NF-κB signaling pathway

NF-κB signaling pathway

Journal of Ethnopharmacology xxx (xxxx) xxxx Contents lists available at ScienceDirect Journal of Ethnopharmacology journal homepage: www.elsevier.c...

2MB Sizes 0 Downloads 20 Views

Journal of Ethnopharmacology xxx (xxxx) xxxx

Contents lists available at ScienceDirect

Journal of Ethnopharmacology journal homepage: www.elsevier.com/locate/jethpharm

Phillygenin inhibits LPS-induced activation and inflammation of LX2 cells by TLR4/MyD88/NF-κB signaling pathway Naihua Hu, Cheng Wang, Xuyang Dai, Mengting Zhou, Lihong Gong, Lingyuan Yu, Cheng Peng∗∗, Yunxia Li∗ School of Pharmacy, Chengdu University of Traditional Chinese Medicine, Key Laboratory of Standardization for Chinese Herbal Medicine, Ministry of Education, National Key Laboratory Breeding Base of Systematic Research, Development and Utilization of Chinese Medicine Resources, Chengdu, 611137, China

A R T I C LE I N FO

A B S T R A C T :

Keywords: Phillygenin TLR4/MyD88/NF-κB LX2 Inflammation Liver fibrosis

Ethnopharmacological relevance:: The traditional Chinese medicine Forsythiae Fructus is the dried fruit of Forsythia suspensa (Thunb.) Vahl. It is commonly used to clear heat and detoxify, reduce swelling and disperse knot, and evacuate wind and heat. Aim of the study:: Inflammation is involved in liver fibrosis. Phillygenin (PHI) is a kind of lignans extracted and separated from Forsythiae Fructus, which has been reported to have a good anti-inflammatory effect. Therefore, we aimed to explore whether PHI has a therapeutic effect on liver fibrosis caused by inflammation. Materials and methods:: Firstly, the induction of the LX2 cells inflammatory model and fibrosis model by LPS with different concentrations were studied. Then, high, medium and low doses PHI was given for intervention therapy. The secretion of IL-6, IL-1β and TNF-α inflammatory factors were detected by ELISA kit, and the expression of collagen I and α-SMA was detected by Western blot and RT-qPCR. The possible mechanism of PHI on TLR4/MyD88/NF-κB signal pathway was studied by computer-aided drug design software and the results were further verified by Western blot and RT-qPCR experiments. Results:: The results showed that LPS could promote the expression of IL-6, IL-1β and TNF-α and the expression of collagen I and α-SMA, indicating that LPS could induce inflammation and fibrosis in LX2 cells. PHI could inhibit LX2 cell activation and fibrotic cytokine expression by inhibiting LPS-induced pro-inflammatory reaction. Molecular docking results showed that PHI could successfully dock with TLR4, MyD88, IKKβ, p65, IκBα, and TAK1 proteins. Subsequently, Western blot and qPCR results further proved that PHI could inhibit the proteins expression in TLR4/MyD88/NF-κB signal pathway which were consistent with the molecular docking results. Conclusion:: PHI can inhibit LPS-induced pro-inflammatory reaction and LX2 cell activation through TLR4/ MyD88/NF-κB signaling pathway, thereby inhibiting liver fibrosis.

1. Introduction

activated under injury and transformed into myofibroblasts for rapid proliferation, secretion of α-smooth muscle actin (α-SMA) and a large number of ECM (Friedman, 2008). If liver fibrosis is not treated in time, liver fibrosis will progress to cirrhosis, even liver cancer, seriously affecting patients’ life and even threatening their lives. Many studies have shown that chronic activation of inflammatory pathways can promote the formation of liver fibrosis tissues (Eli Pikarsky et al., 2004; Maeda et al., 2005; Pellicoro et al., 2014). The sustained activation of HSCs by inflammatory factors is a key link in the

Liver fibrosis is a pathological change induced by abnormal regulation of the injury repair process following chronic liver injury. In the pathogenesis of liver fibrosis, due to the imbalance of synthesis and degradation of extracellular matrix components (ECM), a large amount of extracellular matrix will accumulate such as type I collagen (COL1) and hyaluronic acid (Xu et al., 2016). Hepatic stellate cells (HSCs) are the main effector cells in liver fibrosis(Gur et al., 2012), which are

Abbreviations: ECM, extracellular matrix components; HSCs, Hepatic stellate cells; α-SMA, α-smooth muscle actin; LPS, lipopolysaccharide; TLR4, toll-like receptor 4; IKK, inhibitor of nuclear factor kappa-B kinase; MyD88, myeloiddifferentiationfactor88; NF-κB, nuclear factor kappa-B; PHI, phillygenin; IL, interleukin; TNF, tumor necrosis factor; PDB, Protein Data Bank; TAK1, transforming growth factor-β-activated kinase 1; IRAK1, Interleukin 1 Receptor Associated Kinase 1; TRAF6, Tumor necrosis factor receptor-associated factor 6; COL1, Collagen 1 ∗ Corresponding author. ∗∗ Corresponding author. No. 1166, Liu Tai Avenue, Wenjiang District, Chengdu, Sichuan, China. E-mail addresses: [email protected] (C. Peng), [email protected] (Y. Li). https://doi.org/10.1016/j.jep.2019.112361 Received 13 July 2019; Received in revised form 12 October 2019; Accepted 26 October 2019 0378-8741/ © 2019 Elsevier B.V. All rights reserved.

Please cite this article as: Naihua Hu, et al., Journal of Ethnopharmacology, https://doi.org/10.1016/j.jep.2019.112361

