macrophages polarization

macrophages polarization

Journal Pre-proof Riluzole improves functional recovery after acute spinal cord injury in rats and may be associated with changes in spinal microglia/...

3MB Sizes 0 Downloads 2 Views

Journal Pre-proof Riluzole improves functional recovery after acute spinal cord injury in rats and may be associated with changes in spinal microglia/macrophages polarization Qichao Wu, Yan Zhang, Yanjun Zhang, Wenkai Zhang, Wenxiu Zhang, Yadong Liu, Songjie Xu, Yun Guan, Xueming Chen

PII:

S0304-3940(20)30099-9

DOI:

https://doi.org/10.1016/j.neulet.2020.134829

Reference:

NSL 134829

To appear in:

Neuroscience Letters

Received Date:

9 August 2019

Revised Date:

8 January 2020

Accepted Date:

6 February 2020

Please cite this article as: Wu Q, Zhang Y, Zhang Y, Zhang W, Zhang W, Liu Y, Xu S, Guan Y, Chen X, Riluzole improves functional recovery after acute spinal cord injury in rats and may be associated with changes in spinal microglia/macrophages polarization, Neuroscience Letters (2020), doi: https://doi.org/10.1016/j.neulet.2020.134829

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier.

Riluzole improves functional recovery after acute spinal cord injury in rats and may be associated with changes in spinal microglia/macrophages polarization

Qichao Wua,#, Yan Zhangb,#, Yanjun Zhanga, Wenkai Zhanga, Wenxiu Zhangb, Yadong Liua, Songjie

ro of

Xua, Yun Guanc,d, Xueming Chena,b,*

a

Department of Orthopedics, Beijing Luhe Hospital, Capital Medical University, Beijing, 101149,

China b

-p

Central Laboratory, Beijing Luhe Hospital, Capital Medical University, Beijing, 101149, China

c

Medicine, Baltimore, Maryland, 21205, USA d

re

Department of Anesthesiology and Critical Care Medicine, Johns Hopkins University, School of

lP

Department of Neurological Surgery, Johns Hopkins University, School of Medicine, Baltimore,

na

Maryland, 21205, USA

#

These authors contributed equally to this work.

ur

*Correspondence. Xueming Chen, Department of Orthopedics, Beijing Luhe Hospital, Capital

Jo

Medical University, Beijing 101149, China. Email: [email protected]

1

re

-p

ro of

Graphical abstract

Highlights



Riluzole reduces lesion size and improves functional restoration after SCI.



Riluzole induces the polarization of M2 microglia/macrophages after SCI.



Riluzole decreases the levels of proinflammatory cytokines after SCI.

Jo

ur

na

lP



2

Abstract Spinal cord injury (SCI) triggers pronounced inflammatory responses that are accompanied by neuronal disruption and functional deficits. SCI treatment remains an unmet clinical need. Emerging evidence suggests that riluzole may exert a neuroprotective effect due to its anti-inflammatory

ro of

properties. However, details of the underlying mechanisms remain poorly defined. The polarization of microglial/macrophages has an important role in neuroinflammation. Here, we examined whether riluzole can exert a neuroprotective effect after acute SCI, and whether this effect is associated with

-p

changes in microglia/macrophages polarization. Riluzole (4 mg/kg) or vehicle were injected

re

intraperitoneally (i.p.) in female rats immediately following SCI and repeated for 7 consecutive days (b.i.d.). Compared with vehicle treatment, riluzole-treated SCI rats showed significant higher

lP

locomotor scores (Basso, Beattie, and Bresnahan score, Inclined Plane test score, n = 18/group).

na

Riluzole-treated rats also developed smaller spinal cavities, showed higher levels of myelin basic protein (MBP) and neurofilament (NF)200 immunoreactivities, and lower levels of proinflammatory

ur

cytokines in the spinal cord at 7 days post-SCI. Immunofluorescence study revealed more CD206+ cells and less iNOS+ cells in the injured spinal cord of riluzole-treated SCI rats, as compared to

Jo

vehicle control. Using real-time PCR, we found that riluzole upregulated the mRNA levels of M2 markers, but downregulated that of M1 markers, as compared to the vehicle treatment. Current findings suggest that systemic administration of riluzole after acute SCI facilitated motor function recovery and inhibited inflammatory responses, which may be associated with polarization of M2 microglia/macrophages. 3

Key Words. neuroinflammation, riluzole, microglia/macrophage, spinal cord injury, rats.

