L-tryptophan promotes the cheliped regeneration of Chinese mitten crab (Eriocheir sinensis) through melatonin, serotonin and dopamine involvement

L-tryptophan promotes the cheliped regeneration of Chinese mitten crab (Eriocheir sinensis) through melatonin, serotonin and dopamine involvement

Aquaculture 511 (2019) 734205 Contents lists available at ScienceDirect Aquaculture journal homepage: www.elsevier.com/locate/aquaculture L-tryptop...

1MB Sizes 0 Downloads 27 Views

Aquaculture 511 (2019) 734205

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

L-tryptophan promotes the cheliped regeneration of Chinese mitten crab (Eriocheir sinensis) through melatonin, serotonin and dopamine involvement

T

Cong Zhang, Qian Zhang, Xiaozhe Song, Yangyang Pang, Yameng Song, Yiyue Wang, Long He, ⁎ ⁎ Jiahuan Lv, Yongxu Cheng , Xiaozhen Yang National Demonstration Center for Experimental Fisheries Science Education, Key Laboratory of Freshwater Aquatic Genetic Resources, Ministry of Agriculture, Engineering Research Center of Aquaculture, Shanghai Ocean University, Shanghai, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Eriocheir sinensis L- tryptophan Regeneration Melatonin 5-HT and DA receptor

It is particularly important to artificially promote limb regeneration of Eriocheir sinensis with high limb-impairment rate. This study was designed to evaluate the effects of dietary supplementation of L-tryptophan (L-trp) on cheliped regeneration. Through this study, we find that the dietary supplementation of 0.53% and 0.70% Ltrp significantly increases limb regeneration rates over 14 d (P < .05). The expression of EcR-mRNA (ecdysteroid receptor) and Chi-mRNA (chitinase) are significantly upregulated with the dietary supplementation of 0.53% or 0.70% L-trp while the expression of MIH-mRNA (molt-inhibiting hormone) is significantly downregulated (P < .05). Moreover, digestive enzyme activities are significantly enhanced with dietary supplementation of 0.53% or 0.70% L-trp (P < .05). Further, dietary supplementation of L-trp significantly increases melatonin (MT) levels in eyestalks and L-trp levels in muscles of E. sinensis (P < .05). Interestingly, our study preliminarily explores the role of 5-HT and DA related receptors in the cheliped regeneration of E. sinensis. We find that dietary L-trp supplementation regulates the expression of 5-HT and DA-related receptors in digestive organs (hepatopancreas and intestines) and nervous tissues (cranial and thoracic ganglia), speculating that it may be involved in the improvement of digestion and absorption function and the regulation of nerve tissue repair during the cheliped regeneration of E. sinensis. Taken together, dietary supplementation of L-trp can promote limb regeneration by regulating regeneration-related gene expression and hepatopancreatic digestion in E. sinensis, which may be achieved by regulating MT levels and the binding of 5-HT and DA to corresponding receptors.

1. Introduction The Chinese mitten crab, Eriocheir sinensis, has become a very important aquaculture species in China due to its rich nutritional value and broad market demand (Sui et al., 2011). However, due to various factors such as its fighting behaviors (Riquelme, 2006), defense and predation patterns (Mcvean and Findlay, 1979), high-density culture and artificial harvesting (Rodriguez et al., 2007), broken limbs are common and observed during pond culturing (Zhang et al., 2018a). Limb-autotomy leads to long-term energy and function loss (Fleming et al., 2007), which has serious negative effects on feeding efficiency (Brock and Smith, 1998), immunity and antibacterial capacities (Yang et al., 2017b), survival rates (Simonson, 1985), etc., seriously affecting and restricting the quality and culture success of crabs. Therefore, it is meaningful to study a solution that can promote limb regeneration

while enhancing the immunity of crabs with limb-autotomy. Melatonin (MT) is a well-known pineal hormone that participates in physiological circadian and seasonal rhythms in vertebrates. Some studies have shown that in crustaceans, MT regulates hemolymph glucose (Maciel et al., 2014), enhances antioxidant capacities (Maciel et al., 2010), promotes limb regeneration (Tilden et al., 1997), and mediates molting cycles and circadian rhythms (Sainath et al., 2013). Our previous study has also presented that MT injection can significantly contribute to cheliped regeneration, hepatopancreas digestive capacities and hematological immunity in E. sinensis (Zhang et al., 2018c). Although MT injection has the expected effect, it is difficult to apply the “injection” method to pond culture practice activities of E. sinensis. As a precursor of serotonin (5-HT) and MT, L-tryptophan (L-trp) can promote animal growth (Pianesso et al., 2015), regulate immunity

⁎ Corresponding authors at: Key Laboratory of Freshwater Aquatic Genetic Resources, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai 201306, China. E-mail addresses: [email protected] (Y. Cheng), [email protected] (X. Yang).

https://doi.org/10.1016/j.aquaculture.2019.734205 Received 16 February 2019; Received in revised form 5 May 2019; Accepted 6 June 2019 0044-8486/ © 2019 Published by Elsevier B.V.

Aquaculture 511 (2019) 734205

C. Zhang, et al.

(Rubin et al., 2007) and play an important role in cell redox balancing (Esteban et al., 2004), and it can be used as feed grade at present. Some studies have shown that in vivo, neutral essential amino acid L-trp enters the cell through the active transport mechanism for neutral amino acids; in cells, L-trp is further converted into 5-hydroxytryptophan (5-HTP) under the catalysis of tryptophan hydroxylase (TpOH), which is then decarboxylated by 5-hydroxytryptophan decarboxylase (5-HT-PDC) to form 5 -HT (Sainath et al., 2013; Senatori et al., 2002) and to then synthesize MT from 5-HT by N-acetylation followed by methylation (Muñoz-Pérez et al., 2016; Muñoz et al., 2009). Therefore, the dietary supplementation of L-trp should result increase 5-HT and MT levels in vivo. Studies of Oncorhynchus mykiss, Salmo salar and Oncorhynchus kisutch show that the dietary supplementation of L-trp significantly increases MT and 5-HT levels in vivo (Lepage et al., 2005; Mardones et al., 2018). Obviously, these reports confirm this speculation. Therefore, we speculate that dietary supplementation with L-trp may have an effect similar to that of MT injection while dietary L-trp supplementation has important applications for aquaculture operation. We first studied the immunological significance of dietary L-trp supplementation and found that dietary L-trp supplementation significantly enhances the hematological immunity and antibacterial abilities of E. sinensis subjected to cheliped autotomy stress (Zhang et al., 2018b). Moreover, some studies have found that 5-HT, dopamine (DA) and MT act as important neuroendocrine transmitters in organisms and play an important regulatory role in tissue regeneration (Mohanan et al., 2006; Yang et al., 2017a; Zhang et al., 2018c) and ingestion digestion (Meguid et al., 2000; Pratt et al., 2016; Zhang et al., 2018c). There is a very close and complex relationship between the three neurotransmitters. 5-HT and DA in the extracellular or synaptic cleft must be combined with corresponding receptors on the cell membrane or postsynaptic membrane to function. There are many subtypes of 5-HT and DA receptors, and the receptors of different subtypes have different affinities to 5-HT and DA, target actions and positions, influencing 5-HT and DA roles (Sosa et al., 2004; Tierney, 2001).The gene sequences of 5-HT 1B, 5-HT 2B and 5-HT7 receptors and DA1A and DA2 receptors of E. sinensis have been cloned in our laboratory, while the roles of each receptor involved in this process remain unclear. In the present study, cheliped regeneration rate, regeneration-related gene expression (EcR, MIH and Chi) and hepatopancreatic digestive enzyme activities we measured firstly to evaluate whether the dietary supplementation of L-trp regulates cheliped regeneration by regulating regeneration-related gene expression and hepatopancreatic digestion in E. sinensis. Further, MT levels in the eyestalk and hepatopancreas and L-trp levels in muscles were determined by ultra-performance liquid chromatography-ultraviolet detection (UPLC-UV) and reversed-phase high-performance liquid chromatography (RT-HPLC) to evaluate effects of the dietary supplementation of L-trp on MT and L-trp levels in vivo on E. sinensis. Finally, the qRT-PCR method was used to measure the expression of 5-HT and DA-related receptor genes during this process to conduct a preliminary study of the functional role of different receptors in this process. The study effectively combines laboratory theories with aquaculture production practices and can serve as a reference and basis for improving the culture quality and economic benefits of E. sinensis in a convenient and feasible way. At the same time, the relationship between dietary L-trp and 5-HT, DA related receptors is preliminarily explored, furthering the knowledge of this field.

