–7556. [44] M. Kaushik, R. Kukreti, D. Grover, S.K. Brahmachari, S. Kukreti, Hairpin–duplex equilibrium reflected in the A→ B transition in an undecamer quasi-palindrome present in the locus control region of the human β-globin gene cluster, Nucleic Acids Res. 31 (2003) 6904–6915. [45] L.E. Xodo, G. Manzini, F. Quadrifoglio, G.A. Van der Marel, J.H. Van Boom, Oligodeoxynucleotide folding in solution: loop size and stability of B-hairpins, Biochem. 27 (1988) 6321–6326. [46] L.E. Xodo, G. Manzini, F. Quadrifoglio, N. Yathindra, G.A. van der Marel, J.H. van Boom, A facile duplex-hairpin interconversion through a cruciform intermediate in a linear DNA fragment, J. Mol. Biol. 205 (1989) 777–781. [47] N.R. Kallenbach, R.-I. Ma, N.C. Seeman, An immobile nucleic acid junction constructed from oligonucleotides, Nature 305 (1983) 829–831. [48] M.M. Senior, R.A. Jones, K.J. Breslauer, Influence of loop residues on the relative stabilities of DNA hairpin structures, Proc. Natl. Acad. Sci. 85 (1988) 6242–6246. [49] A. Rajendiran, A. Chatterjee, A. Pan, Computational approaches and related tools to identify MicroRNAs in a species: a Bird’s Eye View, Interdiscip Sci. 10 (2018) 616–635. [50] N. Berova, K. Nakanishi, R.W. Woody, Circular Dichroism: Principles and Applications, John Wiley & Sons, 2000. [51] J. Kypr, I. Kejnovská, D. Renčiuk, M. Vorlíčková, Circular dichroism and conformational polymorphism of DNA, Nucleic Acids Res. 37 (2009) 1713–1725. [52] L.M. Chen, J. Liu, J.C. Chen, C.P. Tan, S. Shi, K.C. Zheng, L.N. Ji, Synthesis, characterization, DNA-binding and spectral properties of complexes [Ru (L) 4 (dppz)] 2+(L= Im and MeIm), J. Inorganic Biochem. 102 (2008) 330–341. [53] L. Hambardzumyan, Thermodynamic investigation of methylene blue complexes with DNA, Proceedins of the YSU. Chem. Biol. (2013) 23–27. [54] R.R. Sinden, DNA Structure and Function, Elsevier, 2012. [55] R.R. Sinden, S.S. Broyles, D.E. Pettijohn, Perfect palindromic lac operator DNA sequence exists as a stable cruciform structure in supercoiled DNA in vitro but not in vivo, Proc.Natl. Acad. Sci. 80 (1983) 1797–1801.

[56] H. Kogo, H. Inagaki, T. Ohye, T. Kato, B.S. Emanuel, H. Kurahashi, Cruciform extrusion propensity of human translocation-mediating palindromic AT-rich repeats, Nucleic Acids Res. 35 (2007) 1198–1208. [57] G. Zheng, T. Kochel, R.W. Hoepfner, S.E. Timmons, R.R. Sinden, Torsionally tuned cruciform and Z-DNA probes for measuring unrestrained supercoiling at specific sites in DNA of living cells, J. Mol. Biol. 221 (1991) 107–122. [58] A. Dayn, S. Malkhosyan, D. Duzhy, V. Lyamichev, Y. Panchenko, S. Mirkin, Formation of (dA-dT) n cruciforms in Escherichia coli cells under different environmental conditions, J. Bacteriol. 173 (1991) 2658–2664. [59] J.A. McClellan, P. Boublikova, E. Palecek, D. Lilley, Superhelical torsion in cellular DNA responds directly to environmental and genetic factors, Proc. Natl. Acad. Sci. 87 (1990) 8373–8377. [60] P. Noirot, J. Bargonetti, R.P. Novick, Initiation of rolling-circle replication in pT181 plasmid: initiator protein enhances cruciform extrusion at the origin, Proc. Natl. Acad. Sci. 87 (1990) 8560–8564. [61] R.M. Wadkins, Targeting DNA secondary structures, Curr. Med. Chem. 7 (2000) 1–15. [62] E.L. Kim, H. Peng, F.M. Esparza, S.Z. Maltchenko, M.K. Stachowiak, Cruciformextruding regulatory element controls cell-specific activity of the tyrosine hydroxylase gene promoter, Nucleic Acids Res. 26 (1998) 1793–1800. [63] A.G. Coté, S.M. Lewis, Mus81-dependent double-strand DNA breaks at in vivogenerated cruciform structures in S. cerevisiae, Mol. Cell. 31 (2008) 800–812. [64] L.S. Shlyakhtenko, V.N. Potaman, R.R. Sinden, Y.L. Lyubchenko, Structure and dynamics of supercoil-stabilized DNA cruciforms, J. Mol. Biol. 280 (1998) 61–72. [65] N. Panayotatos, A. Fontaine, A native cruciform DNA structure probed in bacteria by recombinant T7 endonuclease, J. Biol. Chem. 262 (1987) 11364–11368. [66] L.S. Shlyakhtenko, P. Hsieh, M. Grigoriev, A cruciform structural transition provides a molecular switch for chromosome structure and dynamics, J. Mol. Biol. 296 (5) (2000) 1169–1173. [67] D.B. Haniford, D.E. Pulleyblank, Transition of a cloned d (AT) nd (AT) n tract to a cruciform in vivo, Nucleic Acids Res. 13 (1985) 4343–4363. [68] C. Matek, T.E. Ouldridge, A. Levy, J.P. Doye, A.A. Louis, DNA cruciform arms nucleate through a correlated but asynchronous cooperative mechanism, J. Phy. Chem. B 116 (2012) 11616–11625. [69] V. Brázda, E.B. Jagelská, J.C. Liao, C.H. Arrowsmith, The central region of BRCA1 binds preferentially to supercoiled DNA, J. Biomol. Str. Dyn. 27 (2009) 97–103. [70] V.N. Potaman, L.S. Shlyakhtenko, E.A. Oussatcheva, Y.L. Lyubchenko, V.A. Soldatenkov, Specific binding of poly (ADP-ribose) polymerase-1 to cruciform hairpins, J. Mol. Biol. 348 (2005) 609–615. [71] M.R. Kirshenbaum, R. Tribolet, J.K. Barton, Rh (DIP) 33+: a shape-selective metal complex which targets cruciforms, Nucleic Acids Res. 16 (1988) 7943–7960.