1. Introduction Spinal cord injury (SCI) leads to physical disabilities owing to limited central nervous system (CNS) regeneration and functional recovery (Lang et al., 2014). Due to increased numbers of traffic

ro of

accident and trauma, the number of SCI has increased in both adults and children (New et al., 2019, New, 2019). SCI causes heavy burdens to patient’s family and society. According to the

pathophysiology, SCI can be grossly divided into two stages—the primary trauma leads to neuron

-p

edema, death, demyelination and axon damages, followed by a cascade of immune responses and

re

cell apoptosis further extending the tissue damage (Beattie, 2004).

lP

Microglia/macrophage is essential to inflammatory response and immunoregulation (Manzhulo et al., 2018a). Following acute SCI, microglial cells migrate quickly to the injured area and induce a

na

variety of pathologic changes through releasing pro-inflammatory cytokines, which recruit more

ur

microglia/macrophage to the injury site (Milich et al., 2019). Different phenotypes of microglia/macrophage may lead to different pathological outcomes (Frangogiannis, 2008). The M1

Jo

phenotype mainly exerts a pro-inflammatory action, featured by the secretion of IL-1β, TNF-α, IL-6, 7, 8, and expression of markers including CD68, CD80 and CD86 (Talamonti et al., 2017, Manzhulo et al., 2018b). In contrast, the M2 microglia/macrophages is associated with a net anti-inflammatory action, featured by secreting TGF-β, IL-10, Arg-1 and expression of CD206 and CD163 (Etzerodt and Moestrup, 2013, Yang et al., 2016). The polarization of M1 to M2 microglia/macrophage was 4

suggested to be important to the anti-inflammatory process. For example, salidroside attenuates neuroinflammation after SCI through modulating the polarization of microglia (Wang et al., 2017). Our recent study showed that melatonin also limited inflammation after SCI partially through regulating the polarization of microglia/macrophage (Zhang et al., 2019).

Riluzole, a benzothiazole, is an FDA-approved sodium channel blocker for treatment of

ro of

amyotrophic lateral sclerosis. It inhibits glutamate release and accelerates the mitigation of excitotoxicity (Srinivas et al., 2019). In animal models of SCI, a recent study suggested that riluzole may protect neurons from the secondary injury cascade, enhance functional recovery and reduce

-p

the size of spinal cavitation (Wu et al., 2013). A phase IIB/III (NCT01597518) clinical trial had begun

re

since 2014 to evaluate the safety and efficacy of riluzole in cervical traumatic SCI patients, and will be completed by 2021 (Grossman et al., 2014). Although riluzole may be useful for SCI treatment,

lP

there has been no consensus on its underlying mechanisms. A recent study in a chronic compression animal model of cervical spondylotic myelopathy (CSM) showed that riluzole may

na

reduce inflammation by regulating microglial polarization (Moon et al., 2014). Yet, whether riluzole

ur

modulates spinal microglia/macrophages polarization after acute SCI remains unclear. Therefore, we aimed to examine the curative effects of riluzole on motor function recovery and inflammatory

Jo

responses in the spinal cord after acute SCI in female rats. Current findings suggest that systemic administration of riluzole during the acute stage of SCI exerted a neuroprotective effect and antiinflammatory action, which may be associated with M2-like polarization of spinal microglia/macrophages.

5

2. Materials and methods 2.1 Animals A total of 54 female adult Wistar rats (8 weeks old, 220-240g) were purchased from Vital River Laboratory Animal Technology Co., Ltd (Beijing, China). Rats were randomly allocated into three groups: Sham, SCI+Vehicle, SCI+Riluzole (n=18/group). Rats were housed at constant ambient temperature under a 12 h light and dark cycle, and were supplied with necessary water and food.

ro of

The experimental protocols of this study were carried out under the guidelines of the International Association for the Study of Pain, and approved by the Institutional Committee for the Ethical Use of

-p

Laboratory Animals.

re

2.2 Drug administration

Riluzole (100684, National Institutes for Food and Drug Control, China) was initially dissolved in

lP

10% hydroxypropyl-β-cyclodextrin solution (HBC, Sigma, H107) (Moon et al., 2014), then diluted with normal saline to a final pharmaceutical concentration of 4 mg/ml. An initial dose of Riluzole at 4

na

mg/kg or vehicle was administered intraperitoneally (i.p.) immediately after SCI. SCI rats were then

ur

injected with riluzole (4 mg/kg) or vehicle every 12 hours for 7 consecutive days.

Jo

2.3 Surgical procedures

Rats were anesthetized by inhaling a mixture of oxygen and isoflurane (2.0-3.0%) (Central

Laboratory, Beijing Luhe Hospital, Capital Medical University, Beijing, China) and placed on an electric heating blanket to keep warm. After shaving the surgical area, povidone-iodine and medicinal alcohol (70%) were applied to the skin. Under aseptic conditions, a median incision was 6

performed at the back (T9–T12). Tissues and muscles overlying the spinal cord were retracted to expose the vertebral column. A T10 laminectomy was performed under a microscope, and the dura was kept intact. Using the IMPACTOR MODEL III (Rutgers University, USA), a contusion was induced by rapidly dropping a rod (diameter: 3 mm; weight: 10 g; height: 25 mm) onto the denuded medulla spinalis (Hosier et al., 2015). The surgical wound was sutured layer by layer with sterile

ro of

sutures.

2.4 Animal care

Animals were placed back to cage during recovery from anesthesia, maintained warm under a

-p

heating pad. Manual evacuation of bladder was performed four times daily to prevent postoperative

re

bladder filling and urinary tract infections. Saline was used to clean the hindquarters of the rats, and

lP

skin was dried with a hair dryer.

na

2.5 Basso, Beattie, and Bresnahan Score Test

Locomotor performance of rats was assessed by using the BBB Score test. Animals were

ur

scored based on limb movement, paw placement, coordination and gait (Basso et al., 1995). Rats were evaluated from day 1 to day 7 post-surgery, and the scale ranged from 0 (paralysis) to 21

Jo

(normal).

2.6 Inclined Plane Test Muscle strength of the hind paw was evaluated by using inclined plane test as described in the previous study (Rivlin and Tator, 1977). Rats were evaluated from day 1 to day 7 post-surgery. Rats 7

were initially positioned properly on the inclined plane, and the plane was then raised to the maximum angle. Each animal was tested for three times, and data were averaged for analysis.

2.7 Tissue processing and histology All rats were deeply anesthetized by inhaling a mixture of oxygen and isoflurane (2.0%) and then transcardial perfusion was performed with ice-cold stroke-physiological saline solution followed

ro of

by paraformaldehyde (PA). Spinal cord (~2 cm) around the damage center was dissected and postfixed in 4% PA at 4℃ for 24 hours. Subsequently, the spinal cords were conserved in 30% sucrose at 4°C for 72 hours, and stored at -80℃. After dehydration, tissue samples were embedded by

-p

optimal cutting temperature (OCT), and then cryosection was conducted by using a microtome

re

(Leica, CM1950). Tissue sections (20 μm) were stained with using conventional hematoxylin-eosin

microscopy (Nikon, Japan).

na

2.8 Immunofluorescence

lP

staining (H&E), and the cavitation size was measured by experienced histopathologists using light

Tissue sections were stained for: (1) IbaⅠ/iNOS/DAPI; (2) IbaⅠ/CD206/DAPI; (3)

ur

MBP/Neurofilament (NF) 200. After fixation, the sections were washed with PBST (30 min) and then

Jo

incubated in normal goat serum (10%, 30 min) for blocking. The transverse sections were then incubated with the primary antibodies: rabbit anti‐IbaⅠ, mouse anti‐iNOS, mouse anti‐CD206, rabbit anti‐MBP, mouse anti‐Neurofilament (NF) 200, at 4°C for 12 hours. Subsequently, the sections were washed again in PBST (30 min) and then incubated with the secondary antibodies for 8 hours. Finally, the sections were washed with PBST (30 min) and then incubated with DAPI for 30 s and