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

process of liver fibrosis (Bataller et al., 2005; Henderson et al., 2007; Qian et al., 2015). On the contrary, after activation, HSCs can also secrete inflammatory factors to further promote liver fibrosis. Lipopolysaccharide (LPS), a component of the cell wall of Gramnegative bacteria, binds to Toll-like receptor 4 (TLR4) and triggers an innate immune response (Kawai et al., 2010). In acute and chronic liver disease, elevated levels of serum LPS and the presence of a large number of inflammatory factors can be detected (Liaskou et al., 2012). More and more studies have shown that the LPS/TLR4 signaling pathway plays an important role in the pathogenesis of liver fibrosis (Paik et al., 2003; Soares et al., 2010). A lot of efforts have been made to explore the pathogenesis of the disease, but there is still no effective drug for the treatment of liver fibrosis. Traditional Chinese medicine has been used for the treatment of fibrosis for a long time, and many potential drugs for treating liver fibrosis, such as emodin (Xiaoxv Dong, 2016) and curcumin (Farzaei et al., 2018), have been discovered. Therefore, it is potential to find effective drugs for treating liver fibrosis from traditional Chinese medicine. The traditional Chinese medicine Forsythiae Fructus (the dried fruit of Forsythia suspensa (Thunb.) Vahl) has the effects of clearing heat and detoxifying, reducing swelling and dispersing knot, and evacuating wind and heat (Chinese Pharmacopoeia Commission, 2015). Forsythiae Fructus is often used to treat liver diseases clinically. According to the data, among the prescriptions used to treat 1915 cases of chronic liver diseases, Forsythiae Fructus appeared 706 times. In the ancient Chinese book Secrets of Medical Efficiency, the recorded ganlu xiaodu micropills containing Forsythia suspense have been used to treat the evil which is in qi fen and damp heat combined sickness, which is now commonly referred to as hepatitis and liver fibrosis. Besides, outstanding physician Zhang Chizhi also treated chronic severe hepatitis with Forsythia suspense (M. Guo, 2018).Modern pharmacological studies have shown that Forsythiae Fructus has good anti-liver fibrosis (Zhang et al., 2018), antiinflammatory (Chen and Zhang, 2014), and antipyretic (Y. P. Guo et al., 2015) effects. However, due to the numerous chemical components contained in Forsythiae Fructus, the pharmacodynamic material basis for its effects is not clear. Phillygenin (PHI) (4-[(3S,3aR,6R,6aR) -6(3,4-dimethoxyphenyl) -1,3,3a,4,6,6a-hexahydrofuro[3,4-c]furan-3yl]-2-methoxyphenol) (Fig. 1) is a lignan component extracted from Forsythiae Fructus. Pharmacological studies have shown that PHI has the effects of liver protection (W. Song et al., 2018), anti-inflammatory (Du et al., 2019; Lim et al., 2008), anti-oxidant (Min-Jung Chang and Byung-Sun, 2008) and anti-tumor (He et al., 2019). Although previous studies have shown that PHI has protective effects on carbon tetrachloride-induced liver injury in mice (W. Song et al., 2018), the molecular mechanism of its hepatoprotective effect is not clear, especially whether the anti-inflammatory effect of PHI is inevitably related to its hepatoprotective effect is worthy of further study. Therefore, based on the fact that the pathogenesis of liver fibrosis is related to the TLR4 signal pathway, the purpose of this paper is to explore the possible mechanism of PHI's anti-liver fibrosis effect through the TLR4 signal pathway and provide a theoretical basis for Forsythiae Fructus to treat liver fibrosis.

2. Materials and methods 2.1. Materials PHI (purity above 99%) was purchased from Chroma-Biotechnology Co,.Ltd (Chengdu, China). Lipopolysaccharide (from E.Coli 055: B5) was purchased from Sigma (Sigma-Aldrich, China). 1640 medium and Fetal Bovine Serum were purchased from Gibco (Australia). Trypsin (1:250) was purchased from BIOFROXX (Guangzhou, China). LX2 cells were obtained from the Cell Bank of the Xiangya Central Experiment Laboratory of Central South University (Changsha, China). L02 cells were obtained from Procell Life Science&Technology Co., Ltd. (Wuhan, China). Cell Counting Kit-8 (CCK-8), IL6 Elisa kits and TNF-α Elisa kits were purchased from Multi Sciences (LIANKE) Biotech Co., Ltd. (Hangzhou, China). IL-1β Elisa kits were purchased from Elabscience Biotechnology Co., Ltd (Wuhan, China). Trizol reagent was purchased from Ambion Life Technologies (Carlsbad, CA, USA), 5X All-In-One MasterMix and EvaGreen 2XqPCR MasterMix-No Dye were purchased from abm (Canada). RIPA lysis buffer was obtained from Beyotime Biotechnology. PMSF, BCA Protein Assay Kit were purchased from MultiSciences Biotech Co., Ltd. Protein phosphatase inhibitor was obtained from Beijing Solarbio Sciences & Technology Co., Ltd. Rabbit anti- TLR4, rabbit anti-MyD88, rabbit anti-α-SMA, rabbit anti-COL1, and mouse anti-GAPDH were purchased from Bioss Antibodies (Beijing, China). Rabbit anti-p-p65, rabbit anti-IKKβ, mouse anti-p65, Goat antiMouse IgG-HRP and Goat anti-Rabbit IgG-HRP were purchased from Multi Sciences (LIANKE) Biotech Co., Ltd. (Hangzhou, China). SuperLumia ECL HRP Substrate Kit was purchased from Abbkine Scientific Co., Ltd (Wuhan, China). 2.2. Cell culture and model establish LX2 cells (hepatic stellate cells from the human liver that have been immobilized) were cultured in 1640 supplemented containing 10% Gibco fetal bovine serum and 1% antibiotics (penicillin and streptomycin) at 37 °C in a 5% CO2 -humidified incubator. Cells at 80% confluence were collected and seeded at 5 × 103 cells in each well in 96well plates for further experiment. LX2 cells were stimulated with LPS solution and treated by PHI solution of different concentrations for 24 h. CCK-8 was added and the absorbance was detected by a microplate analyzer at 450 nm 4 h later. 2.3. ELISA detection LX2 cells were plated in 6-well plates (8 × 104 cells/mL) and incubated with LPS in the presence or absence of PHI for 24 h. The cellfree supernatant was collected after LPS stimulation for 24 h. Then IL1β, IL-6 and TNF-α were measured by ELISA kits according to the manufacturer's instructions. The absorbance at 450 nm and 570 nm were detected using a microplate reader. 2.4. Molecular docking As shown in the TLR4 Signal pathway (Fig. 2), the proteins in the signal transduction network were selected as the research targets. Three-dimensional structures of the target proteins were downloaded from Protein Data Bank (PDB) (https://www.rcsb.org/pdb/home/ home.do), and the corresponding optimal structure of ligands was searched. TLR4, MYD88 and TRAF6 specificity ligands and PHI downloaded from https://pubchem.ncbi.nlm.nih.gov/. The specific targets and the corresponding PDB Number and ligands of the protein were shown in Table 1. Firstly, PHI was imported into the Discovery Studio 3.5 software for hydrogenation optimization. Then, the three-dimensional structure of the target protein was introduced and optimized through dehydration, hydrogenation, and structural modification. Finally, PHI was docked with the target protein. Seven scoring functions

Fig. 1. Chemical structure of PHI. 2

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

Fig. 2. Diagram of TLR4/MYD88/NF-κB pathways.

2.5. RT-qPCR

Table 1 The relevant targets and ligands of TLR4/MYD88/NF-κB pathway. Targets

PDB Number

Ligands

TLR4 MYD88 IκBα IKKβ p65 TAK1 IRAK1 TRAF6

3fxi 3mop 4kba 1r0p 1nfi 3p0u 6BFN 1lb4

243984-11-4 894787-30-5 1QM KSA DTV ADN DL1 433249-94-6

Total RNA was collected using Trizol Reagent according to the manufacturer's instructions. Total RNA extracts were dissolved in 50 μL of RNase-free water. Final RNA purity was detected with the Nucleic Acid/Protein Analyzer by measuring the value of OD260/280 and the RNA integrity was verified by Type 1 nucleic acid dye on 1% agarose gel. Reverse transcription for cDNA synthesis with 5X All-In-One MasterMix. RT-qPCR reactions were performed and each experiment was carried out with three independent biological samples. Reaction conditions were prepared according to the manufacturer's instructions. The data was calculated according to the amplification curve by using the formula of 2-ΔΔCt. The gene primer sequence was listed in Table 2.