Table 1 Ingredients and proximate composition of the control diets (% dry matter). Ingredient

Content

Soybean meal Peanut meal Rapeseed meal Cotton meal Fish meal Wheat flour Yeast meal Squid powder Phosphatide oil Fish oil Pork lard Mineral mixa Vitamin mixb Ca(H2PO4)2 Choline chloride Dishulin Bentonite Salt Total Analyzed composition Moisture Crude protein Crude lipid Ash

15.50 8.00 18.00 7.00 7.00 28.30 2.00 2.00 2.00 1.50 1.50 0.30 1.20 1.00 0.40 0.10 4.00 0.20 100.00 11.45 34.56 8.34 9.15

a Vitamin premix (per kg diet): vitamin A, 62500 IU; vitamin D3, 15,000 IU; vitamin E, 1.75 g; vitamin K3, 35.4 mg; vitamin B1, 100 mg; vitamin B2, 150 mg; vitamin B6, 150 mg; vitamin B12, 0.2 mg; biotin, 4 mg; D‑calcium pantothenate, 250 mg; folic acid, 25 mg; nicotinamide, 300 mg; vitamin C, 700 mg. b Mineral premix (per kg diet): FeSO4·H2O, 200 mg; CuSO4·5H2O, 96 mg; ZnSO4·H2O, 360 mg; MnSO4·H2O, 120 mg; MgSO4·H2O, 240 mg; KH2PO4, 4.2 g; NaH2PO4, 0.5 g; KI, 5.4 mg; CoCl2·6H2O, 2.1 mg; Na2SeO3, 3 mg;

on studies of Scylla serrata and Astacus leptodactylus (Höglund et al., 2007; Harlıoğlu et al., 2014; Laranja Jr et al., 2010). L-trp content levels used in the four experimental diets were determined as 0.28% (Diet # A) (control), 0.40% (Diet # B), 0.53% (Diet # C) and 0.70% (Diet # D). L-trp (≥99.7%) was purchased from Sinopharm Chemical Reagent Co., Ltd. (China). Ingredients were ground to a fine powder and sent through a 187.5 μm mesh sieve. Then weigh accurately, using a step-bystep expansion method to add trace L-tryptophan, mix evenly, and use a double screw extruder to make pellet feed at 1.5 mm diameter. Then spread out and dried in an oven at 55 °C. After cooling under natural conditions, it was stored in a ziplock bag and stored in a refrigerator at −20 °C. The actual content of L-trp in different diets was checked and confirmed by reversed-phase high-performance liquid chromatography (RP-HPLC). A C18 (μ- Bondapak Cl8 column, diameter 25 cm × 4.6 mm) column was selected, the mobile phase was composed of sodium acetate buffer + methanol = 95 + 5, the flow rate was 1.5 mL/min, ultraviolet (UV) detection wavelength was 280 nm, the injection volume was 15 μL under room temperature. 2.2. Experimental crabs All experimental protocols were reviewed and approved by the Animal Bioethics Committee, Shanghai Ocean University, China. In May 2018, 350 hard-shelled crabs recently subjected to molting and limb-intact E. sinensis (Crustacea; Decapoda; Grapsidae) juvenile crabs (16.89 ± 3.87 g) were collected from the earth pond at the Chongming Research Base of Shanghai Ocean University (Shanghai, China). Juvenile crabs were acclimated in a 24-L ultra-clear glass tank, and each tank was supplied with continuously aerated freshwater under the following conditions: 24–28 °C, pH 7.84 ± 0.08, DO concentration

2. Materials and methods 2.1. Diets The composition and nutritional level of the basal diet applied is presented in Table 1. As feed protein sources, rapeseed, soybean and cotton meal. As fat sources, pork lard, fish oil and phosphatide oil based 2

Aquaculture 511 (2019) 734205

C. Zhang, et al.

6.3 ± 0.4 mg/L, salinity 0.3%, total ammonia 0.36 ± 0.03 mg/L, chloride level 136 ± 15 mg/L, basal nitrite < 0.05 mg/L−1 and natural photoperiod conditioning for one week. The crabs were fed a commercial crab diet once daily (Diet # A).

Table 2 Primer information for quantitative real-time polymerase chain reaction.

2.3. Experimental design We selected 252 limb-intact crabs from the above, and left cheliped autotomy was induced. To do so, the researcher gently grasped each limb, and the crab would spontaneously autotomize the corresponding limbs. Then, all of the autotomized crabs were randomly divided into four groups: Diet # A, Diet # B, Diet # C and Diet # D. Each diet group had three replicates. The crabs were then immediately returned to the aerated water in monoculture systems and to aquaculture under the environmental conditions described above.

2.4. Sample collection A previous study shows that 14 d of a diet supplemented with individual amino acids can modulate physiological patterns in aquatic animals (Conceição et al., 2012). The feeding trial lasted two weeks to evaluate the effects of short-term dietary supplementation with L-trp on cheliped regeneration, hepatopancreas digestive enzyme activity, MT and L-trp levels, regeneration-related genes and 5-HT, DA receptor gene expression following cheliped autotomy. Crab cheliped buds were measured every 3 days for 12 days using a digital micrometer and dissecting microscope. The length of each cheliped bud was converted to a standardized R-value: R = (limb bud length / carapace width)*100 (Tilden et al., 1997). The eyestalk and hepatopancreas were immediately wrapped in tinfoil and stored at −20 °C for determination of MT levels. Hepatopancreas, intestine, epidermis, muscle, cranial ganglia and thoracic ganglia samples were stored at −80 °C for RNA isolation and further analysis using qRT-PCR to evaluate the expression level of regeneration-related genes (EcR, MIH and Chi), 5-HT and DA related receptor genes (5-HT 1BR, 5-HT 2BR, 5HT 7R, DA 1AR and DA 2R). The remaining hepatopancreas samples were stored at −20 °C for evaluation of digestive enzyme activities. Muscle was collected for determination of L-trp concentration.

