Long-term soft drink and aspartame intake induces hepatic damage via dysregulation of adipocytokines and alteration of the lipid profile and antioxidant status

Long-term soft drink and aspartame intake induces hepatic damage via dysregulation of adipocytokines and alteration of the lipid profile and antioxidant status

    Long-term soft drink and aspartame intake induces hepatic damage via dysregulation of adipocytokines and alteration of the lipid prof...

1MB Sizes 0 Downloads 116 Views

    Long-term soft drink and aspartame intake induces hepatic damage via dysregulation of adipocytokines and alteration of the lipid profile and antioxidant status Mohamed A Lebda, Hossam G Tohamy, Yasser S El-Sayed PII: DOI: Reference:

S0271-5317(17)30096-9 doi: 10.1016/j.nutres.2017.04.002 NTR 7740

To appear in:

Nutrition Research

Received date: Revised date: Accepted date:

30 January 2017 14 March 2017 13 April 2017

Please cite this article as: Lebda Mohamed A, Tohamy Hossam G, El-Sayed Yasser S, Long-term soft drink and aspartame intake induces hepatic damage via dysregulation of adipocytokines and alteration of the lipid profile and antioxidant status, Nutrition Research (2017), doi: 10.1016/j.nutres.2017.04.002

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Long-term soft drink and aspartame intake induces hepatic damage

RI P

and antioxidant status

T

via dysregulation of adipocytokines and alteration of the lipid profile

a

SC

Mohamed A Lebdaaa, Hossam G Tohamyb, Yasser S El-Sayedc Department of Biochemistry, Faculty of Veterinary Medicine, Alexandria University,

b

NU

Edfina 22758, Egypt

Department of Pathology, Faculty of Veterinary Medicine, Alexandria University, Edfina

c

MA

22758, Egypt

Department of Forensic Medicine and Toxicology, Faculty of Veterinary Medicine,

ED

Damanhour University, Damanhour 22511, Egypt

PT

Email addresses:

MAL: [email protected];

CE

[email protected]

AC

HGT: [email protected] YSE: [email protected]; [email protected]



Corresponding author: Mohamed A. Lebda, Department of Biochemistry, Faculty of Veterinary Medicine, Alexandria University, Edfina 22758, Egypt. Tel: +20-10-08479197; E. mail address: [email protected]; [email protected]

ACCEPTED MANUSCRIPT Abbreviations ALP, Alkaline phosphatase; ALT, Alanine aminotransferase;

RI P

T

ANOVA, Analysis of variance; AST, Aspartate aminotransferase;

SC

CAT, Catalase;

DTNB, 5.5-dithiobis 2 nitro-benzoic acid;

MA

GPx, Glutathione peroxidase; GSH, Reduced glutathione;

PT

H2O2, Hydrogen peroxide;

ED

GST, Glutathione-S-transferase; H&E, hematoxylin and eosin;

NU

CDNB, 1-chloro-2,4-dinitrobenzene;

CE

HDL-c, High-density lipoprotein-cholesterol; HFCS, High-fructose corn syrup;

AC

HSCs, Hepatic satellite cells;

LDL-c, Low-density lipoprotein–cholesterol; MDA, Malondialdehyde; NIH, National Institutes of Health; PBS, Phosphate buffer saline; PPAR, Peroxisome proliferator-activated receptors; SEM, Standard error of means; SOD, Superoxide dismutase; TAG, Triacylglycerol;

ACCEPTED MANUSCRIPT

AC

CE

PT

ED

MA

NU

SC

RI P

T

VLDL-c, Very-low-density lipoprotein-cholesterol

ACCEPTED MANUSCRIPT Abstract Dietary intake of fructose corn syrup in sweetened beverages is associated with the

RI P

T

development of metabolic syndrome and obesity. We hypothesized that inflammatory cytokines play a role in lipid storage and induction of liver injury. Therefore, this study intended to explore

SC

the expression of adipocytokines and its link to hepatic damage. Rats were assigned to drink water, cola soft drinks (free access) and aspartame (240 mg/kg body weight/day orally) for two months.

NU

The lipid profiles, liver antioxidants and pathology, and mRNA expression of adipogenic

MA

cytokines were evaluated. Subchronic intake of soft drinks or aspartame substantially induced hyperglycemia and hypertriacylglycerolemia, as represented by increased serum glucose,

ED

triacylglycerol, very-low-density lipoprotein- and very-low-density lipoprotein - cholesterol, with obvious visceral fatty deposition. These metabolic syndromes were associated with the

PT

upregulation of leptin and downregulation of adiponectin and peroxisome proliferator activated

CE

receptor-γ (PPAR-γ) expression. Moreover, alterations in serum transaminases accompanied by hepatic oxidative stress involving induction of malondialdehyde and reduction of superoxide

AC

dismutase, catalase, glutathione peroxidase and glutathione levels are indicative of oxidative hepatic damage. Several cytoarchitecture alterations were detected in the liver, including degeneration, infiltration, necrosis, and fibrosis, predominantly with aspartame. These data suggest that long-term intake of soft drinks or aspartame-induced hepatic damage may be mediated by the induction of hyperglycemia, lipid accumulation, and oxidative stress with the involvement of adipocytokines. Keywords: Sweetened beverages; Aspartame; Metabolic syndrome; Adipocytokines; Oxidative stress; Gene expression

ACCEPTED MANUSCRIPT 1. Introduction The consumption of sugar-sweetened soft drinks or beverages is very common all over the

T

world [1]. The main constituents of Coca-Cola are phosphoric acid, glucose/fructose sugar (high

RI P

fructose corn syrup) or artificial sweeteners, and caffeine, but their concentrations vary among different types of Cola [2]. Acesulfame K, aspartame, and cyclamates are the main artificial