Table 2 The gene primer sequence used for RT-qPCR. Gene

Forward (5′-3 ′)

Reverse (5′-3′)

a-SMA COL1A1 GAPDH TLR4 MyD88 p65 IκBα IKKβ TAK1

CCGGGAGAAAATGACTCAAA CCTGGATGCCATCAAAGTCT ACTTTGGTATCGTGGAAGGACT GGGTATTTGACACCCTCCATAG CTAAGAAGGACCAGCAGAG CCTTATCAAGTGTCTTCCATC CTACACTTAGCCTCTATCCAT CTGCTAATCACTTGCTAACC CATTGAGAGCCTGATGACT

GCAAGGCATAGCCCTCATAG CGCCATACTCGAACTGGAAT GTAGAGGCAGGGATGATGTTCT CAAGAGTGCTGAGGGAATACAG GAAGCATCAGTAGGCATCA AATGCCAGTGCCATACAG GGTAGGTAACTCTGTTGACA CAGACTGGAGGAGGACAT CTGAATACTGACAAGGATACTG

2.6. Western blot LX2 cells were cleaned by precooling PBS for three times and added 150 μL RIPA lysis buffer (RIPA lysis buffer: PMSF: protein phosphatase inhibitor = 100:1:1) on ice for 5 min. The lysis buffer was collected and crushed with ultrasonic cell crusher in an ice bath for 3 min. Then the supernatant was collected after being centrifuged for 15 min. Detected with BCA Protein Assay kit, the protein concentration was adjusted to be consistent with the Lysis Buffer. Protein loading buffer was added (total protein: loading buffer = 4:1) and heated for 5 min at 100 °C, then cooled to room temperature. Equal amounts of sample protein were loaded and separated by electrophoresis (10% SDS-PAGE) and then transferred to poly membranes. After being incubated with 5% milk at room temperature for 2 h, the membrane was incubated with primary antibodies against TLR4, MyD88, p65, p-p65, IκBα, pIκBα,TAK1, IKKβ, α-SMA, COL1 and GAPDH at 4 °C overnight. After washing 3 times, the membrane was incubated with secondary antibodies (Goat anti-Mouse IgG-HRP and Goat anti-Rabbit IgG-HRP) at 1:5000 for 2 h in 37 °C. Signals were detected with ECL kit and exposed in gel imager. The net optical density was quantificationally analyzed with the gel imager analysis software.

were built into the software: LigScore1_Dreiding, LigScore2_Dreiding, -PLP1, -PLP2, Jain, -PMF, DockScore, which can evaluate hydrogen bond force, polarity, solvation of protein and ligand, and so on. Consistency score can integrate the results of multiple scoring functions for comprehensive evaluation. The binding effect of PHI with target proteins was evaluated according to the consistency score results. The ligand we selected is known and has been reported to have good affinity with protein. Therefore, it can be used as a positive control of the affinity between PHI and the target protein. If the binding fraction of PHI and protein is higher than the binding fraction of ligand and protein, PHI and protein may have a better affinity. It can be speculated that this protein is a potential target for PHI to function.

2.7. Safety evaluation L02 cells (normal liver cells from the human liver) were cultured in 3

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

Fig. 3. (A) Effects of LPS on cell viability examined using the CCK-8. LX2 cells were treated with various concentrations of LPS for 24 h. Untreated cells were used as control. (B–D) Effects of different LPS concentrations on IL6, IL1, TNF-α expression in LX2 cells. (E–F) Effects of different LPS concentrations on LX2 cells α-SMA and COL1 mRNA expression. Experimental treatments were analyzed in triplicate and quantitative data are expressed as the mean ± SD of three independent experiments. ***p < 0.001 LPS vs control; **p < 0.01 LPS vs control; *p < 0.05 LPS vs control.

Fig. 4. (A) Effects of PHI and LPS treatment on cell viability. LX2 cells were treated with various concentrations of PHI in the presence of LPS (100 ng/mL) for 24 h. (B–D) Effects of different concentrations of PHI (12.5–50 μg/mL) on the expression of IL6, IL-1β, and TNF-α in LX2 cells stimulated by LPS (100 ng/mL). Experimental treatments were analyzed in triplicate and quantitative data are expressed as the mean ± SD of three independent experiments. ***p < 0.001 LPS + PHI vs LPS; **p < 0.01 LPS + PHI vs LPS; *p < 0.05 LPS + PHI vs LPS. ###p < 0.001 LPS vs control.

cells were treated with PHI solution of different concentrations for 24 h. CCK-8 was added and the absorbance was detected by a microplate analyzer at 450 nm 4 h later.

1640 culture medium containing 10% Gibco fetal bovine serum and 1% antibiotics (penicillin and streptomycin) at 37 °C in a 5% CO2 -humidified incubator. Cells at 80% confluence were collected and seeded at 4 × 103 cells in each well in 96-well plates for further experiment. L02 4

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

Fig. 5. Effects of PHI on the expression of fibrosis cytokines α-SMA and COL1 in LX2 cells. (A) Quantitation of Western blot analysis of α-SMA and COL1. (B) The expression of α-SMA and COL1 mRNA. Experimental treatments were analyzed in triplicate and quantitative data are expressed as the mean ± SD of three independent experiments. ***p < 0.001 LPS + PHI vs LPS; **p < 0.01 LPS + PHI vs LPS. ###p < 0.001 LPS vs control.

2.8. Statistical analysis

3. Results

All statistical analyses were performed using the statistical software SPSS 25.0 and results were presented as Mean ± SD. 95% was set as confidence intervals and the difference was considered as significant if the p-value < 0.05. One -Way ANOVA was used for comparisons among the multiple groups.

3.1. LPS can stimulate the proliferation of LX2 cells and promote the expression of inflammatory and fibrotic factors To explore the optimal LPS concentration, the effect of different concentrations of LPS ranging from 0 to 1000 ng/mL on LX2 cell proliferation was investigated, as shown in Fig. 3A. LPS can promote the 5

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

in Fig. 6. Consistency scores of PHI was higher or equal to the ligand suggesting that PHI could bind to most proteins in the TLR4/MyD88/ NF-κB signaling pathway. Except TRAF6 and IRAK, TLR4, MyD88, IκBα, IKKβ, p65 and TAK1 may be possible targets of PHI in the TLR4/ MyD88/NF-κB signaling pathway. 3.5. PHI can inhibit the TLR4/MyD88/NF-κB signaling pathway According to the results of molecular docking, Western blot was applied to detect the proteins expression in TLR4/MyD88/NF-κB signaling pathway. As shown in Fig. 7A, the results showed that compared with the control group, LPS could significantly promote the expression of TLR4, MyD88, TAK1, p65, p-p65, p-IκBα and IKKβ, but these proteins expression could be inhibited by PHI. At the same time, the results of RT-qPCR experiments were consistent with the results of Western blot, as shown in Fig. 7B.