8

cover-slipped. Images were captured by a laser scanning confocal microscope (Nikon, Japan). Three consecutive slices from each animal were analyzed, and three random visual fields were counted in each slice. Table 1 shows the information of antibodies. 2.9 Real-time PCR Total RNAs were isolated from the spinal cord tissues using Trizol reagent (Invitrogen). The cDNA was synthesized according to the operation procedure from the instructions (Tiangen

ro of

Biotech). A quantitative PCR system with a 96-well plate was used (Applied Biosystems 7500 RealTime PCR Systems, Thermo-Fisher Scientific, Waltham, MA, USA). The cyclic parameters: 5 min at 95°C followed by 40 cycles of 15 s at 95°C, 30 s at 60°C. The relative expression levels of CD16,

-p

CD32, CD206, TNF-α, iNOS, Arg1, TGF-β were calculated with using the 2-∆∆CT method. GAPDH

re

was used as the housekeeping gene. All primers were detailed in Table 2.

lP

2.10 ELISA

RIPA lysis buffer was used to homogenize spinal cord containing the injury epicenter. After

na

centrifuging (12000 g, 4°C, 15 min), supernatant was taken for protein concentration detection with BSA method (Bradford, 1976). According to the manufacture instructions (Cusabio Co., Ltd.,

ur

Wuhan, China), cytokine (IL-13, IL-1β, IL-6, TNF-α, TGF-β1) levels were detected by using ELISA

Jo

(Li et al., 2017). Each Specimen was measured with three duplicates.

2.11 Statistical analysis Comparisons between two groups were made by using the Student’s two-tailed t-test. One-Way analysis of variance (ANOVA) followed by Tukey’s post hoc analysis was used to compared data between multiple groups. Data from Inclined plane test and BBB Scores were evaluated with Two9

Way mixed model ANOVA, followed by Tukey’s post hoc analysis. Numerical data are shown as the mean ± SEM. P < 0.05 was considered to be statistically significant.

3. Results 3.1 Riluzole reduces lesion size and improves functional restoration after acute SCI H&E staining study suggests that the lesion volume in riluzole-treated rats was less than that in

ro of

vehicle-treated rats at 7 days post-SCI (Figure. 1b, c, d). Compared to vehicle-treated rats, riluzoletreated rats showed a better recovery of motor function than vehicle-treated rats (Figure. 1e), as indicated by the higher BBB scores from day 4 post-SCI. They also performed better in inclined

re

-p

panel test with a greater increase in the angle of inclined plane (Figure. 1f).

3.2 Riluzole attenuates the degeneration of axon and reduction of myelin protein after SCI

lP

Immunofluorescence study was performed for evaluating the density of axons and myelin in the injured spinal cord. Neurofilament (NF200) was used as an axonal marker, and myelin basic protein

na

(MBP) was deemed to be a marker of myelin protein. The reductions in both MBP and NF200

ur

staining at the lesion area were lower in riluzole-treated group than that in vehicle-treated group (Figure. 2a-c). These findings suggest attenuations of both axon degeneration and the loss of

Jo

myelin protein by riluzole after acute SCI.

3.3 Riluzole induces the polarization of M2 microglia/macrophages after SCI Double-immunofluorescence staining for IbaⅠwith iNOS (a M1 marker) and CD206 (a M2 marker) was used to examine whether riluzole may affect the polarization of microglia/macrophages

10

after SCI. In injury region, the percentage of double-labeled iNOS+/IbaⅠ+ cells in vehicle-treated rats was significantly higher than that in riluzole-treated rats after SCI (Figure. 3a, b). In contrast, the percentage of double-labeled CD206+/IbaⅠ+ cells was significantly lower in vehicle-treated rats than in riluzole-treated rats (Figure. 4a, b). To further examine whether riluzole regulates spinal microglia/macrophages polarization after SCI, PCR was performed to examine the mRNA levels of several M1 markers (CD16, CD32, TNF-α,

ro of

and iNOS, Figure. 5a-d) and M2 markers (TGF-β, CD206, and Arg-1, Figure. 5e-g) in the spinal cord on day 7 post-SCI. The mRNA levels of both M1 and M2 markers in vehicle-treated SCI rats were significantly higher than that in sham-operated rats. Importantly, riluzole treatment significantly

-p

increased mRNA levels of M2 markers and decreased that of M1 markers, as compared to vehicle

re

treatment.

lP

3.4 Riluzole decreases the levels of proinflammatory cytokines after SCI The levels of inflammatory cytokines in the spinal cord tissue were measured with ELISA. The

na

levels of IL-6, IL-1β and TNF-α in vehicle-treated rats at day 7 post-SCI were significantly higher than that in sham-operated rats (Figure. 6a, b, c). Riluzole treatment significantly reduced the levels

ur

of IL-6, IL-1β and TNF-α, but increased that of IL-13 and TGF-β1, as compared with vehicle

Jo

treatment (Figure. 6a-e).

4. Discussion

SCI is one of the most refractory diseases that significantly impair patient’s daily life. It is crucial to explore effective methods for promoting functional recovery after SCI (Badhiwala et al., 2018). Our study shows that repetitive systemic administrations of riluzole after acute SCI in female rats 11

may reduce the inflammatory process and thus improve functional recovery. Moreover, immunofluorescence study shows that the percentages of double labelling for NF200 with MBP in the injured spinal cord were significantly higher in riluzole-treated rats than that in vehicle-treated rats, and is associated with the better functional restoration. The immune response is governed in part by different regulations of microglia/macrophages, and is a double-edged sword in the progress of SCI (Zhao et al., 2018). Intriguingly, microglia may

ro of

be a key component in the scar that exerts a neuroprotective effect after SCI (Bellver-Landete et al., 2019). Based on surface markers, microglia/macrophages can be grossly segmented into M1 (proinflammatory) and M2 (anti-inflammatory) phenotypes in well-defined in vitro situation. The

-p

dominance of M1-like or M2-like phenotypes may set the direction of immune responses

re

(Frangogiannis, 2008). The pro-inflammatory “M1-like” state may be associated with increased proinflammatory factors (e.g., TNF-α, IL-6, 7, 8, IL-1β) that aggravate local inflammation. In contrast,

lP

the “M2-like” state is associated with increased anti-inflammatory factors (i.e. IL-10 and TGF-β),

na

which is propitious to tissue repair (Girard et al., 2013, Alizadeh et al., 2018). Our immunofluorescence assay shows that the percentages of double-labeled iNOS+/IbaⅠ cells were

ur

significantly lower, but the CD206+ cells/IbaⅠ cells were markedly higher in riluzole-treated SCI rats, as compared to that in vehicle-treated rats. Findings from real-time PCR study suggest that

Jo

riluzole administration may increase the mRNA levels of markers for M2-like state, and decreased that of M1-like state, as compared to vehicle treatment. In line with these findings, ELISA assay shows that riluzole significantly decreased the levels of IL-6, TNF-α, and IL-1β in the spinal cord of SCI rats, as compared to vehicle. Collectively, these findings suggest that riluzole may inhibit inflammation in the injured spinal cord after SCI, which is associated with polarization of 12

microglia/macrophages from M1-like to M2-like phenotypes. Inflammatory responses after SCI are driven in part by peripheral monocyte-derived macrophages and activation of resident microglia cells in the spinal cord. Polarizing the differentiation of infiltrating blood monocytes and resident microglia toward M2 phenotype may reduce secondary neuroinflammation (Kigerl et al., 2009). Microglia and infiltrated macrophages can be differentiated by immunofluorescence staining of P2ry12 (microglia-specific mark) in mice after permanent brain

ro of

ischemia (Zarruk et al., 2018). Yet, it remains to be determined whether riluzole regulates both

microglia and macrophages after SCI in vivo. It needs to be noted that the classification of M1-like and M2-like states in vivo may be complicated by a plethora of conflicting influences from the tissue

-p

environment and sometimes overlapping phenotypes. Recent findings also suggested that M1 and

re

M2 paradigms may not fully explain the dynamic process involved in macrophage and microglia polarization (Colonna and Butovsky, 2017). Indeed, at least 9 distinct subtypes of microglia have

lP

been found (Hammond et al., 2019), and thus microglia may display a complex and mixed

na

phenotypes in vivo (Morganti et al., 2016).

The signal pathways by which riluzole downregulates inflammatory cytokines and how it may

ur

regulate the polarization of microglia/macrophages after acute SCI remain to be determined in future studies. Riluzole was shown to regulate the polarization of microglia/macrophages in a rat

Jo

model of neuropathic pain by affecting the expression of P2X7 receptors (Jiang et al., 2016). However, this mechanism has not been determined in SCI condition. Previous studies showed that polarization of microglia/macrophages in the nervous system may also be regulated through peroxisome proliferators-activated receptors (PPARγ), NF-κB activation, and AMPK pathways (Li et al., 2019, Zhou et al., 2019, Wang et al., b). Future studies need to determine whether riluzole 13

regulates the polarization of microglia/macrophages after acute SCI through any of these mechanisms. In conclusion, our study provides novel evidence that early riluzole treatment immediately after SCI may promote the recovery of locomotor function in female rats. The beneficial effect may be in part due to M2-like polarization of microglia/macrophages and decreased levels of inflammatory cytokines following riluzole treatment in SCI rats. Thus, riluzole may hold promise as a therapeutic

ro of

candidate to exert neuroprotective effect after acute SCI. Early medication and intervention after traumatic SCI may attenuate the development of long-term functional impairment and pathological changes which are deemed to be difficult to treat once established. It remains to be determined

Conflict of interest

lP

The authors declare no conflict of interest.

re

-p

whether riluzole can benefit functional recovery in chronic SCI condition.

Funding

na

This work is supported by the Scientific Research Common Program of Beijing Municipal

Jo

(81901241).

ur

Commission of Education (KM201710025028) and National Natural Science Foundation of China

Riluzole improves functional recovery after acute spinal cord injury in rats through regulating spinal microglia/macrophages polarization

Author Contributions Q.W. carried out the experiments, and drafted the manuscript. Y.Z. performed the statistical analysis, and 14

helped to perform the experiments. X.C. advised on the experimental procedures, and designed the study. Y.G. helped to draft and revise the manuscript. Y.Z. and W.Z. helped to perform the experiments. W.Z., Y.L, S.X., and Y.G. provided expertise and feedback. All authors have read and approved the final manuscript.

Acknowledgements The authors thank Claire F. Levine (Scientific Editor, Department of Anesthesiology and Critical

ro of

Care Medicine, Johns Hopkins University, Baltimore, Maryland) for editing the manuscript.

Jo

ur

na

lP

re

-p

References: Alizadeh A, Santhosh KT, Kataria H, Gounni AS, Karimi-Abdolrezaee S (Neuregulin-1 elicits a regulatory immune response following traumatic spinal cord injury. J Neuroinflammation 15:53.2018). Badhiwala JH, Ahuja CS, Fehlings MG (Time is spine: a review of translational advances in spinal cord injury. J Neurosurg Spine 30:1-18.2018). Basso DM, Beattie MS, Bresnahan JC (A sensitive and reliable locomotor rating scale for open field testing in rats. J Neurotrauma 12:1-21.1995). Beattie MS (Inflammation and apoptosis: linked therapeutic targets in spinal cord injury. TRENDS MOL MED 10:580-583.2004). Bellver-Landete V, Bretheau F, Mailhot B, Vallieres N, Lessard M, Janelle ME, Vernoux N, Tremblay ME, Fuehrmann T, Shoichet MS, Lacroix S (Microglia are an essential component of the neuroprotective scar that forms after spinal cord injury. NAT COMMUN 10:518.2019). Colonna M, Butovsky O (Microglia Function in the Central Nervous System During Health and Neurodegeneration. ANNU REV IMMUNOL 35:441-468.2017). Etzerodt A, Moestrup SK (CD163 and inflammation: biological, diagnostic, and therapeutic aspects. Antioxid Redox Signal 18:2352-2363.2013). Frangogiannis NG (The immune system and cardiac repair. PHARMACOL RES 58:88-111.2008). Girard S, Brough D, Lopez-Castejon G, Giles J, Rothwell NJ, Allan SM (Microglia and macrophages differentially modulate cell death after brain injury caused by oxygen-glucose deprivation in organotypic brain slices. GLIA 61:813-824.2013). Grossman RG, Fehlings MG, Frankowski RF, Burau KD, Chow DS, Tator C, Teng A, Toups EG, Harrop JS, Aarabi B, Shaffrey CI, Johnson MM, Harkema SJ, Boakye M, Guest JD, Wilson JR (A prospective, multicenter, phase I matched-comparison group trial of safety, pharmacokinetics, and preliminary efficacy of riluzole in patients with traumatic spinal cord injury. J Neurotrauma 31:239255.2014). Hammond TR, Dufort C, Dissing-Olesen L, Giera S, Young A, Wysoker A, Walker AJ, Gergits F, Segel M, Nemesh J, Marsh SE, Saunders A, Macosko E, Ginhoux F, Chen J, Franklin R, Piao X, McCarroll 15

Jo

ur

na

lP

re

-p

ro of

SA, Stevens B (Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. IMMUNITY 50:253-271.2019). Hosier H, Peterson D, Tsymbalyuk O, Keledjian K, Smith BR, Ivanova S, Gerzanich V, Popovich PG, Simard JM (A Direct Comparison of Three Clinically Relevant Treatments in a Rat Model of Cervical Spinal Cord Injury. J Neurotrauma 32:1633-1644.2015). Jiang K, Zhuang Y, Yan M, Chen H, Ge AQ, Sun L, Miao B (Effects of riluzole on P2X7R expression in the spinal cord in rat model of neuropathic pain. NEUROSCI LETT 618:127-133.2016). Kigerl KA, Gensel JC, Ankeny DP, Alexander JK, Donnelly DJ, Popovich PG (Identification of two distinct macrophage subsets with divergent effects causing either neurotoxicity or regeneration in the injured mouse spinal cord. J NEUROSCI 29:13435-13444.2009). Lang BT, Cregg JM, DePaul MA, Tran AP, Xu K, Dyck SM, Madalena KM, Brown BP, Weng Y, Li S, Karimi-Abdolrezaee S, Busch SA, Shen Y, Silver J (Modulation of the proteoglycan receptor PTPσ promotes recovery after spinal cord injury. NATURE 518:404-408.2014). Li Q, Dai Z, Cao Y, Wang L (Caspase-1 inhibition mediates neuroprotection in experimental stroke by polarizing M2 microglia/macrophage and suppressing NF-kappaB activation. Biochem Biophys Res Commun 513:479-485.2019). Li Q, Houdayer T, Liu S, Belegu V (Induced Neural Activity Promotes an Oligodendroglia Regenerative Response in the Injured Spinal Cord and Improves Motor Function after Spinal Cord Injury. J NEUROTRAUM 34:3351-3361.2017). Manzhulo O, Tyrtyshnaia A, Kipryushina Y, Dyuizen I, Manzhulo I (Docosahexaenoic acid induces changes in microglia/macrophage polarization after spinal cord injury in rats. ACTA HISTOCHEM 120:741-747.2018a). Manzhulo O, Tyrtyshnaia A, Kipryushina Y, Dyuizen I, Manzhulo I (Docosahexaenoic acid induces changes in microglia/macrophage polarization after spinal cord injury in rats. ACTA HISTOCHEM 120:741-747.2018b). Milich LM, Ryan CB, Lee JK (The origin, fate, and contribution of macrophages to spinal cord injury pathology. ACTA NEUROPATHOL 137:785-797.2019). Moon ES, Karadimas SK, Yu WR, Austin JW, Fehlings MG (Riluzole attenuates neuropathic pain and enhances functional recovery in a rodent model of cervical spondylotic myelopathy. NEUROBIOL DIS 62:394-406.2014). Morganti JM, Riparip L, Rosi S (Call Off the Dog(ma): M1/M2 Polarization Is Concurrent following Traumatic Brain Injury. PLOS ONE 11:e148001.2016). New PW (A Narrative Review of Pediatric Nontraumatic Spinal Cord Dysfunction. Top Spinal Cord Inj Rehabil 25:112-120.2019). New PW, Lee BB, Cripps R, Vogel LC, Scheinberg A, Waugh MC (Global mapping for the epidemiology of paediatric spinal cord damage: towards a living data repository. SPINAL CORD 57:183-197.2019). Rivlin AS, Tator CH (Objective clinical assessment of motor function after experimental spinal cord injury in the rat. J NEUROSURG 47:577-581.1977). Srinivas S, Wali AR, Pham MH (Efficacy of riluzole in the treatment of spinal cord injury: a systematic review of the literature. NEUROSURG FOCUS 46:E6.2019). Talamonti E, Pauter AM, Asadi A, Fischer AW, Chiurchiu V, Jacobsson A (Impairment of systemic DHA synthesis affects macrophage plasticity and polarization: implications for DHA supplementation during inflammation. CELL MOL LIFE SCI 74:2815-2826.2017). 16

Jo

ur

na

lP

re

-p

ro of

Wang C, Wang Q, Lou Y, Xu J, Feng Z, Chen Y, Tang Q, Zheng G, Zhang Z, Wu Y, Tian N, Zhou Y, Xu H, Zhang X (Salidroside attenuates neuroinflammation and improves functional recovery after spinal cord injury through microglia polarization regulation. J CELL MOL MED.2017). Wang Y, Zhu T, Wang M, Zhang F, Zhang G, Zhao J, Zhang Y, Wu E, Li X (Icariin Attenuates M1 Activation of Microglia and Abeta Plaque Accumulation in the Hippocampus and Prefrontal Cortex by Up-Regulating PPARgamma in Restraint/Isolation-Stressed APP/PS1 Mice. Front Neurosci 13:291.2019). Wu Y, Satkunendrarajah K, Teng Y, Chow DSL, Buttigieg J, Fehlings MG (Delayed Post-Injury Administration of Riluzole Is Neuroprotective in a Preclinical Rodent Model of Cervical Spinal Cord Injury. J NEUROTRAUM 30:441-452.2013). Yang R, He J, Wang Y (Activation of the niacin receptor HCA2 reduces demyelination and neurofilament loss, and promotes functional recovery after spinal cord injury in mice. EUR J PHARMACOL 791:124-136.2016). Zarruk JG, Greenhalgh AD, David S (Microglia and macrophages differ in their inflammatory profile after permanent brain ischemia. EXP NEUROL 301:120-132.2018). Zhang Y, Liu Z, Zhang W, Wu Q, Zhang Y, Liu Y, Guan Y, Chen X (Melatonin improves functional recovery in female rats after acute spinal cord injury by modulating polarization of spinal microglial/macrophages. J NEUROSCI RES 97:733-743.2019). Zhao J, Wang L, Li Y (Electroacupuncture Alleviates the Inflammatory Response via Effects on M1 and M2 Macrophages after Spinal Cord Injury. ACUPUNCT MED 35:224-230.2018). Zhou X, Chu X, Xin D, Li T, Bai X, Qiu J, Yuan H, Liu D, Wang D, Wang Z (L-Cysteine-Derived H2S Promotes Microglia M2 Polarization via Activation of the AMPK Pathway in Hypoxia-Ischemic Neonatal Mice. FRONT MOL NEUROSCI 12:58.2019).

17

Jo

ur

na

lP

re

-p

ro of

Figure legends

18

Figure 1. Riluzole attenuates tissue damage and promotes functional restoration in rats after SCI. (a) Experimental protocol. (b) Quantification of lesion as a ratio to whole volume in female rats that were treated with riluzole (n=6) and vehicle (n=6) after spinal cord injury (SCI). p < 0.05 (*) Student’s t-test. (c) Representative H&E-staining of transverse spinal cord sections near the epicenter at 7 days after SCI. (d) Quantification of lesion as a ratio to whole area at different distance from the epicenter in each SCI group. (e, f) Quantification of BBB score and inclined plane

Jo

ur

na

lP

re

-p

mixed model ANOVA followed by Tukey’s post hoc analysis.

ro of

test from day 1 to day 7 after SCI (n=18). Data represents mean ± SEM, p < 0.001 (***), Two-Way

19

ro of -p re lP na ur Jo

Figure 2. Riluzole attenuates the degeneration of axon and reduction of myelin protein after acute SCI. (a) Immunofluorescence images of double-staining of MBP and NF200 in the spinal cord of Sham, SCI+Vehicle and SCI+Riluzole rats (n=6/group, scale bar: 50 μm). (b-c) Quantitative

20

analysis of the expression of MBP and NF200 in SCI rats. Data represents mean ± SEM, p < 0.01

-p

ro of

(**), One-Way analysis of variance (ANOVA) followed by Tukey’s post hoc analysis.

re

Figure 3. Riluzole suppresses the polarization of M1 microglia/macrophages in the spinal cord after SCI. (a) