Phylogenetic relationships among species of Tamarix (Tamaricaceae) in China

Phylogenetic relationships among species of Tamarix (Tamaricaceae) in China

Biochemical Systematics and Ecology 69 (2016) 213e221 Contents lists available at ScienceDirect Biochemical Systematics and Ecology journal homepage...

1MB Sizes 196 Downloads 460 Views

Biochemical Systematics and Ecology 69 (2016) 213e221

Contents lists available at ScienceDirect

Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco

Phylogenetic relationships among species of Tamarix (Tamaricaceae) in China Likun Sun a, Ruiqi Yang a, b, Baogui Zhang a, Gaosen Zhang a, Xiukun Wu a, Wei Zhang a, Binlin Zhang a, c, Tuo Chen a, c, d, **, Guangxiu Liu a, * a

Key Laboratory of Extreme Environmental Microbial Resources and Engineering, Gansu Province, Northwest Institute of EcoEnvironment and Resources, Chinese Academy of Sciences, Lanzhou, 730000, Gansu, China b School of Chemical and Biological Engineering, Lanzhou Jiaotong University, Lanzhou, 730070, Gansu, China c State Key Laboratory of Cryospheric Sciences, Northwest Institute of Eco-Environment and Resources, Chinese Academy of Sciences, Lanzhou, 730000, Gansu, China d Marine and Fisheries Agency of Changyi, Changyi, Shandong 261300, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 May 2016 Received in revised form 5 October 2016 Accepted 8 October 2016

Tamarix is a genus in family Tamaricaceae. The present study inferred phylogenetic trees for sixteen Tamarix species from China, whose status has remained unclear, using the nuclear internal transcribed spacer (ITS) region and four chloroplast DNA regions. Thirty ITS sequences from the GenBank database were added for expanded ITS analysis. The molecular phylogenies divide the Tamarix species into eight clades. Tamarix androssowii, T. gracilis, and T. laxa group together as a subclade closely related to T. gansuensis and T. elongata (clade A). Tamarix austromongolica, T. chinensis, T. hohenackeri, T. ramosissima, and T. sachensis cluster into clade B; T. karelinii from Gansu province is also in this clade. Tamarix leptostachya belongs to clade C, and one population of T. ramosissima from Gansu province is placed in this clade in the expanded ITS tree. Tamarix hispida groups with T. karelinii from Xinjiang province in clade D. Three putative T. hispida individuals from Gansu province and T. hispida from the US cluster into clade E. Finally, Tamarix arceuthoides, T. taklamakanensis, and T. aphylla form separate clades (F, G, and H, respectively). These molecular analyses are consistent with the current classification of certain Tamarix species based on morphological traits. © 2016 Elsevier Ltd. All rights reserved.

Keywords: Chloroplast DNA region Morphological characteristics nrDNA ITS Phylogeny Tamarix

1. Introduction Tamarix L. (Tamaricaceae) is an Old World genus that occurred in the ancient Mediterranean region and is now widely distributed in eastern and southern Asia, southern Europe, the Mediterranean, the Middle East, and North Africa (Baum, 1978; Gaskin, 2003). The plants of this genus are subshrubs, shrubs, or small trees, and usually are halophytes, rheophytes, or xerophytes (Gaskin, 2003). In China, Tamarix is widespread, particularly in the arid northwest region but also elsewhere,

* Corresponding author. No.320, West of DongGang road, Chenguan district, Northwest Institute of Eco-Environment and Resources, Lanzhou, 730000, Gansu, China. ** Corresponding author. No.320, West of DongGang road, Chenguan district, Northwest Institute of Eco-Environment and Resources, Lanzhou, 730000, Gansu, China. E-mail addresses: [email protected] (L. Sun), [email protected] (T. Chen), [email protected] (G. Liu). http://dx.doi.org/10.1016/j.bse.2016.10.003 0305-1978/© 2016 Elsevier Ltd. All rights reserved.