Primers

Sequences (5′-3′)

EcR-F EcR-R MIH-F MIH-R Chi-F Chi-R 5-HT 1BR-F 5-HT 1BR-R 5-HT 2BR-F 5-HT 2BR-R 5-HT 7R-F 5-HT 7R-R DA 1AR-F DA 1AR-R DA 2R-F DA 2R-R 18S-F 18S-R

GGGCATCGGGCTACCACTACAAC GGCACTGAGACTCGGGCACAACA TGAAGACTGCGCCAACATCT GCTCGTCAGGGTAGGTGGTG GAGCCCTACGTCTACAGCATCAC GGTCTCAACACTCCAAACCATCA GCCAGGAAGCGCATCAGACGCA GGGTGAGGGCTGAGAGGACAT AGGCGACGAAGGTTCTGGGTGTGGT ACCAGGTTGATCATCTCCTCCCCGA ATCATTATGAGCGCCTTCGT AGGCACAGAGTCTCCTGGAA CCGGACAGCTCCACCAAAGT AGGGCAGCCAGCACACGATA TGCTATTATCTGGGTGGTGT ATGATGAAGTCTGCGTTGTG TCCAGTTCGCAGCTTCTTCTT AACATCTAAGGGCATCACAGA

2.6. Evaluation of hepatopancreas digestive ability α-Amylase, trypsin, and lipase activity levels were measured using a UV-spectrophotometer (Beijing Purkinje General Instrument Co., Ltd.) at 253 nm, 660 nm, and 420 nm with corresponding detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. 2.7. Determination of MT levels After accurately weighing the eyestalk and hepatopancreas samples, we placed them into the EP tube, added an appropriate amount of HPLC-grade methanol, ground the samples, applied ultrasonic extraction for 30 min, centrifuged at 4500 r/min for 10 min, and moved the supernatant to another new tube. We then added 2 mL of HPLC-grade methanol to the precipitate. The above steps were repeated three times after thoroughly mixing the samples. After combining the samples with extracts, they were centrifuged at 4500 r/min for 10 min and then extracted by Welchrom® BRP Solid Phase Extraction (200 mg/3 mL, 50 pk, Welch Materials, Inc., China), and the extract was then collected and dried in a constant temperature water bath of 37 °C with a nitrogen stream. The residue was dissolved in 300 μL of HPLC-grade methanol and filtered through a 0.45 μm filter for ultra-performance liquid chromatography-ultraviolet detection (UPLC-UV) (Acquity UPLC- HClass-UV detector, Waters Corporation, U.S.A). A C18 (Acquity UPLC® BEH C18 1.7 μm, 2.1 mm × 50 mm Column) column was selected, the mobile phase was composed of water + methanol = 75 + 25 (LiChrosolv® Methanol, hypergrade for LC-MS, EMD Millipore Corporation, Germany), the flow rate was measured at 0.4 mL/min, the ultraviolet (UV) detection wavelength was measured at 222 nm, the injection volume was 2 μL, and the column was set to a temperature of 40 °C.

2.5. Expression levels of regeneration-related genes, 5-HT and DA related receptor genes: quantitative RT-PCR Total RNA was extracted from the hepatopancreas, intestine, epidermis, muscle, cranial ganglia and thoracic ganglia tissues using RNAisoTM plus reagent (RNA Extraction Kit, TaKaRa, Japan) according to the manufacturer's protocol. The concentration and quality of the total RNA were estimated by micro-volume ultraviolet-visible spectrophotometer (Quawell Q5000; Thmorgan, China) and agarose-gel electrophoresis, respectively and reverse transcribed with the PrimeScript™ RT reagent Kit (Perfect Real Time, TaKaRa, Japan) according to the manufacturer's protocol. The obtained cDNA that was diluted to 1:2 with double-distilled water was used as qRT-PCR template. Relative quantification was performed using the ABI 7500 Real-Time PCR System (Life Technology, USA) with a ChamQ™ Universal SYBR® qPCR Master Mix (Vazyme Biotech Co.,Ltd., Nanjing, China) kits using the following program: 95 °C for 30s; 40 cycles at 95 °C for 5 s, 60 °C for 34 s; followed by a melting curve at 95 °C for 15 s, 60 °C for 1 min, 95 °C for 15 s. The PCR primer sequences were shown in Table 2 (Sangon Biotech Co., Ltd., Shanghai, China). 18 s was used as the internal control and performed in triplicate for every sample. Relative changes in gene expression levels were determined by 2-△△Ct method. Data were analyzed and presented as average values ± standard deviation (SD) as well as the n-fold difference relative to the control data.

2.8. Determination of muscle moisture and L-trp content To prevent high temperatures from destroying amino acids in the muscle tissue, we used a vacuum freeze-drying method to measure the muscle moisture. Details are as follows: a 5-mL Eppendorf tube was dried in a 55 °C air dry oven, removed and then cooled in a dry environment. The weight of the Eppendorf tube + wet muscle was accurately determined with an electronic balance (W1), then transferred to a − 40 °C freezer for 2 h, and then placed in a vacuum freeze drier (−40 °C) for 48 h until completely dried and accurately weighed (W2).

Muscle moisture = W1–W2 3

Aquaculture 511 (2019) 734205

C. Zhang, et al.

The freeze-dried muscles described above were used for the determination of L-trp content. Determination of L-trp content is based on the National Standard of the People's Republic of China, “determination of amino acids in feed” (GB/T 18246–2000), using alkaline hydrolysis pretreatment, and the of L-trp content in muscle was determined by reversed-phase high-performance liquid chromatography (RP-HPLC). A C18 (μ- Bondapak Cl8 column, diameter 25 cm × 4.6 mm) column was selected, the mobile phase was composed of sodium acetate buffer + methanol = 95 + 5, the flow rate was 1.5 mL/min, ultraviolet (UV) detection wavelength was 280 nm, the injection volume was 15 μL, and the column was at room temperature. 2.9. Statistical analyses Data are presented as the average values of 10 replicates ± standard deviation (SD). In addition, the percentage values (dependent variable) were arcsine transformed before the analysis. A Tukey's Honestly Significant Difference Test (Tukey's HSD) and one-way ANOVA were used to analyze the statistical significance between the five groups, and a P-value < .05 was considered significant. All statistical analyses were performed using SPSS 20.0 software (Chicago, USA; Version 22.0). 3. Results 3.1. Cheliped regeneration 3.1.1. Growth of the cheliped bud Fig. 1 illustrates levels of cheliped bud growth observed over 14 days in crabs with different dietary supplementations of L-trp, and cheliped bud lengths were converted to a standardized R-value: R = (limb bud length /carapace width) * 100. R-values of the Diet # C and Diet # D groups were significantly higher than those of the control group (Diet # A group) after 5 d, 10 d and 14 d (P < .05), and the Rvalue of the Diet # B group was significantly higher than that of the Diet # A group (P < .05). However, we found no significant difference in R-values among the Diet # C and Diet # D groups. 3.1.2. The expression levels of regeneration-related genes: EcR, MIH, and Chi To investigate the effects of L-trp dietary supplementation on regeneration-related gene expression during E. sinensis cheliped regeneration, total RNA extracted from the hepatopancreas, intestines, epidermis and muscles was subjected to quantitative real-time PCR using the primer pairs listed in Table 2. The expression of EcR-mRNA in hepatopancreas was found to be significantly higher in the Diet # D group than in the other groups (P < .05). In the intestines, expression levels of EcR-mRNA in different dietary groups showed a tendency to first increase and then decrease. However, we found no significant difference between the control group and the other groups. The

Fig. 2. Levels of regeneration-related gene expression normalized to 18 s in the hepatopancreas, intestines, epidermis and muscles of E. sinensis for the four dietary groups. (A) EcR: ecdysteroid receptor gene; (B) MIH: molt-inhibiting hormone gene; and (C) Chi: chitinase gene. Values are expressed as means ± SD (n = 4). Different letters shown above the columns represent significant differences observed between treatments (P < .05).

expression of EcR-mRNA in the epidermis was significantly higher in the Diet # B group than in the Diet # A group (P < .05). Moreover, the expression of EcR-mRNA in muscles was significantly higher in the Diet # C and Diet # D groups than in the Diet # A group (P < .05) (Fig. 2 A). Levels of Chi-mRNA expression followed a similar trend to that of EcR-mRNA (Fig. 2 A and B). The expression of Chi-mRNA in the hepatopancreas, intestines and muscles was significantly more pronounced in the Diet # C and Diet # D groups than in the Diet # A group (P < .05), although no significant difference we observed in the epidermis (Fig. 2 B). MIH-mRNA expression levels exhibited the opposite trend to that of EcR-mRNA and Chi-mRNA (Fig. 2). Expression levels of MIH-mRNA in

Fig. 1. The growth of cheliped buds in E. sinensis was measured for all groups after 14 days of dietary treatment. Values are expressed as means ± SD (n = 10). Different letters shown above the column represent significant differences (P < .05). 4

Aquaculture 511 (2019) 734205

C. Zhang, et al.

Table 3 Effects of L-trp supplementation on digestive enzyme activity in E. sinensis after 14d (n = 5). Digestive enzymes

Groups Diet # A

α-Amylase activity (U/mgprot) Trypsin activity (U/gprot) Lipase activity (U/gprot)

Diet # B a

0.54 ± 0.17 0.31 ± 0.03a 9.74 ± 2.84a

Diet # C a

0.55 ± 0.09 0.31 ± 0.06ab 36.23 ± 2.07b

Diet # D a

0.65 ± 0.12 0.64 ± 0.21b 35.25 ± 12.02b

0.99 ± 0.17b 0.54 ± 0.11ab 41.26 ± 12.44b

Note: Values are expressed as means ± SD (n = 5). Different letters represent significant differences observed between treatments (P < .05).

3.3.2. Expression levels of DA related-receptor genes: DA 1AR and DA 2R To investigate effects of the dietary supplementation of L-trp on DA related-receptor gene expression during E. sinensis cheliped regeneration, total RNA extracted from the cranial ganglia, thoracic ganglia, hepatopancreas and intestines was subjected to quantitative real-time PCR using the primers pairs listed in Table 2. The dietary supplementation of L-trp significantly upregulated the expression of DA 1ARmRNA in the cranial ganglia, thoracic ganglia, hepatopancreas and intestines of E. sinensis (P < .05) while it was significantly decreased in the Diet # D group (P < .05) (Fig. 5 A). The expression of DA 2R-mRNA in the cranial ganglia and thoracic ganglia was significantly more pronounced in the Diet # B group than in the other groups (P < .05) while it was significantly decreased in the intestines with the supplementation of dietary L-tryptophan (P < .05) (Fig. 5 B).

the hepatopancreas, intestines and epidermis were significantly lower in the Diet # D group than in the Diet # A group (P < .05), although no significant differences were observed in the muscles (Fig. 2 C). 3.1.3. Digestive enzyme activity in the hepatopancreas The results showed that α-amylase activity was significantly improved in the Diet # D group (0.99 ± 0.17 U/mgprot) relative to the other groups (P < .05). Trypsin activity reached maximum levels in the Diet # C group (0.64 ± 0.21 U/gprot) and was found to be significantly higher than those of the Diet # A group (0.31 ± 0.03 U/ gprot) (P < .05). Moreover, lipase activity observed in the Diet # B, Diet # C and Diet # D groups (36.23 ± 2.07 U/gprot, 35.25 ± 12.02 U/gprot, and 41.26 ± 12.44 U/gprot, respectively) was significantly enhanced relative to that of the Diet # A group (9.74 ± 2.84 U/gprot) (P < .05), although no significant difference between the three groups was found (Table 3).

4. Discussion

3.2. MT and L-trp levels

In the pond culture of E. sinensis, a variety of natural and human factors spur higher limb-autotomy rates (Zhang et al., 2018a), which seriously affect and restrict the quality and economic aquaculture benefits of crabs. It is thus meaningful to study means of promoting limb regeneration that can also enhance the immunity of crabs with limb-autotomy. In the present study, we found that dietary L-trp supplementation significantly promotes the cheliped regeneration of E. sinensis. We thus explored mechanisms of L-trp promoting cheliped regeneration in relation to regeneration-related genes expression, hepatopancreas digestion, and 5-HT- and DA-related receptor gene expression. We also evaluated the effects of exogenous supplementation of L-trp on endogenous MT and L-trp content levels.

MT content levels in eyestalk samples increased dose-dependently with the dietary supplementation of L-trp and were significantly higher in the Diet # D group (344.54 ± 51.75 pg/mg eyestalk) than in the control group (Diet # A group: 164.09 ± 38.20 pg/mg eyestalk) (P < .05). Hepatopancreas MT content levels showed no significant variations between the different dietary groups (P > .05). Although muscle moisture did not change significantly, the L-trp content in muscles were significantly higher in the Diet # C (0.90 ± 0.03%) and Diet # D (0.90 ± 0.02%) groups than in the control group (0.82 ± 0.02%) (P < .05) (Fig. 3 C and D). 3.3. 5-HT and DA receptor gene expression

4.1. Effects of dietary L-trp supplementation on regeneration-related gene expression

3.3.1. The expression of 5-HT related-receptor genes: 5-HT 1BR, 5-HT 2BR and 5-HT 7R To investigate the effects of L-trp dietary supplementation on 5-HT related-receptor gene expression during E. sinensis cheliped regeneration, total RNA extracted from the cranial ganglia, thoracic ganglia, hepatopancreas and intestines was subjected to quantitative real-time PCR using the primer pairs listed in Table 2. The expression of 5-HT 1BR-mRNA in the cranial ganglia and thoracic ganglia was significantly higher for the Diet # C group than for the other groups (P < .05) while it was significantly less pronounced in the intestines with the supplementation of dietary L-tryptophan (P < .05) (Fig. 4 A). The expression of 5-HT 2BR-mRNA in the cranial ganglia and thoracic ganglia was enhanced dose-dependently with the dietary supplementation of L-trp, and it was significantly higher for the Diet # D group than for the other groups (P < .05). However, the expression of 5-HT 2BR-mRNA followed the opposite trend in the hepatopancreas and intestines, and it significantly declined with the dietary supplementation of L-trp (P < .05) (Fig. 4 B). The dietary supplementation of L-trp significantly upregulated the expression level of 5-HT 7R-mRNA in the cranial ganglia, thoracic ganglia, hepatopancreas and intestines of E. sinensis (P < .05) (Fig. 4 C).

The limb regeneration of crabs occurs under the joint regulation of ecdysteroid (mainly produced in the Y-organ) and molt-inhibiting hormones (MIHs) (mainly produced in the eyestalk) (Hopkins, 1992). Ecdysteroid promotes limb regeneration while MIHs inhibit the release of ecdysteroid and directly or indirectly inhibit limb regeneration (Hopkins, 1992). Tilden et al. (1997) reported that MT can promote the limb regeneration of Uca pugilator and speculated that MT may promote crab limb regeneration by inhibiting the release of MIH or by directly stimulating the release of ecdysteroid (Tilden et al., 1997). Our previous study shows that MT injection can significantly promote the cheliped regeneration of E. sinensis and that the expression of EcRmRNA is significantly upregulated while the expression of MIH-mRNA is significantly downregulated (Zhang et al., 2018c). Similar results have been derived from the Scylla serrata injection of MT (Girish et al., 2015a). As a precursor of MT, we studied the effects of dietary L-trp supplementation on regeneration-related genes. The results show that the dietary supplementation of 0.70% L-trp significantly upregulates EcR-mRNA expression in hepatopancreas, that the dietary supplementation of 0.40% L-trp significantly upregulates EcR-mRNA expression in the epidermis and that the dietary supplementation of 0.53% and 0.70% L-trp significantly upregulates EcR-mRNA expression in 5

Aquaculture 511 (2019) 734205

C. Zhang, et al.

Fig. 3. Effects of L-trp dietary supplementation on MT and L-trp content in E. sinensis. (A) MT content in eyestalk samples; (B) MT content in the hepatopancreas; (C) muscle moisture; (D) L-trp content in muscles. Values are expressed as means ± SD (n = 5). Different letters shown above the columns represent significant differences observed between treatments (P < .05).

enhanced through the dietary supplementation of 0.53% L-trp. Similarly, lipase activity levels are significantly enhanced with the dietary supplementation of L-trp. Svatos et al. (1994) found that L-trp can activate amylase, lipase and trypsin in vitro (Svatos, 1994). Kushak et al. (2002) found that L-trp can increase amylase activity levels (Kushak et al., 2002). Mardones et al. (2018) found that the dietary supplementation of L-trp significantly promotes the activity of alkaline protease in Salmo salar and the activity of lipase in Oncorhynchus kisutch (Mardones et al., 2018). Moreover, Tang et al. (2013) analyzed the effects of dietary Trp supplementation on intestinal digestive enzyme activities of Cyprinus carpio var. Jian and found that Trp can enhance digestion and absorption functions and promote protein synthesis (Tang et al., 2013). Similar results were derived in the present study where the dietary supplementation of L-trp significantly improved the digestive hepatopancreas capacities of E. sinensis. Our previous studies show that hepatopancreas digestive enzyme activities of E. sinensis are significantly enhanced after the injection of MT (Zhang et al., 2018c), echoing the results of the present study. Therefore, the digestive capacities of the hepatopancreas are significantly enhanced through dietary L-trp supplementation, which facilitates the digestion and absorption of nutrients and further accelerates the growth and limb regeneration of E. sinensis. Moreover, as the precursor of MT, dietary L-trp supplementation and MT injection have similar effects on regenerationrelated gene expression and digestive enzyme activity. We speculate that the exogenous supplementation of L-trp can increase endogenous MT levels while MT may be a direct functional substance that promotes limb regeneration. Accordingly, we further measured MT levels in the eyestalk and hepatopancreas and L-trp levels in muscles.

muscles. The expression of MIH-mRNA showed that the dietary supplementation of 0.70% L-trp significantly downregulates MIH-mRNA expression in the hepatopancreas and intestines and that the dietary supplementation of 0.40%, 0.53% and 0.70% L-trp significantly downregulates MIH-mRNA expression in the epidermis. Similar to the effects of MT injection (Zhang et al., 2018c), the dietary supplementation of L-trp may promote the expression of EcR-mRNA and inhibit the expression of MIH-mRNA, thereby promoting limb regeneration in E. sinensis. E. sinensis limb regeneration is relatively slow and typically involves the completion of a full molting cycle (He et al., 2016). Chi is essential for the hardening of soft shells after molting and limb regeneration. Studies of Fenneropenaeus chinensis show that the expression of ChimRNA is positively regulated by retinoid X receptor (rxr) while RXR and ECR have synergistic effects (Girish et al., 2015b; Priya et al., 2009). In the present study, we found that the dietary supplementation of 0.53% and 0.70% L-trp significantly upregulates the expression of Chi-mRNA in the hepatopancreas, intestines and muscles and that effects of dietary supplementation 0.53% L-trp were the best. Similar results are given in our previous work on MT injections (Zhang et al., 2018c). These results show that the dietary supplementation of L-trp can promote the cheliped regeneration of E. sinensis by upregulating the expression of positive regeneration-related genes (EcR and Chi) and downregulating the expression of negative regenerative genes (MIH). 4.2. Effects of dietary L-trp supplementation on digestive capacities of the hepatopancreas In crustaceans, digestive enzyme activity directly reflects capacities to digest and absorb nutrients, thereby shaping an animal's growth and development (Lin et al., 2015). In the present study, we found that the dietary supplementation of 0.70% L-trp significantly increases α-amylase activity levels and that trypsin activity levels are significantly

4.3. Effects of dietary L-trp supplementation on MT and L-trp levels Essential amino acid L-trp is the precursor of monoamine neurotransmitters 5-HT and MT (Boadle-Biber, 1993). An increased dietary 6

Aquaculture 511 (2019) 734205

C. Zhang, et al.

Fig. 5. Levels of DA related-receptor gene expression normalized to 18 s for the cranial ganglia, thoracic ganglia, hepatopancreas and intestines of E. sinensis for the four dietary groups. (A) DA 1A receptor gene; (B) DA 2 receptor gene. Values are expressed as means ± SD (n = 4). Letters shown above the columns represent significant differences observed between treatments (P < .05).

Kisutch show that the dietary supplementation of L-trp significantly increases L-trp and MT levels in vivo (Lepage et al., 2005; Mardones et al., 2018) consistent with our results. 4.4. Effects of dietary L-trp supplementation on 5-HT and DA receptor gene expression

Fig. 4. Levels of 5-HT related-receptor gene expression normalized to 18 s in the cranial ganglia, thoracic ganglia, hepatopancreas and intestines of E. sinensis for the four dietary groups. (A) 5-HT 1B receptor gene; (B) 5-HT 2B receptor gene; and (C) 5-HT 7 receptor gene. Values are expressed as means ± SD (n = 4). Different letters shown above the columns represent significant differences observed between treatments (P < .05).

5-HT and DA are biological amines that typically act as neurotransmitters or neuromodulators to regulate several important physiological functions, and they are widely distributed in the central and peripheral nerve tissues of crustaceans. 5-HT and DA are involved in mediating several important physiological functions of vertebrates and invertebrates such as reproduction (Sukthaworn et al., 2013), feeding regulation (Pratt et al., 2016), aggressive behavior (Aquiloni et al., 2012), and tissue regeneration (Mohanan et al., 2006; Yang et al., 2017a). 5-HT and DA in the extracellular or synaptic cleft must combine with corresponding receptors on the cell or postsynaptic membrane to function. There are many subtypes of 5-HT and DA receptors, and the receptors of different subtypes have different affinities to 5-HT and DA, target actions and positions, influencing 5-HT and DA roles (Sosa et al., 2004; Tierney, 2001). While our laboratory has cloned the gene sequences of 5-HT 1B, 5-HT 2B and 5-HT7 receptors and of DA1A and DA2 receptors of E. sinensis, how these receptors affect how L-trp regulates limb regeneration remains unclear. In the present study, we found that the dietary supplementation of

intake of L-trp can lead to an increase in L-trp levels in vivo, thereby increasing rates of 5-HT biosynthesis in animals (Boadle-Biber, 1993; Johnston et al., 1990) and further leading to an increase in MT levels (Lepage et al., 2005). In mammals, MT levels in the gastrointestinal tract are affected by different nutritional conditions (e.g., the ingestion of Trp) (Huether et al., 1991). MT levels in the plasma of rats with pinealectomy can increase with Trp ingestion (Huether et al., 1991). We found that the dietary supplementation of L-trp significantly increases L-trp levels in muscles of E. sinensis. We further determined MT levels in the eyestalk and hepatopancreas and found that the dietary supplementation of L-trp significantly increases MT levels in the eyestalk. Studies of Oncorhynchus mykiss, Salmo salar and Oncorhynchus 7

Aquaculture 511 (2019) 734205

C. Zhang, et al.

Fig. 6. Mechanism model of L-trp regulating limb regeneration in E. sinensis.

thereby promoting the growth and cheliped regeneration of E. sinensis with cheliped autotomy. Further, 5-HT 1BR, 5-HT2BR and DA 1AR in the hepatopancreas and intestines have an inhibitory effect on digestion and absorption while 5-HT 7R and DA2 enhance digestion and absorption capacities. However, tissue regeneration not only refers to structural regeneration but more importantly involves the recovery of physiological functions of regenerated tissue. Incompletely regenerated tissue in the nervous system may not be able to perform normal physiological functions. Therefore, the nervous system plays an important role in the functional recovery of regenerative tissues. Studies have shown that neurotransmitters (e.g., DA and 5-HT) have important regulatory effects on the recovery of regenerative tissue functions (Wu, 2014). Yang et al. (2017a, 2017b) studied damaged tissue regeneration in zebrafish and found that DA plays an important role in the regeneration of nerve tissue (Yang et al., 2017a). In the present study, we found that dietary L-trp supplementation significantly upregulates the expression of 5-HT 1BR-mRNA, 5-HT 2BR-mRNA, 5-HT 7R-mRNA, DA 1AR-mRNA and DA 2R-mRNA in the cranial and thoracic ganglia. We speculate that 5-HT and DA may be involved in the nerve tissue repair of regenerated tissue with the mediation of the above receptors during E. sinensis cheliped regeneration. However, specific mechanisms of 5-HT and DA-mediated tissue regeneration and nerve repair involved during the cheliped regeneration of E. sinensis require further examination. In summary, based on our results we speculate that L-trp regulates the limb regeneration of E. sinensis through the mechanisms shown in Fig. 6. The regulation of limb regeneration by L-trp is mainly executed by 5-HT, DA and MT. The digestion and absorption capacities of digestive organs and the repair of physiological functions of regenerative tissues occur by altering the expression of 5-HT- and DA-related receptor genes in digestive organs and nervous tissues. We believe that MT is also involved in the above process and plays an important role. Moreover, MT regulates the structural remodeling of regenerative tissues by regulating digestion and absorption functions and the expression of regeneration-related genes. We thus confirm that the way in

L-trp significantly downregulates the expression of 5-HT 1BR-mRNA and 5-HT 2BR-mRNA in the hepatopancreas and intestine. In human colon tissues, 5-HT binds to 5-HT 2BR, which contracts the colon (Borman et al., 2002). 5-HT 1BR and 5-HT2BR stimulated in the ventral tegmental area of the rat midbrain can alter food intake (Pratt et al., 2016). Moreover, the activation of 5-HT 1BR inhibits an animal's food intake (Halford and Blundell, 1996). Therefore, in the present study, we found that dietary L-trp supplementation significantly downregulates the expression of 5-HT 1BR-mRNA and 5-HT 2BR-mRNA in the hepatopancreas and intestines of E. sinensis, showing that L-trp promotes food intake and improves the digestive capacities of the hepatopancreas and intestines. Conversely, the dietary supplementation of L-trp significantly upregulates the expression of 5-HT 7R-mRNA in the hepatopancreas and intestines. 5-HT combined with 5-HT 7R can modulate intestinal smooth muscle relaxation, affecting intestinal digestion, absorption and motility (Tonini et al., 2005). Similarly, the expression of 5-HT 7R-mRNA was found to significantly increase in the hepatopancreas and intestines, indicating that digestive and absorptive capacities of the hepatopancreas and intestines were significantly improved. Moreover, we found that dietary L-trp supplementation significantly upregulates the expression of DA 1AR-mRNA and significantly downregulates the expression of DA 2R-mRNA in the hepatopancreas and intestines. DA receptors in the intestines are thought to be involved in the regulation of gastrointestinal motility (Perrot-Minnot et al., 2013). The inhibition of DA 1 receptor neurons results in a decline in food intake (Land et al., 2014) while the DA2 receptor can mediate the inhibition of feeding behavior (Khodadadi et al., 2017). The DA 1 and DA 2 receptors perform the opposite function in regulating feeding. In the present study, the dietary supplementation of L-trp significantly upregulated the expression of DA 1AR-mRNA and significantly inhibited the expression of DA 2R-mRNA in the hepatopancreas and intestines, indicating that the dietary supplementation of L-trp promotes feeding and intestinal functions of E. sinensis. Therefore, our results show that L-trp can promote digestion and absorption by regulating the expression of 5HT and DA-related receptor genes in the hepatopancreas and intestines, 8

Aquaculture 511 (2019) 734205

C. Zhang, et al.

which L-trp regulates the limb regeneration of E. sinensis is efficient, complex, and operable.

Cancer productus (Decapoda: Brachyura). Biol. Bull. 194, 53–62. Conceição, L.E., Aragão, C., Dias, J., Costas, B., Terova, G., Martins, C., Tort, L., 2012. Dietary nitrogen and fish welfare. Fish Physiol. Biochem. 38, 119–141. Esteban, S., Nicolaus, C., Garmundi, A., Rial, R.V., Rodríguez, A.B., Ortega, E., Ibars, C.B., 2004. Effect of orally administered L-tryptophan on serotonin, melatonin, and the innate immune response in the rat. Mol. Cell. Biochem. 267, 39–46. Fleming, P.A., Muller, D., Bateman, P.W., 2007. Leave it all behind: a taxonomic perspective of autotomy in invertebrates. Biol. Rev. Camb. Philos. Soc. 82, 481–510. Girish, B.P., Ch, S., Reddy, P.S., 2015a. Induction of ecdysteroidogenesis, methyl farnesoate synthesis and expression of ecdysteroid receptor and retinoid X receptor in the hepatopancreas and ovary of the giant mud crab, Scylla serrata by melatonin. Gen. Comp. Endocr. 217-218, 37–42. Girish, B.P., Ch, S., Reddy, P.S., 2015b. Induction of ecdysteroidogenesis, methyl farnesoate synthesis and expression of ecdysteroid receptor and retinoid X receptor in the hepatopancreas and ovary of the giant mud crab, Scylla serrata by melatonin. Gen. Comp. Endocrinol. 217-218, 37–42. Halford, J.C., Blundell, J.E., 1996. The 5-HT1B receptor agonist CP-94,253 reduces food intake and preserves the behavioural satiety sequence. Physiol. Behav. 60, 933–939. Harlıoğlu, M.M., Harlıoğlu, A.G., Yonar, S.M., Duran, T.Ç., 2014. Effects of dietary ltryptophan on the agonistic behavior, growth, and survival of freshwater crayfish Astacus leptodactylus Eschscholtz. Aquacult. Int. 22, 733–748. He, J., Wu, X., Cheng, Y., 2016. Effects of limb autotomy on growth, feeding and regeneration in the juvenile Eriocheir sinensis. Aquaculture. 457, 79–84. Höglund, E., Sørensen, C., Bakke, M.J., Nilsson, G.E., Overli, O., 2007. Attenuation of stress-induced anorexia in brown trout (Salmo trutta) by pre-treatment with dietary ltryptophan. Br. J. Nutr. 97, 786–789. Hopkins, P.M., 1992. Hormonal control of the molt cycle in the fiddler crab Uca pugilator. Am. Zool. 32, 450–458. Huether, G., Poeggeler, B., Reimer, A., George, A., 1991. Effect of tryptophan administration on circulating melatonin levels in chicks and rats: evidence for stimulation of melatonin synthesis and release in the gastrointestinal tract. Life Sci. 51, 945–953. Johnston, W.L., Atkinson, J.L., Hilton, J.W., Were, K.E., 1990. Effect of dietary tryptophan on plasma and brain tryptophan, brain serotonin, and brain 5-hydroxyindoleacetic acid in rainbow trout. J. Nutr. Biochem. 1, 49–54. Khodadadi, M., Zendehdel, M., Baghbanzadeh, A., Babapour, V., 2017. Consequence of dopamine D2 receptor blockade on the hyperphagic effect induced by cannabinoid CB1 and CB2 receptors in layers. Br. Poultry Sci. 58, 585–593. Kushak, R.I., Drapeau, C., Winter, H.S., 2002. Pancreatic and intestinal enzyme activities in rats in response to balanced and unbalanced plant diets. Plant Food Hum. Nutr. 57, 245–255. Land, B.B., Narayanan, N.S., Liu, R.J., Gianessi, C.A., Brayton, C.E., Grimaldi, D.M., Sarhan, M., Guarnieri, D.J., Deisseroth, K., Aghajanian, G.K., 2014. Medial prefrontal D1 dopamine neurons control food intake. Nat. Neurosci. 17, 248–253. Laranja Jr., J.L.Q., Quinitio, E.T., Catacutan, M.R., Coloso, R.M., 2010. Effects of dietary L-tryptophan on the agonistic behavior, growth and survival of juvenile mud crab Scylla serrata. Aquaculture 310, 84–90. Lepage, O., Larson, E.T., Mayer, I., Winberg, S., 2005. Tryptophan affects both gastrointestinal melatonin production and interrenal activity in stressed and nonstressed rainbow trout. J. Pineal Res. 38, 264–271. Lin, J., Zhang, Q., Wensheng, L.I., 2015. Comparison of the digestive enzyme activity of Nile tilapia (Oreochromis niloticus) in different farming modes. J. Fish. China 39, 65–74. Maciel, F.E., Ramos, B.P., Geihs, M.A., Vargas, M.A., Cruz, B.P., Meyerrochow, V.B., Vakkuri, O., Allodi, S., Monserrat, J.M., Nery, L.E., 2010. Effects of melatonin in connection with the antioxidant defense system in the gills of the estuarine crab Neohelice granulata. Gen. Comp. Endocr. 165, 229–236. Maciel, F.E., Geihs, M.A., Cruz, B.P., Vargas, M.A., Allodi, S., Marins, L.F., Nery, L.E., 2014. Melatonin as a signaling molecule for metabolism regulation in response to hypoxia in the crab Neohelice granulata. Int. J. Mol. Sci. 15, 22405–22420. Mardones, O., Devia, E., Labbé, B.S., Oyarzún, R., Vargas-Chacoff, L., Muñoz, J.L.P., 2018. Effect of L-tryptophan and melatonin supplementation on the serotonin gastrointestinal content and digestive enzymatic activity for Salmo salar and Oncorhynchus kisutch. Aquaculture. 482, 203–210. Mcvean, A., Findlay, I., 1979. The incidence of autotomy in an estuarine population of the crab Carcinus maenas. J. Mar. Biol. Assoc. UK 59, 341–354. Meguid, M.M., Fetissov, S.O., Varma, M., Sato, T., Zhang, L., Laviano, A., Rossi-Fanelli, F., 2000. Hypothalamic dopamine and serotonin in the regulation of food intake. Nutrition. 16, 843–857. Mohanan, V.V., Khan, R., Paulose, C.S., 2006. Hypothalamic 5-HT functional regulation through 5-HT1A and 5-HT2C receptors during pancreatic regeneration. Life Sci. 78, 1603–1609. Muñoz, J.L., Ceinos, R.M., Soengas, J.L., Míguez, J.M., 2009. A simple and sensitive method for determination of melatonin in plasma, bile and intestinal tissues by high performance liquid chromatography with fluorescence detection. J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 877, 2173–2177. Muñoz-Pérez, J.L., López-Patiño, M.A., Álvarez-Otero, R., Gesto, M., Soengas, J.L., Míguez, J.M., 2016. Characterization of melatonin synthesis in the gastrointestinal tract of rainbow trout (Oncorhynchus mykiss): distribution, relation with serotonin, daily rhythms and photoperiod regulation. J. Comp. Physiol. B. 186, 1–14. Perrot-Minnot, M.J., Dion, E., Cézilly, F., 2013. Modulatory effects of the serotonergic and histaminergic systems on reaction to light in the crustacean Gammarus pulex. Neuropharmacology. 75, 31–37. Pianesso, D., Neto, J.R., Silva, L.P.D., Goulart, F.R., Adorian, T.J., Mombach, P.I., Loureiro, B.B., Dalcin, M.O., Rotili, D.A., Lazzari, R., 2015. Determination of tryptophan requirements for juvenile silver catfish (Rhamdia quelen) and its effects on growth performance, plasma and hepatic metabolites and digestive enzymes activity.

5. Conclusion In the present study, we found that the dietary supplementation of L-trp can promote limb regeneration by regulating regeneration-related gene expression and hepatopancreatic digestion in E. sinensis. Further, the dietary supplementation of L-trp can significantly increase MT and L-trp levels in E. sinensis in vivo. As the precursor of MT, the dietary supplementation of L-trp and injection of MT have similar effects on cheliped regeneration and digestive functions of E. sinensis and can be used as an alternative to “injections of MT.” Moreover, our study preliminarily explored the role of 5-HT and DA receptors in the cheliped regeneration of E. sinensis and found that dietary L-trp supplementation significantly downregulates 5-HT 1BR-mRNA, 5-HT 2BR-mRNA and DA 1AR-mRNA expression and significantly upregulates 5-HT 7R-mRNA and DA 2R-mRNA expression in the hepatopancreas and intestines to promote feeding and digestive functioning. Moreover, dietary L-trp supplementation significantly upregulates the expression of 5-HT 1BRmRNA, 5-HT 2BR-mRNA, 5-HT 7R-mRNA, DA 1AR-mRNA and DA 2RmRNA in the cranial and thoracic ganglia, they may be involved in the nerve tissue repair of regenerated tissue during E. sinensis cheliped regeneration. This study effectively combines laboratory theories with aquaculture production practice and can be used as a reference and basis for improving the culture quality and economic benefits of E. sinensis in a convenient and feasible manner. At the same time, while the relationship between dietary L-trp and 5-HT- and DA-related receptors was preliminarily explored, specific mechanisms for the mediation of tissue regeneration and nerve repair require further study. Acknowledgements This work was supported by the Aquaculture Engineering Research Platform in Shanghai Established by Shanghai Science and Technology Commission [grant number 16DZ2281200]), the China Agriculture Research System [grant number CARS-48] and the Technical Research and Application Demonstration of Whole-compatible Feed in the Culture of Eriocheir sinensis by Jiangsu Province Fishery Science and Technology Project [grant number D2018-4]. Disclosure statement The authors have nothing conflict of interest. Author contributions Cong Zhang designed the experiment and wrote the article. Qian Zhang determined the hepatopancreas digestive ability and MT levels. Xiaozhe Song determined the expression level of regeneration-related genes. Yangyang Pang and Yameng Song determined the muscle moisture and L-trp content. Yiyue Wang, Long He and Jiahuan Lv assisted in collecting samples. Yongxu Cheng provided funding support. Xiaozhen Yang guided the experiment design and the writing of the article. References Aquiloni, L., Giulianini, P.G., Mosco, A., Guarnaccia, C., Ferrero, E., Gherardi, F., 2012. Crustacean hyperglycemic hormone (cHH) as a modulator of aggression in crustacean decapods. PLoS One 7, e50047. Boadle-Biber, M.C., 1993. Regulation of serotonin synthesis. Prog. Biophys. Mol. Biol. 60, 1–15. Borman, R.A., Tilford, N.S., Harmer, D.W., Day, N., Ellis, E.S., Sheldrick, R.L.G., Carey, J., Coleman, R.A., Baxter, G.S., 2002. 5-HT2B receptors play a key role in mediating the excitatory effects of 5-HT in human colon in vitro. Br. Aust. J. Pharm. 135, 1144–1151. Brock, R.E., Smith, L.D., 1998. Recovery of claw size and function following autotomy in

9

Aquaculture 511 (2019) 734205

C. Zhang, et al.

enzymes. Casopís Lékar Ceskych 133, 140. Tang, L., Feng, L., Sun, C.Y., Chen, G.F., Jiang, W.D., Hu, K., Liu, Y., Jiang, J., Li, S.H., Kuang, S.Y., 2013. Effect of tryptophan on growth, intestinal enzyme activities and TOR gene expression in juvenile Jian carp (Cyprinus carpio var. Jian): studies in vivo and in vitro. Aquaculture 412-413, 23–33. Tierney, A., 2001. Structure and function of invertebrate 5-HT receptors: a review. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 128, 791–804. Tilden, A.R., Rasmussen, P., Awantang, R.M., Furlan, S., Goldstein, J., Palsgrove, M., Sauer, A., 1997. Melatonin cycle in the fiddler crab Uca pugilator and influence of melatonin on limb regeneration. J. Pineal Res. 23, 142–147. Tonini, M., Vicini, R., Cervio, E., De, P.F., De, G.R., Barbara, G., Stanghellini, V., Dellabianca, A., Sternini, C., 2005. 5-HT7 receptors modulate peristalsis and accommodation in the guinea pig ileum. Gastroenterology. 129, 1557–1566. Wu, H., 2014. Ultrastructural observation and neurotransmitter analysis of tissue regeneration after amputation of Zebrafish lower jaw. Hans J. Agricult. Sci. 04, 73–80. Yang, Q., Wang, Q., Wu, H., Yan, J., 2017a. Expression characteristic analysis of neurotransmitters dopamine andγ-aminobutyric acid in damaged tissue regeneration in Zebrafish. Genom. Appl. Biol. 36, 201–209. Yang, X.Z., Zhang, C., Huang, G.Y., Xu, M.J., Cheng, Y.X., Yang, Z.G., Zhang, Q., Wang, Y.Y., 2017b. Cellular and biochemical parameters following autotomy and ablationmediated cheliped loss in the Chinese mitten crab, Eriocheir sinensis. Dev. Comp. Immunol. 81, 33–43. Zhang, C., Huang, G.Y., Xu, M.j., Pang, Y.Y., Cheng, Y.X., Yang, X.Z., 2018a. Research progress on limb autotomy and regeneration of crabs. Chin. J. Ecol. 37, 1584–1588. Zhang, C., Zhang, Q., Song, X., Pang, Y., Song, Y., Cheng, Y., Yang, X., 2018b. Dietary Ltryptophan modulates the hematological immune and antibacterial ability of the Chinese mitten crab, Eriocheir sinensis, under cheliped autotomy stress. Front. Immunol. 9, 2744. Zhang, C., Yang, X.Z., Xu, M.J., Huang, G.Y., Zhang, Q., Cheng, Y.X., He, L., Ren, H.Y., 2018c. Melatonin promotes Cheliped regeneration, digestive enzyme function, and immunity following autotomy in the Chinese mitten crab, Eriocheir sinensis. Front. Physiol. 9, 269–280.

Anim. Feed Sci. Tech. 210, 172–183. Pratt, W.E., Clissold, K.A., Lin, P., Cain, A.E., Ciesinski, A.F., Hopkins, T.R., Ilesanmi, A.O., Kelly, E.A., Pierce-Messick, Z., Powell, D.S., 2016. A systematic investigation of the differential roles for ventral tegmentum serotonin 1- and 2-type receptors on food intake in the rat. Brain Res. 1648, 54–68. Priya, T.A., Li, F., Zhang, J., Wang, B., Zhao, C., Xiang, J., 2009. Molecular characterization and effect of RNA interference of retinoid X receptor (RXR) on E75 and chitinase gene expression in Chinese shrimp Fenneropenaeus chinensis. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 153, 121–129. Riquelme, R., 2006. Incidence patterns of limb autotomy in the estuarine crab, Hemigrapsus crenulatus (H. Milne Edwards, 1837) (Brachyura, Grapsoidea) from a temperate estuary in the eastern South Pacific. Crustaceana 79, 925–932. Rodriguez, E.M., Paradoestepa, F.D., Quinitio, E.T., 2007. Extension of nursery culture of Scylla serrata (Forsskal) juveniles in net cages and ponds. Aquac. Res. 38, 1588–1592. Rubin, L.L., Canal, C.W., ALM, Ribeiro, Kessler, A., Silva, I., Trevizan, L., Viola, T., Raber, M., Goncalves, T.A., Krás, R., 2007. Effects of methionine and arginine dietary levels on the immunity of broiler chickens submitted to immunological stimuli. Rev. Brasil. Ciên. Avícola 9, 241–247. Sainath, S.B., Ch, S., Reddy, P.S., 2013. What do we (need to) know about the melatonin in crustaceans? J. Exp. Zool. A 319, 365–377. Senatori, O., Pierucci, F., Parvez, S.H., 2002. Monoamine oxidase in Teleosts. Biogen. Amines 17, 199–213. Simonson, J.L., 1985. Reversal of handedness, growth, and claw stridulatory patterns in the stone crab Menippe mercenaria (say) (Crustacea: Xanthidae). J. Crustacean Biol. 5, 281–293. Sosa, M.A., Spitzer, N., Edwards, D.H., Baro, D.J., 2004. A crustacean serotonin receptor: cloning and distribution in the thoracic ganglia of crayfish and freshwater prawn. J. Comp. Neurol. 473, 526–537. Sui, L., Wille, M., Cheng, Y., Wu, X., Sorgeloos, P., 2011. Larviculture techniques of Chinese mitten crab Eriocheir sinensis. Aquaculture. 315, 16–19. Sukthaworn, S., Panyim, S., Udomkit, A., 2013. Molecular and functional characterization of a dopamine receptor type1 from Penaeus monodon. Aquaculture. 380–383, 99–105. Svatos, A., 1994. The effect of amino acids, sugars and fats on activation of pancreatic

10