SC

sweeteners that replace glucose/fructose sugar in beverages [3]. A direct relationship was reported

NU

between soft drink consumption and the incidence of obesity, type II diabetes mellitus, and metabolic syndrome [4, 5]. Previous researchers have indicated that increased consumption of

MA

fructose corn syrup in calorically sweetened beverages is associated with obesity [6]. Highfructose diets produce hypertriglyceridemia, hyperinsulinemia, insulin resistance, impaired

ED

glucose tolerance, and increased body weight [7]. The weight gain promoting effect of fructose

PT

can be attributed to the lack of insulin secretion and leptin production with disturbances in satiety [6, 8]. Moreover, Prabhakar, Reeta [9] found that the administration of fructose to rats produced

CE

significant hypertriglyceridemia and impaired glucose tolerance as well as insulin resistance

AC

associated with a reduction in peroxisome proliferator-activated receptors (PPAR-α/γ). Lozano, Van der Werf [10] reported that rats fed high-fructose beverages had a transient increase in leptin after two months, but the level of adiponectin was decreased in obese subjects [11]. A few studies suggest a lipogenic effect of sweetened-beverages, but whether aspartame

2. can induce obesity is not clear and further study is needed. Our

hypothesis is that, sweetened beverages and aspartame contribute to obesity. To test out hypothesis, we investigated the consequences of both sweetened beverages and aspartame on the expression of adipogenic cytokines (leptin, adiponectin, PPAR-γ) as well as on the serum lipid profile and hepatic antioxidant pathways in the rat. Our approach is a molecular-biochemical

ACCEPTED MANUSCRIPT interaction study to better understand how the intake of beverages is associated with obesity and increased body weight.Methods and materials

T

2.1. Animals

RI P

Thirty male 6-8 weeks of age Wistar strain Albino rats, weighing 187.67±15.14 g, were

SC

purchased from the Faculty of Science, Alexandria University. The animals were maintained under controlled environmental conditions with a 12 h light-dark cycle and had free access to water and

NU

food that was provided as follows: moisture (8.3%), crude protein (21.7%), crude fat (3.7%), ash (5.7%), crude fiber (5.2%), nitrogen free extract (53.3%), calcium (1.1%), phosphorous

MA

96 (0.9%) and vitamins (0.2%). The diet was formulated to meet all of the nutritional requirements of growing rats, including minerals, vitamins, protein, essential amino acids,

ED

essential fatty acids, and metabolizable energy [12]. This food was formulated to meet all of the

PT

nutritional requirements of growing rats, including minerals, vitamins, protein, essential amino acids and metabolizable energy [12]. The animal experiment was carried out in accordance with

CE

the National Institutes of Health (NIH) Guidelines for the Care and Use of Laboratory Animals,

AC

and the study protocol was approved by the committee of the Faculty of Veterinary Medicine, Alexandria University.

2.2. Chemicals and reagents Aspartame (N-L-α-aspartyl-L-phenylalanine-1-methyl ester, C14H18N2O5) was purchased from Sigma Chemical Company, St. Louis, MO, USA. Pepsi was obtained from a local market in Egypt. The QIAamp RNeasy Mini kit and QuantiTect SYBR Green PCR Master Mix were obtained from Qiagen, Germany, GmbH. Oligonucleotide primers were purchased from Biobasic Co., Canada. Biochemical assay kits were obtained from Biodiagnostic Co., Cairo, Egypt. All

ACCEPTED MANUSCRIPT other reagents, including those for analytical, high-performance liquid chromatography, were of the best available pharmaceutical grade.

T

2.3. Experimental design

RI P

Rats were allocated randomly into three groups (10 rats per group) as follows: Group I: the

SC

control group, allowed to drink water ad libitum. Group II: aspartame group, intragastrically intubated with aspartame, 240 mg/kg body weight (6 times the average daily dose in humans as

NU

rodents have higher metabolic rates than humans [13]). Group III: soft drink group, allowed to freely drink Coca-cola beverages according to Alkhedaide, Soliman [14] for two consecutive

MA

months. CO2 bubbles were removed from beverages by vigorous hand shaking, and the bottles were left open for 30 min. At the end of the experiment, the rats were anesthetized with

ED

ketamine/xylazine (7.5:10 mg/kg, 1 mg/kg i.p.). Blood was then withdrawn from the inner canthus

PT

of the eye into a clean tube for serum separation. Five animals from each group were randomly selected

and

then

immediately

CE

euthanized by the approved protocol. The adipose tissue and livers were collected and washed

AC

with ice-cold phosphate buffer saline (PBS) and then stored at −80 ºC until further analyses. The homogenate (10% w/v) of the liver tissue was prepared in a Teflon-glass tissue homogenizer using ice-cold PBS (100 mM, pH 7.4) and centrifuged separately in a cooling centrifuge at 705 ×g for 10 min. The supernatant was used to analyze the oxidative stress parameters. 2.4. Serum hepatic biomarkers and lipid profiles measurements Following the collection of blood samples, sera were separated by centrifugation at 2,500 ×g for 10 min at room temperature. Using commercially available colorimetric assay kits, the serum activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were spectrophotometrically estimated as the decreasing in absorbance due to oxidation of NADH to

ACCEPTED MANUSCRIPT NAD by pyruvate and oxaloacetate, respectively [15]. The activity of alkaline phosphatase (ALP) was spectrophotometrically measured following hydrolysis of p-nitrophenyl phosphate into p-

T

nitrophenol in alkaline medium at 405 nm [16]. Glucose concentration was measured by the

RI P

glucose oxidase-peroxidase test, which forms a more stable pink-coloured product, its intensity measured at 540 nm [17]. Total cholesterol content was measured by cholesterol oxidase-

SC

peroxidase (CHOD-PAP test) [18]. Triacylglycerol (TAG) concentration was determined

NU

according to the method of Bucolo and David [19]. High-density lipoprotein-cholesterol (HDL-c) was estimated by HDL-precipitating reagent [20]. Low-density lipoprotein–cholesterol (LDL-c)

MA

and very low density lipoprotein-cholesterol (VLDL-c) were calculated using Friedwald’s

ED

equations [21] as follow: VLDL-c = TAG/5, and LDL-c = Total cholesterol – (HDL-c + VLDL-c). 2.5. Hepatic oxidative and antioxidative indices measurements

PT

Lipid peroxidation was measured by estimating malondialdehyde (MDA), an intermediary product of lipid peroxidation, using thiobarbituric acid and expressed as nmol/g tissue [22].

CE

Superoxide dismutase (SOD) was conveniently assayed using the method of interference of free

AC

radicals in auto-oxidation of pyrogallol and is expressed as IU/min/g tissue [23]. Catalase (CAT) was assayed with standard hydrogen peroxide (0.2 M H2O2) as the substrate. The CAT activity was terminated at intervals of 0, 15, 30, and 60 s by the addition of potassium dichromate-acetic acid reagent and is expressed as IU/min/g tissue [24]. Glutathione peroxidase (GPx) activity was assayed by its ability to utilize standard glutathione in the presence of a specific amount of hydrogen peroxide (1 mM H2O2) and is expressed as IU/min/g tissue [25]. Glutathione-Stransferase (GST) was estimated by the method of Habig, Pabst [26]. The activity of GST in tissues is expressed as μmoles of 1-chloro-2,4-dinitrobenzene (CDNB) utilized/min/g tissue. Reduced glutathione (GSH) was measured by its reaction with 5.5-dithiobis 2 nitro-benzoic acid

ACCEPTED MANUSCRIPT (DTNB) to form a compound that absorbs at 412 nm [27]. The level of GSH is expressed as μmol of GSH/g tissue.

T

2.6. RNA extraction and gene expression

RI P

Approximately 100 mg of the adipose tissue sample was added to 600 µl of RLT buffer

SC

(containing 10 μl of β-mercaptoethanol/ml). For homogenization of the samples, tubes were placed into adaptor sets that were fixed into the clamps of a Qiagen Tissue Lyser. Disruption was

NU

performed by a 2 min high-speed (30 Hz) shaking step. One volume of 70% ethanol was added to the cleared lysate, and the steps were completed according to the Purification of Total RNA from

MA

Animal Tissues Protocol of the QIAamp RNeasy Mini kit (Qiagen, Germany, GmbH). Real-time RT-PCR was performed using QuantiTect SYBR Green PCR Master Mix (Qiagen, Germany,

ED

GmbH). A 25-µL reaction for each examined gene was prepared from 12.5 µL of the 2×

PT

QuantiTect SYBR Green PCR Master Mix (Qiagen, Germany, GmbH), 0.25 µL of RevertAid Reverse Transcriptase (Thermo Fisher), 0.5 µL of 20 pmol of each primer, 7.25 µL of water, and 4

CE

µL of RNA template. The primer sequences of the target genes are described in Table 1. The

AC

reaction was performed in a Stratagene MX3005P Real-Time PCR Machine. Amplification curves and Ct values were determined using the Agilent MX3005P software. To estimate the variation of gene expression in the RNA of the different samples, the Ct of each sample was compared with that of the positive control group according to the “ΔΔCt” method as stated by Yuan, Reed [28]. 2.7. Liver histopathology Liver specimens were collected from 5 animals per group, fixed in phosphate buffered formalin 10% and embedded in paraffin. They were used for the preparation of 5 μm sections stained with hematoxylin and eosin (H&E) following a standard protocol for histopathological assessment under a light microscope. The lesion scoring system was assessed as follows: (0) absence of the

ACCEPTED MANUSCRIPT lesion= 0%, (+) mild= 5-25%, (++) moderate= 26-50% and (+++) severe≥ 50% of the examined tissue sections.

T

2.8. Statistical analyses

RI P

Values are shown as the mean values ± standard error of mean (SEM). To evaluate differences

SC

among the treatment groups, one-way analysis of variance (ANOVA) followed by post hoc Duncan's multiple range tests were used. The sample size was calculated using the power

NU

procedure for one-way ANOVA, considering P <.05 with a power of 80%. Treatment differences

was used for all statistical analyses.

ED

3. Results

MA

were considered significant at P < .5. SPSS version 22.0 for Windows (IBM, Armonk, NY, USA)

3.1. Body weight

PT

Both soft drinks and aspartame intake groups were fed their respective diets ad libitum.

AC

(Table 2).

CE

However, following 8 weeks of intake, body weights were comparable (P < .05) among the groups

3.2. Assessment of liver function biomarkers The activities of the serum enzymes ALT, AST, and ALP were measured as biomarkers of liver function. The data presented in Table 3 shows that the serum AST in aspartame intake rats (96.68 ± 1.51 U/L) and soft drink intake rats (106.80 ± 4.77 U/L) was significantly (P < .05) increased compared to control rats (73.94 ± 2.85 U/L). In respect to serum ALT, no significant (P > .05) changes were found in the aspartame-treated group, but a significant (P < .05) decrease (40%) was evident in the soft drink intake rats compared to the control. Serum ALP activity was significantly (P < .05) reduced in animals that received aspartame (335.46 ± 26.66 U/L) and very

ACCEPTED MANUSCRIPT significantly (P < .01) reduced in those that received soft drinks (242.62 ± 17.49 U/L) versus controls (417.88 ± 14.08 U/L).

T

3.3. Serum lipid profile and glucose level

RI P

The results provided in Table 3 reveal that rats that received aspartame had a significant

SC

increase (P < .05) in the serum level of glucose (97.28 ± 1.23 mg/dL), TAG (117.57 ± 7.45 mg/dL), LDL-c (50.75 ± 4.35 mg/dL), and VLDL-c (23.65 ± 2.37 mg/dL) relative to the controls

NU

(87.12 ± 2.38, 95.12 ± 7.34, 41.67 ± 5.12, and 18.54 ± 3.87 mg/dL, respectively), with nonsignificant (P > .05) changes in the serum cholesterol and HDL-c levels. Interestingly,

MA

administration of soft drinks resulted in the same effects on the corresponding serum lipid profile and glucose level, with the exception of a significant increase (P < .05) in the serum cholesterol

ED

level (147.43 ± 11.51 mg/dL) compared to controls (115.23 ± 9.11 mg/dL).

PT

3.4. Liver lipid peroxidation and antioxidative indices

CE

MDA, GSH concentrations and antioxidant enzymatic activities (GPx, GST, CAT, and SOD) are shown in Table 4. Both soft drinks and aspartame administration had similar results concerning

AC

the oxidative/antioxidative indices. A significant increase (P < .05) in the hepatic MDA concentration (18 and 13%), significant (P < .05) decrease in the hepatic GSH concentration (35 and 35%), and decreased activities of GPx (26 and 23%), CAT (14 and 12%) and SOD (14 and 14%) were detected in rats that received soft drink and aspartame, respectively, compared to controls. However, the activity of the GST enzyme was non-significantly (P > .05) decreased in the treated groups compared to the control group. 3.5. mRNA expression of leptin, adiponectin, and PPAR-γ The mRNA expression of adipogenic proteins was measured using real-time PCR in adipose tissues (Fig. 1). The results showed that the relative mRNA expression of leptin was up-regulated

ACCEPTED MANUSCRIPT (P < .05) in the adipose tissue of rats that received soft drinks or aspartame compared to controls. Meanwhile, the intake of soft drinks or aspartame down-regulated (P < .05) the mRNA expression

RI P

T

of adiponectin and PPAR-γ cytokines compared to controls. 3.6. Liver histopathological findings

SC

Regular histological features of the livers in the control group showed well-formed central veins, sinusoidal spaces and cord-like arrays of hepatocytes around the central vein (Fig. 2A). The

NU

hepatic histoarchitectural findings in the soft drink group included congestion of the portal vein and edema, characterized by faint eosinophilic albuminous fluid in the portal area. Additionally,

MA

mild to moderate fatty changes in hepatocytes, characterized by sharp-edged vacuoles, flattened nuclei and a signet-ring appearance were also seen (Fig. 2B1, Table 5). Moreover, moderate

ED

bloodless sinusoidal dilatation, irregular appearance, and focal hepatic necrosis with inflammatory

PT

cells infiltration were observed (Fig. 2B2, Table 5).

CE

The encountered hepatic lesions in the aspartame group showed severe hydropic degeneration of hepatocytes (Table 5), which was characterized by swollen cells and clear fluids that replace the

AC

cytoplasm, but an unaffected nucleus in terms of shape or location. Additionally, intense inflammatory cell aggregation in the portal area, congestion of the portal vein with focal hepatic necrosis and infiltration of inflammatory cells were observed (Fig. 2C1, Table 5). Moreover, there were hemorrhages characterized by extravasation of RBCs from the blood vessels that replaced necrotic hepatocytes (Fig. 2C2, Table 5).

4. Discussion In this study, both sweetened beverages and aspartame caused visceral adiposity, impaired glucose tolerance and lipid profile, perturbated the hepatic antioxidants/oxidant status, and disturbed adipogenic cytokines. Regarding the impact of soft drinks on metabolic syndrome and

ACCEPTED MANUSCRIPT obesity, serum concentrations of glucose, TAG, VLDL-c, and LDL-c were substantially increased with obvious fatty deposition in the viscera despite no change in body weight. Fructose-containing

T

beverages increased hepatic fatty acid synthesis and de novo lipogenesis, leading to increased

RI P

serum TAG [29, 30] and VLDL-c [31], which have been linked to ectopic fat deposition in adipose and hepatic tissues. This may contribute to the visceral adiposity and hepatic fatty changes

SC

observed in our histopathological findings. The hyperglycemic effect of soft drinks was consistent

NU

with the results of Babacanoglu, Yildirim [32] who demonstrated that serum glucose, insulin, and TAG concentrations were increased following consumption of 10 and 20% high-fructose corn

syndrome

(hyperglycemia,

and

hypertriacylglycerolemia),

changes

in

ED

Metabolic

MA

syrup (HFCS)-containing solutions for a period of 12 weeks.

adipocytokines mRNA expression in fat tissues, and oxidative stress in the liver tissues were

PT

associated with the consumption of soft drinks. Adiponectin, an adipocytokine that is expressed

CE

and secreted by adipose tissue, has anti-inflammatory, antiatherogenic, and insulin sensitizing activities [33, 34]. Leptin is considered to be a pro-inflammatory agent and a potential hepatic

AC

fibrosis mediator [35]. PPAR-γ is a transcription factor that plays a central role in adipocyte biology and regulates adiponectin gene expression, processing, and secretion [36]. The impairment of the expression of these adipocytokines by soft drink consumption contributed to the hepatic inflammatory conditions and even fibrosis observed in our study. Hyperleptinemia played a role in the liver fibrogenic process by activating hepatic satellite cells (HSCs), a critical step in the fibrogenic process [37], and down-regulating PPAR-γ expression at the mRNA and protein levels, which reduced the promoter activity of the PPAR-γ gene in HSCs [38]. Furthermore, adiponectin (anti-inflammatory, anti-apoptotic adipocytokine) was decreased with adiposity [39], suggesting a damaging effect of soft drinks in the liver. This hypothesis was proven by the severe infiltration of inflammatory cells and the hydropic degeneration seen in the liver histopathology following the

ACCEPTED MANUSCRIPT enhancement of AST with low ALT activity. However, the reduction in serum ALP activity may be attributed, in part, to a zinc deficiency following soft drink or aspartame administration (data

T

not published), which negatively affects ALP activity [40]. It has been previously reported that a

RI P

massive intake of cola soft drinks for two months significantly reduced serum ALP in ovariectomized rats [41]. Another effect of soft drink-induced obesity on liver injury is oxidative

SC

stress. Sil and Chakraborti [5] reported that rats fed a high fructose diet for six weeks had

NU

increased lipid peroxidation and decreased GSH levels. Interestingly, Pandey, Shihabudeen [42] revealed that a higher leptin level was associated with reduced antioxidant activities and increased

MA

lipid peroxidation in obese diabetic patients. This study demonstrated a relationship between fructose-containing soft drinks, adipocytokines, oxidative/antioxidative status and induction of

ED

hepatic inflammation, necrosis, and fibrosis.

PT

In terms of the effect of aspartame on adipocytokine expression, similar results were also

CE

observed with soft drinks. No studies have investigated these effects, which may be due to the lipogenic activity of aspartame. Both aspartame and soft drink consumption induced

AC

hyperglycemia, hypertriacylglycerolemia, and abdominal adiposity. This result was consistent with [43], who revealed increased concentrations of glucose, cholesterol, and LDL-c as well as decreased

HDL-c

following

aspartame

treatment.

Hypercholesterolemia

and

hypertriacylglycerolemia were associated with oxidative damage to tissues and the induction of chronic diseases, such as diabetes, atherosclerosis, and chronic liver disease [44]. The increased serum AST observed after aspartame oral drenching was indicative of hepatic damage and necrosis corresponding to our pathologic findings. Similar results were reported earlier by AbdelSalam, Salem [45] and Choudhary and Devi [46]. Subchronic consumption of aspartame significantly increased lipid peroxidation products in the brain, liver, and kidneys with a concomitant depletion of enzymatic (GST, GPx, SOD, and CAT) and non-enzymatic (GSH)

ACCEPTED MANUSCRIPT antioxidants levels [47]. This finding was consistent with the result of the present study, explaining another mechanism of hepatic damage induced by aspartame other than lipid

T

alterations. Alwaleedi [48] reported that a 60-day aspartame treatment significantly increased lipid

RI P

peroxidation with a remarkable reduction in antioxidant status in the liver and kidney tissues of rats. Aspartame-induced oxidative stress may be attributed to its methanol content, a hallmark of

SC

aspartame toxicity [49, 50], and the free radicals produced during aspartame metabolism that cause

NU

lipid peroxidation and depletion of antioxidant enzymes [47].

One concern that should be taken into consideration is that the results are dependent on the

MA

quality of information, including the explanation of the effects of soft drinks on adipocytokines,

ED

lipid profile, and antioxidant status. Because we cannot attribute these effects to particular ingredients in soft drinks, further studies are needed to explore the effect of each ingredient

PT

separately.

CE

In conclusion, over-expression of a pro-inflammatory adipocytokine (leptin) and downregulated expression of an anti-inflammatory adipocytokine (adiponectin) that were induced

AC

following 60 days of soft drink consumption or aspartame oral drenching support our hypothesis on the role of adipocytokines in the induction of hepatic injury besides lipid accumulation, oxidative stress and alteration of the antioxidant status in Wistar albino rats. The mechanisms responsible for the soft drink or aspartame toxicities could be mediated through induction of hyperglycemia, lipid accumulation, and an oxidant/antioxidant imbalance with the involvement of adipocytokines in hepatic inflammation, fatty changes, and necrosis. Based on these preclinical study results, an excess intake of soft drinks or aspartame artificial sweetener could induce hepatic lipogenesis in association with impaired adipocytokines expressions.

ACCEPTED MANUSCRIPT Acknowledgments All of the authors declare that they have no competing interests to disclose. This research did

T

not receive any specific grant from funding agencies in the public, commercial, or not-for-profit

RI P

sectors. The authors are solely responsible for the design and conduct of the study and the collection, management, analysis, and interpretation of the data, and the preparation of the

SC

manuscript. All authors had full access to the data and take responsibility for its integrity. All

NU

authors have read and agreed with the manuscript as written.

References

MA

[1] Ebbeling CB, Feldman HA, Chomitz VR, Antonelli TA, Gortmaker SL, Osganian SK, et al. A randomized trial of sugar-sweetened beverages and adolescent body weight. N Engl J Med.

ED

2012;367:1407-16.

PT

[2] Tothova L, Hodosy J, Mettenburg K, Fabryova H, Wagnerova A, Babickova J, et al. No

CE

harmful effect of different Coca-cola beverages after 6 months of intake on rat testes. Food Chem Toxicol. 2013;62:343-8.

AC

[3] Maes P, Monakhova YB, Kuballa T, Reusch H, Lachenmeier DW. Qualitative and quantitative control of carbonated cola beverages using (1)H NMR spectroscopy. J Agric Food Chem. 2012;60:2778-84.

[4] Malik VS, Popkin BM, Bray GA, Despres JP, Willett WC, Hu FB. Sugar-sweetened beverages and risk of metabolic syndrome and type 2 diabetes: a meta-analysis. Diabetes Care. 2010;33:2477-83. [5] Sil R, Chakraborti AS. Oxidative inactivation of liver mitochondria in high fructose dietinduced metabolic syndrome in rats: Effect of glycyrrhizin treatment. Phytother Res. 2016;30:1503-12.

ACCEPTED MANUSCRIPT [6] Bray GA, Nielsen SJ, Popkin BM. Consumption of high-fructose corn syrup in beverages may play a role in the epidemic of obesity. Am J Clin Nutr. 2004;79:537-43.

T

[7] Stanhope KL, Medici V, Bremer AA, Lee V, Lam HD, Nunez MV, et al. A dose-response

RI P

study of consuming high-fructose corn syrup-sweetened beverages on lipid/lipoprotein risk factors for cardiovascular disease in young adults. Am J Clin Nutr. 2015;101:1144-54.

SC

[8] Bocarsly ME, Powell ES, Avena NM, Hoebel BG. High-fructose corn syrup causes

NU

characteristics of obesity in rats: increased body weight, body fat and triglyceride levels. Pharmacol Biochem Behav. 2010;97:101-6.

MA

[9] Prabhakar P, Reeta KH, Maulik SK, Dinda AK, Gupta YK. Protective effect of thymoquinone against high-fructose diet-induced metabolic syndrome in rats. Eur J Nutr. 2015;54:1117-27.

ED

[10] Lozano I, Van der Werf R, Bietiger W, Seyfritz E, Peronet C, Pinget M, et al. High-fructose

PT

and high-fat diet-induced disorders in rats: impact on diabetes risk, hepatic and vascular complications. Nutr Metab (Lond). 2016;13:15.

CE

[11] Garg MK, Dutta MK, Mahalle N. Adipokines (adiponectin and plasminogen activator

AC

inhhibitor-1) in metabolic syndrome. Indian J Endocrinol Metab. 2012;16:116-23. [12] NRC. Nutrient requirements of laboratory rat. Nutrient Requirements of Laboratory Animals. 4th Revised ed. Washington (DC): National Academies Press (US); 1995. p. 11-79. [13] Fernstrom JD. Oral aspartame and plasma phenylalanine: pharmacokinetic difference between rodents and man, and relevance to CNS effects of phenylalanine. Short note. J Neural Transm. 1989;75:159-64. [14] Alkhedaide A, Soliman MM, Salah-Eldin AE, Ismail TA, Alshehiri ZS, Attia HF. Chronic effects of soft drink consumption on the health state of Wistar rats: A biochemical, genetic and histopathological study. Mol Med Rep. 2016;13:5109-17.

ACCEPTED MANUSCRIPT [15] Reitman S, Frankel S. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am J Clin Pathol. 1957;28:56-63.

T

[16] Tietz NW, Rinker AD, Shaw LM. IFCC methods for the measurement of catalytic

RI P

concentration of enzymes Part 5. IFCC method for alkaline phosphatase (orthophosphoricmonoester phosphohydrolase, alkaline optimum, EC 3.1.3.1). J Clin Chem Clin Biochem.

SC

1983;21:731-48.

NU

[17] Trinder P. Determination of blood glucose using an oxidase-peroxidase system with a noncarcinogenic chromogen. J Clin Pathol. 1969;22:158-61.

MA

[18] Allain CC, Poon LS, Chan CS, Richmond W, Fu PC. Enzymatic determination of total serum cholesterol. Clin Chem. 1974;20:470-5.

PT

Clin Chem. 1973;19:476-82.

ED

[19] Bucolo G, David H. Quantitative determination of serum triglycerides by the use of enzymes.

[20] Gotto AM, Jr. Lipoprotein metabolism and the etiology of hyperlipidemia. Hosp Pract (Off

CE

Ed). 1988;23 Suppl 1:4-13.

AC

[21] Levy FRI, Fridickson DS. Friedwald formula. In: Bauer JD, editor. Clinical Laboratory Methods. 9th ed. St. Louis: Mosby; 1982. p. 555. [22] Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem. 1979;95:351-8. [23] Marklund S, Marklund G. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem. 1974;47:469-74. [24] Sinha AK. Colorimetric assay of catalase. Anal Biochem. 1972;47:389-94. [25] Rotruck JT, Pope AL, Ganther HE, Swanson AB, Hafeman DG, Hoekstra WG. Selenium: biochemical role as a component of glutathione peroxidase. Science. 1973;179:588-90.

ACCEPTED MANUSCRIPT [26] Habig WH, Pabst MJ, Jakoby WB. Glutathione S-transferases. The first enzymatic step in mercapturic acid formation. The Journal of biological chemistry. 1974;249:7130-9.

T

[27] Moron MS, Depierre JW, Mannervik B. Levels of glutathione, glutathione reductase and

RI P

glutathione S-transferase activities in rat lung and liver. Biochim Biophys Acta. 1979;582:6778.

SC

[28] Yuan JS, Reed A, Chen F, Stewart CN, Jr. Statistical analysis of real-time PCR data. BMC

NU

Bioinformatics. 2006;7:85.

[29] Ackerman Z, Oron-Herman M, Grozovski M, Rosenthal T, Pappo O, Link G, et al. Fructose-

MA

induced fatty liver disease: hepatic effects of blood pressure and plasma triglyceride reduction. Hypertension. 2005;45:1012-8.

ED

[30] Mock K, Lateef S, Benedito VA, Tou JC. High-fructose corn syrup-55 consumption alters

PT

hepatic lipid metabolism and promotes triglyceride accumulation. J Nutr Biochem. 2017;39:32-9.

CE

[31] Koo HY, Wallig MA, Chung BH, Nara TY, Cho BH, Nakamura MT. Dietary fructose

AC

induces a wide range of genes with distinct shift in carbohydrate and lipid metabolism in fed and fasted rat liver. Biochim Biophys Acta. 2008;1782:341-8. [32] Babacanoglu C, Yildirim N, Sadi G, Pektas MB, Akar F. Resveratrol prevents high-fructose corn syrup-induced vascular insulin resistance and dysfunction in rats. Food Chem Toxicol. 2013;60:160-7. [33] Ohashi K, Ouchi N, Matsuzawa Y. Anti-inflammatory and anti-atherogenic properties of adiponectin. Biochimie. 2012;94:2137-42. [34] El Husseny MW, Mamdouh M, Shaban S, Ibrahim Abushouk A, Zaki MM, Ahmed OM, et al. Adipokines: Potential therapeutic targets for vascular dysfunction in Type II diabetes mellitus and obesity. J Diabetes Res. 2017;2017:8095926.

ACCEPTED MANUSCRIPT [35] Tsochatzis E, Papatheodoridis GV, Archimandritis AJ. The evolving role of leptin and adiponectin in chronic liver diseases. Am J Gastroenterol. 2006;101:2629-40.

T

[36] Astapova O, Leff T. Adiponectin and PPARgamma: cooperative and interdependent actions

RI P

of two key regulators of metabolism. Vitam Horm. 2012;90:143-62.

[37] Potter JJ, Womack L, Mezey E, Anania FA. Transdifferentiation of rat hepatic stellate cells

SC

results in leptin expression. Biochem Biophys Res Commun. 1998;244:178-82.

NU

[38] Zhou Q, Guan W, Qiao H, Cheng Y, Li Z, Zhai X, et al. GATA binding protein 2 mediates leptin inhibition of PPARgamma1 expression in hepatic stellate cells and contributes to

MA

hepatic stellate cell activation. Biochim Biophys Acta. 2014;1842:2367-77. [39] Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, Tobe K. Adiponectin and adiponectin

ED

receptors in insulin resistance, diabetes, and the metabolic syndrome. J Clin Invest.

PT

2006;116:1784-92.

[40] Cho YE, Lomeda RA, Ryu SH, Sohn HY, Shin HI, Beattie JH, et al. Zinc deficiency

CE

negatively affects alkaline phosphatase and the concentration of Ca, Mg and P in rats. Nutr

AC

Res Pract. 2007;1:113-9.

[41] Garcia-Contreras F, Paniagua R, Avila-Diaz M, Cabrera-Munoz L, Martinez-Muniz I, FoyoNiembro E, et al. Cola beverage consumption induces bone mineralization reduction in ovariectomized rats. Arch Med Res. 2000;31:360-5. [42] Pandey G, Shihabudeen MS, David HP, Thirumurugan E, Thirumurugan K. Association between hyperleptinemia and oxidative stress in obese diabetic subjects. J Diabetes Metab Disord. 2015;14:24. [43] Prokic M, Paunovic M, Matic M, Djordjevic N, Ognjanovic B, Stajn A, et al. Effect of aspartame on biochemical and oxidative stress parameters in rat blood. Arch Biol Sci. 2015;67:535-45.

ACCEPTED MANUSCRIPT [44] Tangvarasittichai S. Oxidative stress, insulin resistance, dyslipidemia and type 2 diabetes mellitus. World J Diabetes. 2015;6:456-80.

T

[45] Abdel-Salam OM, Salem NA, Hussein JS. Effect of aspartame on oxidative stress and

RI P

monoamine neurotransmitter levels in lipopolysaccharide-treated mice. Neurotox Res. 2012;21:245-55.

SC

[46] Choudhary AK, Devi RS. Effects of aspartame on hsp70, bcl-2 and bax expression in immune

NU

organs of Wistar albino rats. J Biomed Res. 2016;30:427-35. [47] Adaramoye OA, Akanni OO. Effects of long-term administration of aspartame on

Physiol Pharmacol. 2016;27:29-37.

MA

biochemical indices, lipid profile and redox status of cellular system of male rats. J Basic Clin

ED

[48] Alwaleedi S. Alterations in antioxidant defense system in hepatic and renal tissues of rats

PT

following aspartame intake. Journal of Applied Biology and Biotechnology. 2016:046-52. [49] Parthasarathy NJ, Kumar RS, Manikandan S, Devi RS. Methanol-induced oxidative stress in

CE

rat lymphoid organs. J Occup Health. 2006;48:20-7.

AC

[50] Castro GD, Costantini MH, Delgado de Layno AM, Castro JA. Rat liver microsomal and nuclear activation of methanol to hydroxymethyl free radicals. Toxicol Lett. 2002;129:227-36.

ACCEPTED MANUSCRIPT Figures captions Figure 1 Relative mRNA expression patterns of adipocytokines in adipose tissues

T

Data are expressed as the means ± SEM and were analyzed by one-way ANOVA followed

RI P

by Duncan's post hoc test. Aspartame and soft drink intake correlated with up-regulated (*P

SC

< .05) leptin, adiponectin and PPAR-γ mRNA gene expression.

Figure 2 Photomicrograph of rat livers from the control, aspartame and soft drink groups

NU

stained with H&E (×200)

MA

(A) Liver from a control group rat showing a normal histological structure. (B) Liver from soft drink-receiving rats showing vacuolar degeneration of hepatocytes with

infiltration (arrows) (B2).

ED

fatty changes types (arrows) (B1), and focal hepatic necrosis with inflammatory cell

PT

(C) Liver from aspartame-receiving rats showing congestion of the portal vein (long arrow)

CE

and focal hepatic necrosis with inflammatory cells infiltration (short arrow) (C1), and hemorrhage with RBC extravasation from blood vessel (long arrow) that replaced necrotic

AC

hepatocytes (short arrows) (C2).

ACCEPTED MANUSCRIPT Table 1. Primer sequences used for qRT-PCR. Primer (5'→3')

GenBank NM_007393.5

F: TCCTCCTGAGCGCAAGTACTCT R

GCTCAGTAACAGTCCGCCTAGA A

: NM_008493.3

F: CCTGTGGCTTTGGTCCTATCTG R :

Adiponecti

q

n

NM_009605.4

PT

Adipo

AC

* Housekeeping gene

MA

F: CATTTCTGCTCCACACTATGAA R

61

AGGCAAGCTGGTGAGGATCTG

51

CGGGAAGGACTTTATGTATGCG

:

ED

Peroxisome NM_001127330. proliferator activated 2 receptor gamma

CE

PPARγ

SC

Leptin

NU

Lep

Annealin g temp. (°C) 55

T

Gene descriptio n β-actin

RI P

Gene symbo l Actb*

F: CTCCACCCAAGGAAACTTGT R :

CTGGTCCACATTTTTTTCCT

59

ACCEPTED MANUSCRIPT Table 2. Effects of soft drink and aspartame intake on body weight in rats Soft drink

Aspartame

Initial body weight

186.82 ± 14.93

189.88 ± 16.44

188.54 ± 14.05

Final body weight after 2 months

346.58 ± 31.05

385.94 ± 27.42

359.56 ± 31.77

T

Control

RI P

Parameter

Data are expressed as the means ± SEM (n = 10 per group). No significant differences are

AC

CE

PT

ED

MA

NU

SC

indicated (one-way ANOVA followed by post hoc Duncan's multiple range test).

ACCEPTED MANUSCRIPT Table 3. Effects of soft drinks and aspartame intake on liver function

Soft drink

AST (U/L)

73.94 ± 2.85

106.80 ± 4.77*

96.68 ± 1.51*

ALT (U/L)

31.54 ± 2.79

18.68 ± 1.09*

27.72 ± 1.18

ALP (U/L)

417.88 ± 14.08

242.62 ± 17.49**

335.46 ± 26.66*

87.12 ± 2.38

Total cholesterol (mg/dL)

115.23 ± 9.11

Triacylglycerol (mg/dL)

95.12 ± 7.34

HDL-c (mg/dL)

57.72 ± 5.67

LDL-c (mg/dL) VLDL-c (mg/dL)

SC

Glucose (mg/dL)

Aspartame

100.80 ± 3.35*

97.28 ± 1.23*

147.43 ± 11.51*

126.45 ± 13.21

NU

Parameter

T

Control

RI P

biomarkers, lipid profile and glucose concentration in rats

117.57 ± 7.45*

52.82 ± 8.23

54.87 ± 4.92

41.67 ± 5.12

73.45 ± 7.43*

50.75 ± 4.35*

18.54 ± 3.87

23.94 ± 3.87*

23.65 ± 2.37*

ED

MA

118.39 ± 8.63*

Data are expressed as the means ± SEM (n = 10 per group). Significant differences are indicated

significantly

different

PT

(one-way ANOVA followed by post hoc Duncan's multiple range test). *P < .05, **P < .01 from

control.

AST,

aspartate

aminotransferase;

ALT,

alanine

CE

aminotransferase; ALP, alkaline phosphatase; HDL-c, high-density lipoprotein - cholesterol; LDL-

AC

c, low-density lipoprotein - cholesterol; VLDL-c, very low-density lipoprotein - cholesterol.

ACCEPTED MANUSCRIPT Table 4. Effects of soft drinks and aspartame intake on hepatic oxidative/antioxidative indices in rats Soft drink

Aspartame

186 ± 12.45 47.65 ± 7.54 435.45 ± 23.54 159.23 ± 12.34 321.45 ± 26.43 589.23 ± 31.56

221 ± 13.76* 30.12 ± 7.31* 412.38 ± 21.56 119.54 ± 13.27* 278.39 ± 21.67* 508.92 ± 33.87*

211.65 ± 11.23* 31.48 ± 6.71* 421.67 ± 18.54 123.54 ± 11.43* 285.38 ± 19.45* 509.57 ± 29.56*

RI P

T

Control

SC

Parameter MDA (nmol/g tissue) GSH (μmol/g tissue) GST (μmol/min/g tissue) GPx (IU/min/g tissue) CAT (IU/min/g tissue) SOD (IU/min/g tissue)

NU

Data are expressed as the means ± SEM (n = 5 per group). Significant differences are indicated (one-way ANOVA followed by post hoc Duncan's multiple range test). *P < .05 significantly

MA

different from control. MDA, malondialdehyde; GSH, reduced glutathione; GST, glutathione S-

AC

CE

PT

ED

transferase; GPx, glutathione peroxidase; CAT, catalase; SOD, superoxide dismutase.

ACCEPTED MANUSCRIPT

Table 5. Incidence† and severity‡ of hepatic histopathological lesions following soft drinks and aspartame intake in rats

0

2

Hemorrhage Hepatic necrosis with inflammatory cell infiltration Inflammatory cell infiltration in the portal area Edema in the portal area

5

0

3

1

3

1

2

3

Fatty changes

2

2

Bloodless sinusoidal dilatation

3

ED

T

IP

Moderate (++) 1

Severe (+++) 3

2

1

0

1

2

2

0

0

2

2

1

0

1

0

1

1

2

1

1

0

2

2

1

0

0

0

5

0

0

0

1

0

5

0

0

0

1

0

5

0

0

0

AC

CE

1

Severe (+++) 0

MA NU S

Congestion of blood vessels

PT

Hydropic degeneration

Moderate (++) 0

Aspartame Absent Mild (-) (+) 0 1

CR

Lesions

Soft drink Absent Mild (-) (+) 5 0





Number of rats with lesions per total examined (n= 5 rats per group). Severity of lesions was graded by estimating the percentage area affected in the entire section. Lesion scoring: (0) absence of the lesion=

0%, (+) mild= 5-25%, (++) moderate= 26-50% and (+++) severe ≥ 50% of the examined tissue sections. - 27 -

AC

Figure 1

CE

PT

ED

MA

NU

SC

RI P

T

ACCEPTED MANUSCRIPT

- 28 -

AC

CE

PT

ED

MA

NU

SC

RI P

T

ACCEPTED MANUSCRIPT

Figure 2

- 29 -