214

L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

being found in Xinjiang, Gansu, Inner Mongolia, Qinghai, and Ningxia. The Tarim Basin in Xinjiang is considered one of the centers of diversity for Tamarix in China, with 14 of the 16 Chinese species in the genus, including endemics such as Tamarix taklamakanensis M. T. Liu and T. tarimensis P. Y. Zhang et M. T. Liu (Zhang et al., 2002). One or two species are found in the river delta and saline wetlands of eastern and northeast China (Zhang et al., 1989). Occurring in diverse, harsh habitats, the plants have evolved various physiological traits, such as deep root systems, subulate leaves, glabrous, papillose younger branches, long flowering periods, and the production of numerous, wind-dispersed seeds (Chen et al., 2010, 2013; Zhang et al., 2003). Thirteen molecular pathways in this genus as potential adaptations to harsh habitats have also been elucidated. For example, pathways related to signal transduction, cell wall structure, phosphatase activity, and lipid kinase activity are highly enriched. Moreover, the genes involved in lignin metabolism and the biosynthesis of proline and trehalose are expressed in this genus in response to NaHCO3 stress (Wang et al., 2014). Thus, Tamarix species are often used in restoring arid and saline habitats, such as deserts, regions with saline soils, and saline wetlands. These species also play important roles in reducing desertification through slowing wind speeds and stabilizing soil in sand dunes. These ecological functions were confirmed in the southern margin of the Taklimakan desert, north of the Kunlun Mountains and Hotan Drainage basin (Yang et al., 2005), and also in Tarim Basin region with high salinity and lower underground water (Fan et al., 2013). Therefore, species of this genus have been selected for soil stabilization and the restoration of fragile ecosystems. Tamarix plants have also been used to create sea embankments in the Liaohe delta (Pan and Yu, 1998) and to remediate soil contaminated with heavy metals and organic matter (Ebrahimabadi and Alavi, 2013; Manousaki et al., 2008; Masciandaro et al., 2014). Moreover, these plants have been used as a source of beneficial compounds such as ethanol, polyphenols, phenolics, antioxidants, antivirals, anti-inflammatory substances, and cytotoxic compounds (Ionescu et al., 2014; Ksouri et al., 2009; Santi et al., 2014). However, because many species are indistinguishable in the vegetative state (Gaskin and Schaal, 2003), Tamarix is considered one of the most taxonomically difficult genera of angiosperms (Baum, 1978). It was first monographed by Willdenow (1813), who described 16 species. Bunge (1852) also monographed the genus, identifying 51 species and classifying the species primarily based on whether the racemes were produced on the previous year's woody branches (vernal) or on the current year's green branches (aestival). This character was considered diagnostically unreliable by Baum (1978), who later completed an exhaustive revision of the genus (Baum, 1978). Qaiser (1983) investigated Tamarix in Pakistan, China, Mongolia, and other regions of the world, and extended the genus to 68 species and 7 varieties. Recently, Villar et al. (2014) identified three species in Crete (Greece), and provided a dichotomous key for species of Tamarix in Greece (Villar et al., 2014). Villar García et al. (2014a and b) first described the morphology of T. hohenackeri Bunge in Mexico and five species in Spain, and published a dichotomous key for those six species. In China, investigation of the morphology and taxonomy of this genus was performed by Zhang and Jia (1962), Zhang and Liu (1988), and Zhang et al. (2002), establishing 16 species and 2 varieties so far. For delimiting problematic taxa, molecular phylogenies based on the nuclear internal transcribed spacer (ITS) region and chloroplast DNA (cpDNA) regions, combined with morphological characteristics, have frequently been used in recent years (Pinar et al., 2015; Zimmer and Wen, 2012). Sequences of ITS, chloroplast trnS-trnG, and the intron of phosphoenolpyruvate carboxylase (PepC) have all been used to reconstruct the phylogeny of Tamarix (Gaskin and Schaal, 2002; Mayonde et al., 2015; Zhang et al., 2000). These studies revealed an incidence of hybridization and introgression in populations of Tamarix in the USA and South Africa. Based on ITS sequences, Zhang et al. (2000) and Hua et al. (2003) constructed a molecular phylogeny of some species of Tamarix that occur in China. However, phylogenetic relationships within Tamarix remain to be further elucidated. In the present study, based on sequences of ITS and four chloroplast regions (trnL-trnF, rps16, psbB-psbH, and psbA-trnH), we analyzed the phylogenetic relationships of ten Tamarix species from China. Sampling was expanded using ITS sequences available in GenBank, and included seven individuals that were difficult to identify based on morphology. Our aim was to produce a robust phylogenetic hypothesis for this group in Tamarix, and compare molecular clades and morphological classification. We also discuss possible factors in the evolution of this group that might have led to the current taxonomic difficulties.

2. Materials and methods 2.1. Plant material DNA sequences were obtained from three sources. First, vouchers and silica-dried leaf samples from 10 of the 16 Chinese species were obtained from Gansu and Shandong province during their flowering time (June to August) in 2013 and 2014 (Table 1). Second, 30 ITS sequences from previous studies of 15 taxa that occur in China were obtained from GenBank (www. ncbi.nlm.nih.gov/genbank; Table S1). Of these 15 species, 6 were sampled only in China: T. austromongolica Nakai, T. arceuthoides Bunge, T. gansuensis H. Z. Chang, T. karelinii Bunge, T. sachensis P. Y. Zhang et M. T. Liu, and T. taklamakanensis M. T. Liu. Eight were sampled both in China and in other countries: T. androssowii Litw., T. chinensis Lour., T. elongata Ledeb., T. hispida Willd., T. hohenackeri Bunge, T. laxa Willd., T. leptostachya Bunge, and T. ramosissima Ledeb. Finally, Tamarix aphylla (L.) Warb. was sampled only in the US. Nine of the ten newly collected species are also represented by GenBank sequences of other populations, with the exception being T. gracilis Willd. Third, seven individuals with uncertain identifications based on their morphological characteristics were collected and sequenced, including four that were tentatively identified to species and

L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

215

Table 1 List of sampled species and their sources, vouchers, and GenBank accession numbers. Species

Voucher

Source

ITS

trnL-trnF

rps16

psbB-psbH

psbA-trnH

T. T. T. T. T. T. T. T. T. T. T. T. T. T.

Mingting Liu

Minqin, Bot Gard, Gansu province, China, N 38.5860 , E 102.9756 , alt. 1370 m

KT377289 KT377290 KT377274 KT377275 KT377282 KT377283 KT377293 KT377294 KT377280 KT377281 KT377284 KT377285 KT377272 KT377273

KT377353 e KT377356 e KT377361 KT377362 KT377354 KT377355 KT377358 KT377359 KT377360 KT448731 KT377351 KT377352

KT377336 e KT377339 e KT377344 KT377345 KT377337 KT377338 KT377341 KT377342 KT377343 e KT377334 KT377335

KT377322 KT448726 KT377325 KT448728 KT377330 KT377331 KT377323 KT377324 KT377327 KT377328 KT377329 KT448727 KT377320 KT377321

KT377303 KT448724 KT377308 KT448722 KT377304 KT377305 KT377309 KT377310 KT377306 KT377307 KT377302 KT448725 KT377311 KT377312

KT377276

KT377350

KT377333

KT377319

KT377313

KT377291 KT377292

KT448730 KT377357

e KT377340

KT448729 KT377326

KT448723 KT377314

KT377277 KT377278 KT377279 KT377298

KT377364 KT377365 KT377366 KT377363

KT377346 KT377347 KT377348 KT377349

KT377316 KT377317 KT377318 KT377332

KT377299 KT377300 KT377301 KT377315

austromongolica 1 austromongolica 2 elongata 1 elongata 2 hohenackeri 1 hohenackeri 2 karelinii 1 karelinii 2 laxa 1 laxa 2 ramosissima1 ramosissima 2 androssowii 1 androssowii 2

T. gracilis

T. leptostachya1 T. leptostachya2 T. chinensis1 T. chinensis2 T. chinensis 3 R. soongarica

Yong Zhang

Xiaofei Ma

Zhangye, Gansu province, China, N 39.0375 , E 100.4864 alt. 1429 m Baiyin, Gansu province, China, N 36.6006 , E 104.0718 alt. 1837m Minqin, Gansu province, China, N 38.4560 , E 103.1136 alt. 1305 m Wetland of Bo sea, Shandong, province, China, N 37.0100 , E 119.3881 alt. 1.4 m Laohutai, Gansu province, China, N 36.2437 , E 103.8300 alt. 1880m

three that remain unidentified (Table S2). Reaumuria songarica (Pall.) Maxim. in Tamaricaceae was also sampled and analyzed as an outgroup species. 2.2. Morphological analysis Phenological and morphological characters, including inflorescence, flowering time, number of floral parts, petal shape and color, and leaf morphology were determined according to species descriptions published by Zhang and Jia (1962), Baum (1978), Zhang et al. (1989), and Wu (1999). 2.3. Selection of molecular markers Twelve cpDNA regions and the nrDNA internal transcribed spacer regions (ITS-1 e 5.8S e ITS-2, referred to here as ITS) were screened for use (Table 2). Eight regionsdITS, trnL-trnF, petB-petD, trnS2-trnG2, ndhA, rps16, psbB-psbH, and psbAtrnHdwere successfully amplified. Five of the most variabledITS, trnL-trnF, rps16, psbB-psbH, and psbA-trnHdwere sequenced and used in further analyses. 2.4. DNA extraction, PCR amplification, and sequencing Total genomic DNA was extracted from approximately 20e30 mg of dry leaf tissue using HP Plant DNA extract kits (Omega, GA, USA), according to the manufacturer's protocol. The concentration and purity of the extracted DNA was quantified using a NanoDrop 2000 (ThermoScientific, DE, USA). PCR amplification was performed in a total volume of 25 mL, with 2.5 mL10  PCR buffer (Mg2þconcentration of 25 mM), 2 mL of each dNTP (10 mM), 1.5 U of Taq Polymerase (Takara), 10e30 ng genomic DNA, and 2 mL of each primer (5 mM). An S1000™ thermo cycler (Bio-Rad, CA, USA) was used with the following settings for ITS: 95  C for 3 min; 30 cycles of 95  C for 30 s, 58  C for 30 s, 72  C for 1min; and 72  C for 10 min. The cpDNA regions were amplified using the same conditions with the exception of annealing at 52  C for 1min and a final elongation at 72  C for 1min. After product purification with an alcohol/EDTA/NaAc protocol, PCR products were then sequenced on an ABI 3730 automated sequencer (Honortech Co., Ltd, Beijing, China). All sequence data has been deposited in GenBank (Table 1). 2.5. Phylogenetic analysis DNA sequences were aligned using ClustalX version 1.83 (Thompson et al., 1997) and checked manually. The number of indels and levels of polymorphism for each gene region were determined using DnaSP version 5.0 (Librado and Rozas, 2009). Because indels can improve support values in phylogenetic analysis (Simmons et al., 2001), all indels were encoded for

216

L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

Table 2 Primer pairs used for PCR amplification and sequencing. Gene amplification region

Primers sequence(50 e30 )

Amplified sequence length (bp)

Annealing temperature ( C)

Reference

ITS

ITS1:TCCGTAGGTGAACCTGCGG ITS4: TCCTCCGCTTATTGATATGC F: ATGTCACCAAAAACAGAGACTAAAG R: TGGATTACAAGTAATCAATCGTATC F71: GCTATGCTT AGTGTGTGACTCGTTG R1516: CCCTTCATTCTTCCTCTATGT TG L: CGAAATCGGTAGACGCTACG F: ATTTGAACTGGTGACACGAG F: CCAAATTCGTTCTCTCTGTG R: TATTCCATGAGTCAGGAGAG IF2: AAGGGATCTTTCTCCATATC IF4: ATTGCGAACGAAACTTCCAA IR2: CTTTGGTTTCAACCGTATAG IR4: CAGATATACGAGTGCCCTAC petB: CAATCCACTTTGACTCGTTTT petD: GGTTCACCAATCATTGATGGTTC atpH: AACAAAAGGATTCGCAAATAAAAG atpL: AGTTGTTGTTCTTGTTTCTTTAGT trnS: GCCGCTTTAGTCCACTCAGC trnG: GAACGAATCACACTTTTACCAC ndhA5: TCAACTATATCAACTGTACTTGAAC ndhA3: CGAGCTGCTGCTCAATCGAT petN: ATGGATATAGTAAGTCTCGCTTGC psbM: ATGGAAGTAAATATTCTTGCAT psbA: GTTATGCATGAACGTA ATGCTC trnH: CGCGCATGGTGGATTCACAA ATC F: GTGGTAGAA AGCAACGTGCGACTT R: TCGGGATCGAACATCAAT TGCAAC F: AGATGTTTTTGCTGGTATTGA R: TTCAACAGTTTGTGTAGCCA

690

58

Gaskin and Wilson (2007)

fail

fail

Small et al. (1998)

fail

fail

Small et al. (1998)

1100bp

52e55

Taberlet et al. (1991)

fail

fail

Mao (2010)

1500

52e57

Dong et al. (2012)

1000

fail

Dong et al. (2012)

1000

53

Gaskin and Schaal (2003)

1200

53

Dong et al. (2012)

fail

fail

Dong et al. (2012)

350

52e53

Wang et al. (2009)

1000

52

Zhang et al. (2014)

500

52

Zhang et al. (2014)

RbcL rpl16 trnL-trnF matK

petB-petD atpH-atpL trnS2-trnG2 ndhA petN-psbM psbA-trnH rps16 psbB-psbH

analysis using the simple coding method in GapCoder (Young and Healy, 2003). To determine whether the ITS and chloroplast data partitions differ significantly from random partitions of the combined data, the incongruence length difference (ILD) test was conducted in PAUP* (also known as the partition homogeneity test; Swofford, 1999) with 100 replicates and 1000 random-addition starting sequences. Phylogenetic trees were estimated for concatenated (ITS and cpDNA) datasets using maximum parsimony (MP) and Bayesian inference analyses. Expanded taxon sampling for a Bayesian analysis of ITS data was accomplished by adding GenBank sequences. Parsimony analyses were conducted in PAUP*, with the heuristic search option, 1000 random-addition sequence replicates, tree bisection-reconnection (TBR) branch swapping, and the MulTrees option. The consistency index (CI) and retention index (RI) were also calculated, and non-parametric bootstrap analyses were carried out with 1000 replicates with the full heuristic search option and TBR branch swapping. Bayesian phylogenetic inference was conducted using MrBayes3.0b4 (Huelsenbeck and Ronquist, 2001). The GTR model of DNA substitution was selected by the program Modeltest 3.7 (Posada and Crandall, 1998) as the best-fit model for the concatenated dataset and GenBank ITS sequences. Each search was started from random trees with four MCMCs (Markov's chain Monte Carlo simulations) and was run for 2,000,000 generations. The analysis was run until the two MCMC runs converged to a stationary distribution, with the first 10% of trees being discarded as burn-in, as assessed by inspection of the lnLtrace using Tracerv.1.5 (Rambaut and Drummond, 2007). Levels of support obtained were mapped on the Bayesian Inference (BI) Allcompat consensus tree, using the FigTreev.1.4 program (Rambaut, 2012). 3. Results Characteristics of each sequenced gene region are provided in Table 4. The ILD test indicated that the cpDNA and ITS datasets were congruent (p ¼ 0.170). Concatenated MP analyses produced a tree with 386 steps (CI: 0.925; RI: 0.731; Fig. 1) that is entirely consistent with the concatenated BI tree (Fig. 2). These trees contained four major lineages: A with T. androssowii, T. laxa, T. gracilis, and T. elongata; B with T. chinensis, T. hohenackeri, T. austromongolica, and T. ramosissima; C with T. leptostachya; and D with T. karelinii. A BI tree with expanded taxon sampling was produced by adding GenBank ITS sequences for six species, T. hispida, T. gansuensis, T. arceuthoides, T. sachensis, T. taklamakanensis, and T. aphylla (Table S1; Fig. 3). Several populations were tentatively identified to species, but their morphology is not definitive. It was not possible to identify members of the SC population to species; these three individuals clustered with T. arceuthoides with strongly support (0.99). A putative population of T. gansuensis did not group with a clearly identifiable specimen of T. gansuensis from the Turpan Desert Botanical Garden, but instead was closely related to the other species in clade B (Fig. 3). Comparing the three phylogenetic trees (Figs. 1e3), we

L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

217

Fig. 1. Phylogenetic analysis based on Maximum Parsimony method for Tamarix. Strict consensus tree of most-parsimonious trees concatenated ITS and sequences. Numbers above lines are bootstrap values.

found that T. androssowii, T. laxa, and T. gracilis consistently formed a clade, with T. elongata sister to that group (Figs. 1 and 2) along with T. gansuensis when it was sampled (Fig. 3; clade A); T. hohenackeri, T. austromongolica, T. chinensis, and T. ramosissima grouped together, and T. sachensis and T. karelinii (Gansu province) are added to this group in the expanded ITS analyses (clade B); The population of T. hispida from Xinjiang clustered with T. karelinii from the same region, rather than with T. hispida from the USA. In addition, all of the specimens of T. leptostachya clustered into a clade, and relationships of the single representatives of T. taklamakanensis and T. aphylla with the rest of the species were not strongly supported.

4. Discussion In this study, ITS and cpDNA sequences were used to reconstruct the phylogenetic relationships of Tamarix species in China. The results from morphological studies of the 16 species of Tamarix in China are summarized in Table 3 (Baum, 1978; Wu, 1999; Zhang and Jia, 1962; Zhang et al., 1989). Analyses of the concatenated dataset along with an expanded ITS dataset divided these species into eight clades (Figs. 1e3).

Fig. 2. Phylogenetic tree inferred by Bayesian analysis from the concatenated ITS and chloroplast datasets for Tamarix species. Values at nodes indicate Bayesian posterior probability.

218 L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

Fig. 3. Phylogenetic analysis based on Bayesian analysis for Tamarix using ITS sequence. (* show sequence download from Genbank).

L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

219

Table 3 Morphological characters used for classification of Tamarix species from China and clades based on morphological and molecular phylogenetic analyses. Species

Typical taxonomic characters

Flower organs characteristics

Morphological cladesa

Molecular clades

T. androssowii

Vernales, petals with 4 pieces

Bract length equal to petal; white petal, yellow or faint yellow anther Bract length equal or little longer than calyx; bulky and long (approximately 12 cm) raceme Bract length is shorter than the half-length of the petal; short (less than 6e7 cm) raceme, chocolate anther Acuminate calyx, petals with 5 pieces, Petals with 4 or 5 pieces; bract length equal or slightly shorter than calyx Pedicel, leaves and branches are slender and drooping; entire sepals rim, oval petals oblong petals, barrel or drum shape corolla Sepal rim is eroded-denticulate; obovate or elliptic obovate petal, glassy corolla Fully expanded and caducous petals at the time of seed maturation, white sepals Non-caducous petals at the time of seed maturation, erect branches, gray-green leaves Caducous petals, current year's leaves and branches with papillose or dense hair, bright-colored petals (redpurple) Non-caducous petals, sprout with little papillose or short hair Caducous petals at the time of seed maturation, compact panicle Short (3e5 cm) raceme, non-caducous petals; petals are less than 4 mm in diameter Long (7e15 cm) raceme; caducous petals, petals are 5 e7 mm in diameter Calyx ectropion

Clade III

Clade A

Clade III

Clade A

Clade III

Clade A

Clade III Clade III

Clade A Clade A

Clade I

Clade B

Clade I Clade I

Clade B Clade B,C

Clade I

Clade F

Clade I

Clade B

Clade II

Clade D, E

Clade II

Clade B, D

Clade II

Clade C

Clade IV

Clade B

Clade IV

Clade G

Not reported

Clade H

T. elongata T. laxa T. gansuensis T. gracilis

Vernales Vernales and aestivales

T. chinensis

Aestivales, non-caducous petals at the time of seed maturation

T. hohenackeri T. ramosissima T. arceuthoides

Aestivales, petals with 5 pieces

T. austromongolica

Aestivales;

T. hispida

T. karelinii T. leptostachya T. sachensis

Leaves are amplexicaul and vaginate

T. taklamakanensis T. aphylla a

Leaves are amplexicaul and vaginate

Reference from Zhang (2004).

Clade A includes five species, T. androssowii, T. elongata, T. gracilis, T. gansuensis, and T. laxa. A previous study (Bunge, 1852) divided Tamarix into two groups, vernales and aestivales. These species possess morphological traits characteristic of members of the vernales group, which produce inflorescences on the previous year's woody branches and have flowers with 4e5 petals. Raceme length distinguishes T. elongata (about 12 cm) from T. laxa (less than 6e7 cm). The petals of T. androssowii are white, and the anthers are yellow or faint yellow. T. gansuensis is morphologically similar to T. elongata. The morphological and molecular similarity of the five species in this clade may also be due to hybridization. The ranges of these species putatively overlap, and they have the same flowering time. Clade B comprises four species based on the multilocus analyses (Figs. 1 and 2), T. austromongolica, T. chinensis, T. hohenackeri, and T. ramosissima. These species are aestivales, in which the inflorescences grow on the current year's branches. Members of this clade can be identified by their sessile leaves, pentamerous flowers, and hololophic androecial discs (Gaskin and Schaal, 2003). The morphological similarity of T. ramosissima and T. chinensis render them difficult to distinguish (Gaskin,

Table 4 Sequence lengths and variability for Tamarix and the outgroup, Reaumuria songarica. Species group

DNA sequences

Aligned sequence length

Polymorphics No.

Indels No.

Mean G þ C content (%)

Within Tamarix

ITS trnL-trnF psbA-trnH rps16 psbB-psbH Chloroplast DNA region ITS trnL-trnF psbA-trnH rps16 psbB-psbH Chloroplast DNA region

686 713 347 797 625 2482 693 714 347 798 625 2484

34 4 2 10 4 20 133 72 34 64 26 196

2 4 27 7 7 45 40 25 72 16 27 140

61.0 30.1 24.5 30.2 33.9 30.4 61.2 29.7 26.3 30.2 34.5 30.7

With outgroup

220

L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

2003), but there are differences in petal shape (Zhang et al., 1989). T. ramosissima is distinguished from T. hohenackeri by the shape of the corolla (Zhang et al., 1989). T. chinensis is widely distributed in China, occurring in Anhui, Hebei, Henan, Jiangsu, Liaoning, Shandong, and some regions of Gansu and Qinghai. In China, wild populations are most common in the Yellow River Delta. This species is considered an invasive species in the USA. T. ramosissima is also a widespread species in China. Interestingly, Zhang (1988) reported specimens in Jinta of Gansu province and in Ejinaqi of Inner Mongolia that have morphological characteristics of both T. ramosissima and T. leptostachya; he hypothesized that these individuals were influenced by hybridization. T. leptostachya (clade C) is unresolved or weakly sister to clade B (which includes T. ramosissima) in the concatenated trees (Figs. 1 and 2); the sampled populations from both species are from Gansu province. In the expanded ITS tree, most populations of T. ramosissima remain in clade B, but one from Gansu province is placed in a clade with T. leptostachya (Fig. 3). Gaskin and Schaal (2002) found extensive hybridization among two of the invasive Tamarix species within the U.S., T. chinensis and T. ramosissima. Less often, other hybrids among the invasive species have been found, involving combinations of T. ramosissima and T. chinensis with T. parviflora and T. gallica. Hybridization has been reported among T. ramosissima, T. chinensis, T. hohenackeri, and T. arceuthoides in their native range (Wu, 1999). The high occurrence of hybridization among Tamarix species might be a major cause of some of the taxonomic confusion in this genus (Villar et al., 2014). T. sachensis and T. karelinii (Gansu province) were also in clade B in Fig. 3. The putative population of T. gansuensisis apparently misidentified in the wild, for it clusters with clade B. Clade C contains only one species, T. leptostachya, with the possible addition of one population of T. ramosissima (this species is otherwise placed in clade B, see above). The compact panicle of T. leptostachya when flowering makes it easy to distinguish from other species of Tamarix. Clade D includes only T. karelinii in the concatenated trees, but when T. hispida is added to the expanded ITS tree, some populations group with T. karelinii from Xinjiang province, whereas T. karelinii from Gansu province is placed weakly sister to clade B. A connection between T. karelinii and T. hispida is consistent with the results of ITS analyses by Zhang et al. (2000) and Hua et al. (2003). Leaves and branches produced in the current year are papillose or densely hairy for these two species. They also have a higher salt tolerance than do other members of Tamarix in China. Zhang et al. (1989) reported that T. karelinii was a hybrid between T. hispida and T. ramosissima of clade B. In the present study, T. karelinii was found to cluster with T. ramosissima in the expanded ITS tree (clade B in Fig. 3). Clade E in the expanded ITS BI tree includes a morphologically uncertain population of T. hispida from China with a population of T. hispida from the USA (posterior probability, PP ¼ 0.77). Notably, T. hispida from Xinjiang in China does not cluster with the population of T. hispida from the USA, suggesting the presence of intraspecific polymorphism in ITS. Intraindividual polymorphism of ITS sequences has been revealed across a range of taxa, including presumed non-hybrid diploids (Bailey et al., 2003). Clades F, G, and H each contain one species (Fig. 3). T. arceuthoides of clade F is aestivales, with fully expanded petals and caducous petals at the time of seed maturation; the five sepals are white. Based on morphological traits, T. arceuthoides and T. hohenackeri were placed as sister taxa by Zhang (2004), but they are not closely related in our ITS tree. The SC population clustered with T. arceuthoides with strong support (0.99), and so we resolved the classification of this population. T. taklamakanensis of clade G was first identified by Liu in 1960, and it is distributed mainly in the Taklimakan desert. These plants are restricted to extremely arid habitats with frequent sandstorms; it is the most xerophilous species of Tamarix. The morphology of T. sachensis is similar to that of T. taklamakanensis, as reported before (Wu, 1999; Zhang, 2004), but these two species are separated in the present phylogenetic analysis (Fig. 3). Finally, T. aphylla of clade H is easily distinguished from other species of Tamarix by its vaginate leaves. This species occurs only in the USA. In conclusion, the present study provides a clear framework for classification of Tamarix in China. The results indicate that morphological and molecular characters can effectively distinguish many species of Tamarix. Certain floral features (e.g., insertion of filaments) are shown to be more reliable than most of the vegetative characters for identification of Tamarix species. Other morphological characters (e.g., pale pink petal color) are not useful for species identification, owing to phenotypic variation within species of Tamarix with changes in climatic conditions or soil types. Several populations were of uncertain identity, based on morphology. Molecular characters provided some insights into their potential relationships. Among these, the most notable is the strong support for the placement of population SC. However, more rapidly evolving molecular markers will be required, to distinguish species within clade A and clade B. Additionally, given the evidence of possible hybridization within Tamarix, future studies need to consider potential gene flow among species.

Acknowledgements This work was financially supported by the National Natural Science Foundation of China (41271265, 31470544) and the knowledge innovation project of the Cold and Arid Regions Environmental and Engineering Research Institute, Chinese Academy of Sciences (51Y451A61). The authors are very grateful to Minqin Botanic Garden and members of the Marine and Fisheries Agency of ChangYi (Shandong province) for their support of this research. Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.bse.2016.10.003.

L. Sun et al. / Biochemical Systematics and Ecology 69 (2016) 213e221

221

References Bailey, C.D., Carr, T.G., Harris, S.A., et al., 2003. Characterization of angiosperm nrDNA polymorphism, paralogy, and pseudogenes. Mol. Phylogenetics Evol. 29, 435e455. Baum B.R., The genus Tamarix. Jerusalem: Israel Academy of Arts and Sciences xii, 209p. (Publications of the Israel Academy of Sciences and Humanities) - Icones, Maps. Geog, 1978, 1. Bunge, A., 1852. Tentamen generis Tamaricum species accuratius definiendi: (Progr. In solemn. Peractor. X lustrorum Univers. Dorpat.). Chen, Y., Wang, H., Zhang, F.S., et al., 2010. The characteristic of salt excretion and its affected factors on Tamarix ramosissima ledeb. under desert salinealkali habitat in Xinjiang Province. Acta Ecol. Sin. 30, 511e518 (in Chinese). Chen, Y., Zhou, H., Chen, Y., 2013. Adaptation strategies of desert riparian forest vegetation in response to drought stress. Ecohydrology 6, 956e973. Dong, W., Liu, J., Yu, J., et al., 2012. Highly variable chloroplast markers for evaluating plant phylogeny at low taxonomic levels and for DNA barcoding. PLoS One 7, e35071. Ebrahimabadi, A., Alavi, I., 2013. Plant type selection for reclamation of Sarcheshmeh copper mine using fuzzy-topsis approach. Archives Min. Sci. 58, 953e968. Fan, Z.L., Xu, H.L., Fu, J.Y., et al., 2013. Ecological protection objects and restoration measures in the lower reaches of Tarim River. J. Desert Res. 33, 1191e1197 (in Chinese). Gaskin, J.F., 2003. Tamaricaceae. Flower. Plants Dicotyledons. Springer, Berlin Heidelberg, pp. 363e368. Gaskin, J.F., Schaal, B.A., 2002. Hybrid Tamarix widespread in US invasion and undetected in native Asian range. Proc. Natl. Acad. Sci. 99, 11256e11259. Gaskin, J.F., Schaal, B.A., 2003. Molecular phylogenetic investigation of US invasive. Tamarix. Syst. Bot. 28, 86e95. Gaskin, J.F., Wilson, L.M., 2007. Phylogenetic relationships among native and naturalized Hieracium (Asteraceae) in Canada and the United States based on plastid DNA sequences. Syst. Bot. 32, 478e485. Hua, L., Zhang, D.Y., Pan, B.R., 2003. Molecular systematics of Tamarix and Myricaria in China inferred from ITS sequence data. Acta Bot. Yunnanica 26, 283e289 (in Chinese). Huelsenbeck, J.P., Ronquist, F., 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17, 754e755. Ionescu, D., Aldea, I.M., Bleotu, C., et al., 2014. Evaluation of antiral and cytotoxic activities of Tamarix gallica and Silybum marianum extracts. Farmacia 62, 329e340. Ksouri, R., Falleh, H., Megdiche, W., et al., 2009. Antioxidant and antimicrobial activities of the edible medicinal halophyte Tamarix gallica L. and related polyphenolic constituents. Food Chem. Toxicol. 47, 2083e2091. Librado, P., Rozas, J., 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25, 1451e1452. Manousaki, E., Kadukova, J., Papadantonakis, N., et al., 2008. Phytoextraction and phytoexcretion of Cd by the leaves of Tamarix smyrnensis growing on contaminated non-saline and saline soils. Environ. Res. 106, 326e332. Mao, K.S., 2010. Biogeography of Cupressaeeae Sensu Lato: from Plate Tectonics to Glaeial Refugia. Ph.D. Dissertation. Lanzhou University (in Chinese). Masciandaro, G., Di Biase, A., Macci, C., et al., 2014. Phytoremediation of dredged marine sediment: monitoring of chemical and biochemical processes contributing to sediment reclamation. J. Environ. Manag. 134, 166e174. Mayonde, S.G., Cron, G.V., Gaskin, J.F., et al., 2015. Evidence of Tamarix hybrids in South Africa, as inferred by nuclear ITS and plastid trnS-trnG DNA sequences. South Afr. J. Bot. 96, 122e131. Pan, W.L., Yu, L., 1998. Techniques for protection forest system construction on saline alkalized soil of Liaohe Delta. J. Appl. Ecol. 9, 231e236 (in Chinese). Posada, D., Crandall, K.A., 1998. Modeltest: testing the model of DNA substitution. Bioinformatics 14, 817e818. Pinar, M.S., Dizkirici, A., Yigit, O., 2015. Understanding taxonomic position of local endemic Agropyron deweyi (Poaceae) using morphological characters and sequences of nuclear and chloroplast DNA regions. Biologia 70, 1307e1317. Qaiser, M., 1983. The genus Tamarix (Tamaricaceae) in Pakistan. Iran. J. Bot. 2, 21e68. Rambaut, A., 2012. FigTree version 1.4.0. Available at: http://tree.bio.ed.ac.uk/software/figtree. Rambaut, A., Drummond, A.J., 2007. Tracer Version 1.5. Available at: http://beast.bio.ed.ac.uk/Tracer. Santi, G., D'Annibale, A., Eshel, A., et al., 2014. Ethanol production from xerophilic and salt-resistant Tamarix jordanis biomass. Biomass Bioenergy 61, 73e81. Small, R.L., Ryburn, J.A., Cronn, R.C., et al., 1998. The tortoise and the hare: choosing between noncoding plastome and nuclear Adh sequences for phylogeny reconstruction in a recently diverged plant group. Am. J. Bot. 85, 1301e1315. Simmons, M.P., Ochoterena, H., Carr, T.G., 2001. Incorporation, relative homoplasy, and effect of gap characters in sequence-based phylogenetic analyses. Syst. Biol. 50, 454e462. Swofford, D.L., 1999. Phylogenetic Analysis Using Parsimony (And Other Methods) PAUP*4.0. Sinauer, Sunderland. Taberlet, P., Gielly, L., Pautou, G., et al., 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 17, 1105e1109. Thompson, J.D., Gibson, T.J., Plewniak, F., et al., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic acids Res. 25, 4876e4882.  Vicente, A., et al., 2014. The genus Tamarix (Tamaricaceae) in Crete (Greece). Willdenowia 44, 321e326. Villar, J.L., Alonso, M.A.,  2014a. Tamarix hohenackeri Bunge, a new record for the flora of Mexico. Acta Bot. Mex. 106, Villar García, J.L., Juan Gallardo, A.I., Alonso Vargas, M.A., 117e128.  et al., 2014b. Type specimens of Tamarix (Tamaricaceae) described by Josef Franz Freyn in 1903. Villar García, J.L., Juan Gallardo, A.I., Alonso Vargas, M.A., Phytotaxa 172, 289e292. Wang, C., Gao, C.Q., Wang, L.Q., et al., 2014. Comprehensive transcriptional profiling of NaHCO3-stressed Tamarix hispida roots reveals networks of responsive genes. Plant Mol. Biol. 84, 145e157. Wang, Y., Liu, Y.F., Liu, S.B., et al., 2009. Molecular phylogeny of Myricaria (Tamaricaceae): implications for taxonomy and conservation in China. Bot. Stud. 50, 343e352. Willdenow, C.L., 1813. Beschreibung der Gattung Tamarix.na. Wu, Z.Y., 1999. China flora: 52 Volume. Science Press, Beijing (in Chinese). Yang, L.W., He, B.Y., Huang, P.Y., et al., 2005. Evaluation on ecological value of Tamarix spp. forest in Hotan Drainage basin. J. desert Res. 25, 268e274 (in Chinese). Young, N.D., Healy, J., 2003. GapCoder automates the use of indel characters in phylogenetic analysis. Bmc Bioinforma. 4, 6. Zhang, D.Y., 2004. A cladistic analysis of Tamarix from China. Acta Bot. Yunnanica 26, 275e282 (in Chinese). Zhang, D.Y., Yin, L.K., Pan, B.R., 2002. A review on the study of salt glands of Tamarix. Acta Bot. Boreali-Occidentalia Sin. 23, 190e194 (in Chinese). Zhang, D.Y., Tao, D.Y., Zhang, J., et al., 2003. Comparative anatomy of young branches of 16 species of Tamarix from China with reference to their ecological significance. Acta Bot. Yunnanica 25, 653e662 (in Chinese). Zhang, M.L., Meng, H.H., Zhang, H.X., et al., 2014. Himalayan origin and evolution of Myricaria (Tamaricaeae) in the neogene. PloS one 9, e97582. Zhang, P.Y., Liu, M.T., 1988. A brief history of Tamarix research in China. Arid zone Res. 3, 20e26 (in Chinese). Zhang, P.Y., Zhang, Y.J., Liu, M.T., 1989. Taxonomic characters of Tamarix L. Arid land Res. 3, 1e9 (in Chinese). Zhang, X.Z., Jia, H.X., 1962. Tamarix in northwest China. J. Lanzhou Univ. Nat. Sci. 1, 14 (in Chinese). Zhang, Y.M., Pan, B.R., Yin, L.K., et al., 2000. The research history of the family Tamaricaceae. Acta Bot. Boreali-Occidentalia Sin. 21, 796e804 (in Chinese). Zimmer, E.A., Wen, J., 2012. Using nuclear gene data for plant phylogenetics: progress and prospects. Mol. Phylogenetics Evol. 65, 774e785.