Fig. 6. Consistency scores of PHI and ligands in TLR4/MyD88/NF-κB signaling pathway.

3.6. PHI did not affect the proliferation of normal hepatocytes proliferation of LX2 cells in a dose-dependent manner. At 100 ng/ml, LX2 cells have a maximum proliferation capacity. Subsequently, IL6, IL1β, and TNF-α were detected. With the increase of dose, LPS could significantly promote the expression of IL6, IL-1β, and TNFα(Fig. 3B–D), indicating that LPS could induce the inflammatory response of LX2 cells and the inflammatory model was successfully established. As the characterization proteins activated by LX2, the expressions of α-SMA and COL1 mRNA were also detected. It was found that LPS can significantly promote the expression of α-SMA and COL1 mRNA (Fig. 3E and F), indicating that LPS successfully caused liver fibrosis.

To investigate the safety of PHI in the treatment of liver fibrosis and whether it affects the growth of normal hepatocytes while inhibiting the growth of LX2 cells, we conducted CCK-8 experiment, as shown in Fig. 8. It was found that PHI did not affect L02 cells when the concentration of PHI was lower than 100 μg/mL. When it was higher than 100 μg/mL, PHI showed inhibitory effect on L02 cells. Therefore, PHI has higher safety and can be used for the treatment of liver fibrosis. 4. Discussion LPS/TLR4 signaling pathway mainly mediates inflammatory reaction, and its role in liver injury and liver fibrosis has been confirmed (Chan et al., 1997). LPS-activated TLR4/NF-κB signaling pathway mainly through two pathways, one of which is myeloid differentiation factor 88 (MyD88) dependent pathway which is the most classical pathway in signal transduction, which is studied in this experiment. Inflammation model and fibrosis model were established by LPS. The targets of PHI on TLR4/MyD88/NF-κB signal pathway were studied by molecular docking technology. The molecular docking results were verified by Western blot and qPCR experiments. Finally, it was concluded that PHI exerts anti-inflammatory and anti-fibrosis effects through TLR4/MyD88/NF-κB signaling pathway. Molecular docking technology is the main method used in structurebased drug design. The technique is to place the ligand molecule at the active site of the receptor molecule, then evaluate the interaction between the ligand and the receptor in real-time according to the principle of geometric complementarity, energy complementation, and chemical environment complementary, and find the best binding mode between the two molecules through scoring functions (S.-Y. Huang et al., 2010; J. Li et al., 2019; Yuriev et al., 2015). At present, molecular docking technology is widely used to screen active compounds (Chang et al., 2010; Schneider, 2018). Ren successfully screened small molecular compounds with Pim-1 inhibitory activity by molecular docking technology (Ren et al., 2011), Kenji Matsuno discovered a series of new STAT3 dimerization inhibitors using molecular docking technology (Matsuno et al., 2010). In the study, molecular docking technology was applied to screen potential anti-inflammatory targets of PHI with LigandFit method, a tool for virtual screening using precise classical molecular docking method (Venkatachalam et al., 2003). In this experiments, the docking scores of PHI with TLR4, IKKβ, p65 and TAK1 were 6 points, and that of MyD88 and IκBα proteins were 7 points, which were higher than or equal to the scores of specific ligand, indicating that PHI may have higher affinity with these proteins. It was speculated that PHI may affect TLR4/MyD88/NF-κB signal pathway by acting on these proteins. Although molecular docking technology provides screening of early targets, due to its limitations, for example, the flexibility of proteins and changes in the acid and alkaline environment

3.2. PHI can inhibit LPS-induced cell proliferation and the release of inflammatory cytokines CCK-8 experiment was conducted to detect the effect of PHI on LX2 inflammation and hepatic fibrosis model stimulated by LPS and to screen out the optimal concentration of PHI. The results were shown in Fig. 4A. It was found that under the LPS stimulation (100 ng/ml), the proliferation capacity of LX2 cells gradually decreased with the increase of the concentration of PHI. At a concentration of 50 μg/ml PHI, LX2 cells were inhibited and there was no significant difference compared with the control group. Although 100 μg/ml and 200 μg/ml showed obvious inhibitory effect on LX2 cell proliferation, the control cell was also influenced. Therefore, 12.5 μg/ml, 25 μg/ml, 50 μg/ml of PHI was selected as the final dose concentration without affecting cell growth and ensuring the effectiveness of the drug. Next the effect of high, medium and low dose concentrations of PHI on LPS-induced inflammatory cytokines in LX2 cells were examined which indicated that PHI can significantly inhibit the expression of IL6, IL-1β, and TNF-α (Fig. 4B–D), thereby inhibiting the inflammatory response. 3.3. PHI can inhibit the activation of LX2 cells To explore the effect of PHI on LPS-induced liver fibrosis in LX2 cells, Western blot experiments were conducted to detect the expression of α-SMA and COL1 in LX2 cells, as shown in Fig. 5. The results showed that PHI can inhibit the expression of α-SMA and COL1 proteins, and inhibit the activation of LX2 cells. Expression of α-SMA and COL1 mRNA was also detected, and the results were consistent with the protein expression. 3.4. Molecular docking Molecular docking experiments was conducted to further explore the anti-fibrosis mechanism of PHI. The molecular docking results of PHI and ligands in TLR4/MyD88/NF-κB signaling pathway were shown 6

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

Fig. 7. Effects of PHI on TLR4/MyD88/NF-κB signaling pathway-related proteins and mRNA。(A) Quantitation of Western blot analysis of TLR4, MyD88, TAK1, p65, p-p65, IκBα, p-IκBα and IKKβ. (B) The mRNA expression of TLR4, MyD88, p65, IKKβ, IκBα, and TAK1. Experimental treatments were analyzed in triplicate and quantitative data are expressed as the mean ± SD of three independent experiments. ***p < 0.001 LPS + PHI vs LPS; **p < 0.01 LPS + PHI vs LPS. ###p < 0.001 LPS vs control.

7

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

Fig. 7. (continued)

regulated by NF-κB, while IκBα, in turn, regulates the inactivation of NF-κB (Napetschnig et al., 2013). When inflammatory signals were generated, IκBα in the cytoplasm was phosphorylated, then degraded and NF-κB protein was released into the nucleus (Alkhalf et al., 2018; Mitchell et al., 2018). IKK complex, as a key molecule for activating NFκB signal pathway, can target IκBα to release NF-κB and activate the NF-κB signal pathway (Catherine H. Re' gnier, 1997; Frank Mercurio et al., 1997; John et al., 1997; Joseph A. DiDonato et al., 1997; Zandi et al., 1997). In this experiment, PHI inhibited the expression of IKKβ and reduced the release of P65. The expression of phosphorylated P65(P–P65), a marker of NF-κB activation (Christian et al., 2016), was also been inhibited. Compared with the control group, the expression of IκBα protein in the model group was decreased indicating that the p65 increased which was consistent with the result of p65. The expression of p-IκBα was significantly inhibited by PHI, indicating that p65 protein released by IκBα decreased and inflammatory reaction was inhibited. These results were consistent with PCR results. The experiment results proved that the anti-inflammatory effect of PHI depended on NF-κB signal pathway and was realized by inhibiting IKKβ, P65, P–P65, and pIκBα which were consistent with the results of molecular docking. It has been reported that inhibition of NF-κB signaling pathway played an important role in reducing liver fibrosis reaction (Jaeyeon Jung, 2004). Activation of hepatic stellate cells is the key in the process of hepatic fibrosis which usually express α-SMA and excess COL1 (Jingjing Jiao and Costica, 2009; D. Li et al., 1999; Thirunavukkarasu et al., 2005; Thirunavukkarasu et al., 2006). In this experiment, LPS can not only stimulate LX2 cells to secrete inflammatory cytokines, but also activate LX2 cells to express fibrotic cytokines of α-SMA and COL1, which was consistent with previous studies (Liu et al., 2015; Paik et al., 2003).The administration of PHI inhibited both the expression of protein in NF-κB signaling pathway and α-SMA and COL1 in LX2 cells, which indicated that PHI's anti-fibrosis effect may be related to antiinflammatory effect. To explore this connection, we studied the expression of TAK1. TAK1 is a key regulator of inflammation, immune and stress response signaling (Dai et al., 2012; Sakurai, 2012). Arsura confirmed that TGF-β1 induced activation of NF-κB was mediated by TAK1 (Arsura et al., 2003). Knockout of TAK1 can reduce macrophage

Fig. 8. Effects of different concentrations of PHI on L02 cells. Experimental treatments were analyzed in triplicate and quantitative data are expressed as the mean ± SD of six independent experiments. ***p < 0.001 PHI vs control; **p < 0.01 PHI vs control.

were usually not considered (Cavasotto et al., 2004; Spyrakis et al., 2015), the results of molecular docking needed further biological verification. LPS induced LX2 cells inflammation model was successfully established with upregulation of IL-1β, IL-6 and TNF-α levels, which was in accordance with the reported work (Y. Chen et al., 2016; Liu et al., 2015). In the current experiment, we observed that LPS can activate TLR4/MyD88/NF-κB signaling pathway in LX2 cells, promote the expression of TLR4, MYD88, TAK1, p65, p-p65, p-IκBα, IKKβ. NF-κB protein family includes RelA (p65), RELB, C-REL, P50 (P105 precursor) and p52 (p100 precursor) (Bassères et al., 2006; Courtois et al., 2006; Ghosh and Karin, 2002; Huang and Miyamoto, 2001; Malek, 2001; Tam et al., 2001; Toubi and Yehuda, 2004). RelA (p65), RelB and c-Rel contain a C-terminal transactivation domain (TAD), allowing them to activate target gene expression. P65 was selected as NFκB for research in this experiment. The transcription of IκBα is 8

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

Declaration of competing interest

infiltration and myofibroblast activation in mice (I. J. Song et al., 2018). In other words, TAK1 may play a pivotal role between inflammation and fibrosis. In this experiment, we found that PHI can inhibit the expression of TAK1. The liver is mainly composed of parenchymal cells and non-parenchymal cells. The parenchymal cells are mainly hepatocyte, and the non-parenchymal cells include kupffer cell, hepatic stellate cell, and liver sinusoidal endothelial cell (Si-Tayeb et al., 2010). Among them, Hepatic stellate cell accounts for 5%–8% (Geerts, 2001) and Hepatocyte for 60%–70%(G, 2010). Since most of the liver are parenchymal cells, parenchymal cells are responsible for most functions of the liver, such as energy metabolism, bile acid synthesis and biotransformation of xenobiotics(Pfeiffer et al., 2015; Si-Tayeb et al., 2010). Therefore, when looking for anti-hepatic fibrosis drugs, it is also necessary to consider whether drugs have effects on liver parenchymal cells. When confirming that PHI inhibits LPS-stimulated activation of LX2 cells, this experiment also examined the effect of PHI on L02 cells of human normal liver cells. It was found that 50 μg/mL PHI had no effect on the proliferation of L02 cells, and 12.5 μg/mL PHI had a slight promoting effect on the proliferation of L02 cells, suggesting that PHI may have a certain hepatoprotective effect, which is consistent with the research by Song (W. Song et al., 2018). Therefore, it can be further explained that PHI has higher safety and higher specificity for LX2 cells. Kupffer cells and monocytes also play an important role in liver fibrosis and inflammation. Stimulated by LPS, kupffer cells and monocytes transformed into macrophages. Macrophages are the main sources of liver inflammatory factors which can directly stimulate HSCs proliferation and collagen synthesis and participate in the formation of liver fibrosis (Heymann, 2009; Wynn et al., 2010). Hepatic macrophages have high plasticity, which is characterized by macrophages in the stage of liver injury, secreting a large number of inflammatory factors and promoting the activation of HSCs. After liver injury stops, liver macrophages will transform phenotype into repair macrophages, promoting tissue repair and regression of fibrosis. Although the antihepatic fibrosis mechanism of PHI has been proved to be related to TLR4/MyD88/NF-κB signaling pathway, further research is also needed to figure out whether other signaling pathways or cells are involved in this pathogenesis.

The authors declare no conflict of interest. References Regnier, Catherine H., S, H.Y., Gao, Xiong, Goeddel, David V., Cao, Zhaodan, Rothe, Mike, 1997. Identification and characterization of an IκB kinase. Cell 90, 373–383. https://doi.org/10.1016/s0092-8674(00)80344-x. Alkhalf, M.I., Khalifa, F.K., 2018. Blueberry extract attenuates gamma-radiation-induced hepatocyte damage by modulating oxidative stress and suppressing NF-kappaB in male rats. Saudi J. Biol. Sci. 25 (7), 1272–1277. https://doi.org/10.1016/j.sjbs.2018. 07.002. Arsura, M., Panta, G.R., Bilyeu, J.D., Cavin, L.G., Sovak, M.A., Oliver, A.A., Factor, V., Heuchel, R., Mercurio, F., Thorgeirsson, S.S., Sonenshein, G.E., 2003. Transient activation of NF-kappaB through a TAK1/IKK kinase pathway by TGF-beta1 inhibits AP-1/SMAD signaling and apoptosis: implications in liver tumor formation. Oncogene 22 (3), 412–425. https://doi.org/10.1038/sj.onc.1206132. Bassères, D.S., Baldwin, A.S., 2006. Nuclear factor-κB and inhibitor of κB kinase pathways in oncogenic initiation and progression. Oncogene 25 (51), 6817–6830. https://doi. org/10.1038/sj.onc.1209942. Bataller, R., Brenner, D.A., 2005. Liver fibrosis. J. Clin. Investig. 115 (2), 209–218. https://doi.org/10.1172/jci24282. Cavasotto, C.N., Abagyan, R.A., 2004. Protein flexibility in ligand docking and virtual screening to protein kinases. J. Mol. Biol. 337 (1), 209–225. https://doi.org/10. 1016/j.jmb.2004.01.003. Chan, C.C., Hwang, S.J., Lee, F.Y., Wang, S.S., Chang, F.Y., Li, C.P., Chu, C.J., Lu, R.H., Lee, S.D., 1997. Prognostic value of plasma endotoxin levels in patients with cirrhosis. Scand. J. Gastroenterol. 32 (9), 942–946. https://doi.org/10.3109/ 00365529709011206. Chang, M.W., Ayeni, C., Breuer, S., Torbett, B.E., 2010. Virtual screening for HIV protease inhibitors: a comparison of AutoDock 4 and Vina. PLoS One 5 (8), e11955. https:// doi.org/10.1371/journal.pone.0011955. Chen, C.L., Zhang, D.D., 2014. Anti-inflammatory effects of 81 Chinese herb extracts and their correlation with the characteristics of traditional Chinese medicine. Evid Based Complement Alternat Med 985176. https://doi.org/10.1155/2014/985176. 2014. Chen, Y., Zeng, Z., Shen, X., Wu, Z., Dong, Y., Cheng, J.C., 2016. MicroRNA-146a-5p negatively regulates pro-inflammatory cytokine secretion and cell activation in lipopolysaccharide stimulated human hepatic stellate cells through inhibition of tolllike receptor 4 signaling pathways. Int. J. Mol. Sci. 17 (7). https://doi.org/10.3390/ ijms17071076. Chinese Pharmacopoeia Commission, 2015. Pharmacopeia of the People's republic of China (2015 Version). The medicine science and technology press of China, Beijing, pp. 170–171. Christian, F., Smith, E.L., Carmody, R.J., 2016. The regulation of NF-kappaB subunits by phosphorylation. Cells 5 (1). https://doi.org/10.3390/cells5010012. Courtois, G., Gilmore, T.D., 2006. Mutations in the NF-kappaB signaling pathway: implications for human disease. Oncogene 25 (51), 6831–6843. https://doi.org/10. 1038/sj.onc.1209939. Dai, L., Aye Thu, C., Liu, X.Y., Xi, J., Cheung, P.C., 2012. TAK1, more than just innate immunity. IUBMB Life 64 (10), 825–834. https://doi.org/10.1002/iub.1078. DiDonato, Joseph A., H, M., Rothwarf, David M., Zandi, Ebrahim, Karin, Michael, 1997. A cytokine-responsive IκB kinase that activates the transcription factor NF-κB. Nature 388, 548–554. https://doi.org/10.1038/41493. Du, B., Zhang, L., Sun, Y., Zhang, G., Yao, J., Jiang, M., Pan, L., Sun, C., 2019. Phillygenin exhibits anti-inflammatory activity through modulating multiple cellular behaviors of mouse lymphocytes. Immunopharmacol. Immunotoxicol. 41 (1), 1–10. https://doi. org/10.1080/08923973.2018.1547742. Eli Pikarsky, R.M.P., Stein, Ilan, Abramovitch, Rinat, Amit, Sharon, Kasem, Shafika, Gutkovich-Pyest, Elena, Urieli-Shoval, Simcha, Galun, Eithan, Ben-Neriah, Yinon, 2004. NF-kB functions as a tumour promoter in inflammation-associated cancer. Nature 431 (7007), 461–466. https://doi.org/10.1038/nature02924. Farzaei, M.H., Zobeiri, M., Parvizi, F., El-Senduny, F.F., Marmouzi, I., Coy-Barrera, E., Naseri, R., Nabavi, S.M., Rahimi, R., Abdollahi, M., 2018. Curcumin in liver diseases: a systematic review of the cellular mechanisms of oxidative stress and clinical perspective. Nutrients 10 (7). https://doi.org/10.3390/nu10070855. Frank Mercurio, H.Z., Murray, Brion W., Shevchenko, Andrej, Bennett, Brydon L., wu Li, Jian, Young, David B., Barbosa, Miguel, Mann, Matthias, Manning, Anthony, Rao, Anjana, 1997. IKK-1 and IKK-2: cytokine-activated IKB kinases essential for NF-KB activation. Science 278 (5339), 860–866. https://doi.org/10.1126/science.278. 5339.860. Friedman, S.L., 2008. Hepatic stellate cells: protean, multifunctional, and enigmatic cells of the liver. Physiol. Rev. 88 (1), 125–172. https://doi.org/10.1152/physrev.00013. 2007. G A, 2010. Recent advances in the isolation of liver cells. Hepatology 20 (2), 494–514. https://doi.org/10.1002/hep.1840200231. Geerts, A., 2001. History, heterogeneity, developmental biology, and functions of quiescent hepatic stellate cells. Semin. Liver Dis. 21, 311–335. https://doi.org/10. 1055/s-2001-17550. Ghosh, S., Karin, M., 2002. Missing pieces in the NF-kappaB puzzle. Cell 109 (Suppl. l), S81–S96. https://doi.org/10.1016/S0092-8674(02)00703-1. Guo, M., 2018. Professor Zhang Chizhi's Academic Thoughts and Medication Rules of Treating Chronic Severe Hepatitis Using the Theory of Warm Disease. (MASTER DISSERTATION). Hubei University of Chinese Medicine.

5. Conclusions The research results showed that LX2 cells were activated and expressed a large number of inflammatory factors and fibrotic cytokines under the stimulation of LPS. PHI can inhibit the expression of inflammatory factors and fibrotic factors through TLR4/MyD88/NF-κB signaling pathway by targeting TLR4, MyD88, TAK1, p65, p-p65, pIκBα and IKKβ, thus inhibiting the activation of LX2 cells.

Author contributions N.H. (Naihua Hu), Y.L. (Yunxia Li) and C.P. (Cheng Peng) designed the study and directed the study's optimization strategy. N.H. summarized the Results and Discussion sections of the text. WB and qPCR were performed by C.W., X.D., N.H., and M.Z. N.H., L.G. and L.Y. conducted the biological experiments and analyzed the data. All the authors read and approved the final manuscript.

Funding The study was supported by the National Natural Science Foundation of China (No:81373943, 81573583), Sichuan Provincial Science and Technology Department of Youth Science and technology innovation research team program (2017TD0001). 9

Journal of Ethnopharmacology xxx (xxxx) xxxx

N. Hu, et al.

human hepatic stellate cells. Hepatology 37 (5), 1043–1055. https://doi.org/10. 1053/jhep.2003.50182. Pellicoro, A., Ramachandran, P., Iredale, J.P., Fallowfield, J.A., 2014. Liver fibrosis and repair: immune regulation of wound healing in a solid organ. Nat. Rev. Immunol. 14 (3), 181–194. https://doi.org/10.1038/nri3623. Pfeiffer, E., Kegel, V., Zeilinger, K., Hengstler, J.G., Nussler, A.K., Seehofer, D., Damm, G., 2015. Featured Article: isolation, characterization, and cultivation of human hepatocytes and non-parenchymal liver cells. Exp. Biol. Med. 240 (5), 645–656. https:// doi.org/10.1177/1535370214558025. Qian, H., Deng, X., Huang, Z.W., Wei, J., Ding, C.H., Feng, R.X., Zeng, X., Chen, Y.X., Ding, J., Qiu, L., Hu, Z.L., Zhang, X., Wang, H.Y., Zhang, J.P., Xie, W.F., 2015. An HNF1alpha-regulated feedback circuit modulates hepatic fibrogenesis via the crosstalk between hepatocytes and hepatic stellate cells. Cell Res. 25 (8), 930–945. https://doi.org/10.1038/cr.2015.84. Ren, J.X., Li, L.L., Zheng, R.L., Xie, H.Z., Cao, Z.X., Feng, S., Pan, Y.L., Chen, X., Wei, Y.Q., Yang, S.Y., 2011. Discovery of novel Pim-1 kinase inhibitors by a hierarchical multistage virtual screening approach based on SVM model, pharmacophore, and molecular docking. J. Chem. Inf. Model. 51 (6), 1364–1375. https://doi.org/10.1021/ ci100464b. Sakurai, H., 2012. Targeting of TAK1 in inflammatory disorders and cancer. Trends Pharmacol. Sci. 33 (10), 522–530. https://doi.org/10.1016/j.tips.2012.06.007. Schneider, G., 2018. Automating drug discovery. Nat. Rev. Drug Discov. 17 (2), 97–113. https://doi.org/10.1038/nrd.2017.232. Si-Tayeb, K., Lemaigre, F.P., Duncan, S.A., 2010. Organogenesis and development of the liver. Dev. Cell 18 (2), 175–189. https://doi.org/10.1016/j.devcel.2010.01.011. Soares, J.B., Pimentel-Nunes, P., Roncon-Albuquerque, R., Leite-Moreira, A., 2010. The role of lipopolysaccharide/toll-like receptor 4 signaling in chronic liver diseases. Hepatol Int 4 (4), 659–672. https://doi.org/10.1007/s12072-010-9219-x. Song, I.J., Yang, Y.M., Inokuchi-Shimizu, S., Roh, Y.S., Yang, L., Seki, E., 2018. The contribution of toll-like receptor signaling to the development of liver fibrosis and cancer in hepatocyte-specific TAK1-deleted mice. Int. J. Cancer 142 (1), 81–91. https://doi.org/10.1002/ijc.31029. Song, W., Wu, J., Yu, L., Peng, Z., 2018. Evaluation of the pharmacokinetics and hepatoprotective effects of phillygenin in mouse. BioMed Res. Int. https://doi.org/10. 1155/2018/7964318. 2018, 7964318. Spyrakis, F., Cavasotto, C.N., 2015. Open challenges in structure-based virtual screening: receptor modeling, target flexibility consideration and active site water molecules description. Arch. Biochem. Biophys. 583, 105–119. https://doi.org/10.1016/j.abb. 2015.08.002. Tam, W.F., Sen, R., 2001. IkappaB family members function by different mechanisms. J. Biol. Chem. 276 (11), 7701–7704. https://doi.org/10.1074/jbc.C000916200. Thirunavukkarasu, C., Uemura, T., Wang, L.F., Watkins, S.C., Gandhi, C.R., 2005. Normal rat hepatic stellate cells respond to endotoxin in LBP-independent manner to produce inhibitor(s) of DNA synthesis in hepatocytes. J. Cell. Physiol. 204 (2), 654–665. https://doi.org/10.1002/jcp.20366. Thirunavukkarasu, C., Watkins, S.C., Gandhi, C.R., 2006. Mechanisms of endotoxin-induced NO, IL-6, and TNF-alpha production in activated rat hepatic stellate cells: role of p38 MAPK. Hepatology 44 (2), 389–398. https://doi.org/10.1002/hep.21254. Toubi, E.S., Yehuda, 2004. Toll-like receptors and their role in the development of autoimmune diseases. Autoimmunity 37 (3), 183–188. https://doi.org/10.1080/ 08916930410001704944. Venkatachalam, C.M., Jiang, X., Oldfield, T., Waldman, M., 2003. LigandFit: a novel method for the shape-directed rapid docking of ligands to protein active sites. J. Mol. Graph. Model. 21, 289–307. https://doi.org/10.1016/s1093-3263(02)00164-x. Wynn, T.A., Barron, L., 2010. Macrophages: master regulators of inflammation and fibrosis. Semin. Liver Dis. 30 (3), 245–257. https://doi.org/10.1055/s-0030-1255354. Xiaoxv Dong, J.F., Yin, Xingbin, Cao, Sali, Li, Xuechun, Lin, Longfei, Huyiligeqi, Ni1, Jian, 2016. Emodin: a review of its pharmacology, toxicity and pharmacokinetics. Phytother Res. 30 (8), 1207–1218. https://doi.org/10.1002/ptr.5631. Xu, F., Liu, C., Zhou, D., Zhang, L., 2016. TGF-beta/SMAD pathway and its regulation in hepatic fibrosis. J. Histochem. Cytochem. 64 (3), 157–167. https://doi.org/10.1369/ 0022155415627681. Yuriev, E., Holien, J., Ramsland, P.A., 2015. Improvements, trends, and new ideas in molecular docking: 2012-2013 in review. J. Mol. Recognit. 28 (10), 581–604. https://doi.org/10.1002/jmr.2471. Zandi, E., Rothwarf, D.M., Delhase, M., Hayakawa, M., Karin, M., 1997. The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell 91 (2), 243–252. https://doi.org/10.1016/s0092-8674(00)80406-7. Zhang, Y., Miao, H., Yan, H., Sheng, Y., Ji, L., 2018. Hepatoprotective effect of Forsythiae Fructus water extract against carbon tetrachloride-induced liver fibrosis in mice. J. Ethnopharmacol. 218, 27–34. https://doi.org/10.1016/j.jep.2018.02.033.

Guo, Y.P., Lin, L.G., Wang, Y.T., 2015. Chemistry and pharmacology of the herb pair Flos Lonicerae japonicae-Forsythiae fructus. Chin. Med. 10 (1), 16. https://doi.org/10. 1186/s13020-015-0044-y. Gur, C., Doron, S., Kfir-Erenfeld, S., Horwitz, E., Abu-Tair, L., Safadi, R., Mandelboim, O., 2012. NKp46-mediated killing of human and mouse hepatic stellate cells attenuates liver fibrosis. Gut 61 (6), 885–893. https://doi.org/10.1136/gutjnl-2011-301400. He, J., Wei, W., Yang, Q., Wang, Y., 2019. Phillygenin exerts in vitro and in vivo antitumor effects in drug-resistant human esophageal cancer cells by inducing mitochondrial-mediated apoptosis, ROS generation, and inhibition of the nuclear factor kappa B NF-kappaB signalling pathway. Med. Sci. Monit. 25, 739–745. https://doi. org/10.12659/MSM.913138. Henderson, N.C., Iredale, J.P., 2007. Liver fibrosis: cellular mechanisms of progression and resolution. Clin. Sci. (Lond.) 112 (5), 265–280. https://doi.org/10.1042/ CS20060242. Heymann, F., C, T., F, T., 2009. Monocytes and macrophages as cellular targets in liver fibrosis 8https://doi.org/10.2174/187152809789352230. (4). Huang, T.T., Miyamoto, S., 2001. Postrepression activation of NF-kappaB requires the amino-terminal nuclear export signal specific to IkappaBalpha. Mol. Cell. Biol. 21 (14), 4737–4747. https://doi.org/10.1128/MCB.21.14.4737-4747.2001. Huang, S.-Y., Grinter, S.Z., Zou, X., 2010. Scoring functions and their evaluation methods for protein–ligand docking: recent advances and future directions. Phys. Chem. Chem. Phys. 12 (40), 12899. https://doi.org/10.1039/c0cp00151a. Jaeyeon Jung, E.S., Balakrishnan, Hari, Member IEEE, Morris, Robert, 2004. Inhibition of inhibitor of κB kinases stimulates hepatic stellate cell apoptosis and accelerated recovery from rat liver fibrosis. Gastroenterology 128 (1), 108–120. https://doi.org/10. 1053/j.gastro.2004.10.003. Jingjing Jiao, S.L.F., Costica, Aloman, 2009. Hepatic fibrosis. Curr. Opin. Gastroenterol. 25 (3), 223–229. https://doi.org/10.1097/mog.0b013e3283279668. John, D., Woronicz, X.G., Cao, Zhaodan, Rothe, Mike, Goeddel, David V., 1997. IkB kinase-Beta:NF-kB activation and complex formation with IkB kinase-Alpha and NIK. Science 278 (31), 866–869. https://doi.org/10.1126/science.278.5339.866. Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11 (5), 373–384. https://doi.org/10. 1038/ni.1863. Li, D., Friedman, S.L., 1999. Liver fibrogenesis and the role of hepatic stellate cells: new insights and prospects for therapy. J. Gastroenterol. Hepatol. 14 (7), 618–633. https://doi.org/10.1046/j.1440-1746.1999.01928.x. Li, J., Fu, A., Zhang, L., 2019. An overview of scoring functions used for protein-ligand interactions in molecular docking. Interdiscip Sci. https://doi.org/10.1007/s12539019-00327-w. Liaskou, E., Wilson, D.V., Oo, Y.H., 2012. Innate immune cells in liver inflammation. Mediat. Inflamm. 949157. https://doi.org/10.1155/2012/949157. 2012. Lim, H., Lee, J.G., Lee, S.H., Kim, Y.S., Kim, H.P., 2008. Anti-inflammatory activity of phylligenin, a lignan from the fruits of Forsythia koreana, and its cellular mechanism of action. J. Ethnopharmacol. 118 (1), 113–117. https://doi.org/10.1016/j.jep.2008. 03.016. Liu, M., Xu, Y., Han, X., Yin, L., Xu, L., Qi, Y., Zhao, Y., Liu, K., Peng, J., 2015. Dioscin alleviates alcoholic liver fibrosis by attenuating hepatic stellate cell activation via the TLR4/MyD88/NF-kappaB signaling pathway. Sci. Rep. 5, 18038. https://doi.org/10. 1038/srep18038. Maeda, S., Kamata, H., Luo, J.L., Leffert, H., Karin, M., 2005. IKKbeta couples hepatocyte death to cytokine-driven compensatory proliferation that promotes chemical hepatocarcinogenesis. Cell 121 (7), 977–990. https://doi.org/10.1016/j.cell.2005.04.014. Malek, S., C, Y., Huxford, T., Ghosh, G., 2001. Ikappa Bbeta,but not lkappa Balpha,Functions as a classical cytoplasmic inhibitor of NF-kappa B dimers by masking bothnf-kappa B nuclear localization sequences in resting cells. J. Biol. Chem. 276 (48), 45225–45235. https://doi.org/10.1074/jbc.m105865200. Matsuno, K., Masuda, Y., Uehara, Y., Sato, H., Muroya, A., Takahashi, O., Yokotagawa, T., Furuya, T., Okawara, T., Otsuka, M., Ogo, N., Ashizawa, T., Oshita, C., Tai, S., Ishii, H., Akiyama, Y., Asai, A., 2010. Identification of a new series of STAT3 inhibitors by virtual screening. ACS Med. Chem. Lett. 1 (8), 371–375. https://doi.org/10.1021/ ml1000273. Min-Jung Chang, T.M.H., Byung-Sun, Min, 2008. Lignans from the fruits of\ Forsythia suspensa\ (thunb.) Vahl protect high-density lipoprotein during oxidative stress. Biosci. Biotechnol. Biochem. 72 (10), 2750–2755. https://doi.org/10.1271/bbb. 80392. Mitchell, J.P., Carmody, R.J., 2018. NF-kappaB and the transcriptional control of inflammation. Int Rev Cell Mol Biol 335, 41–84. https://doi.org/10.1016/bs.ircmb. 2017.07.007. Napetschnig, J., Wu, H., 2013. Molecular basis of NF-kappaB signaling. Annu. Rev. Biophys. 42, 443–468. https://doi.org/10.1146/annurev-biophys-083012-130338. Paik, Y.H., Schwabe, R.F., Bataller, R., Russo, M.P., Jobin, C., Brenner, D.A., 2003. Tolllike receptor 4 mediates inflammatory signaling by bacterial lipopolysaccharide in

10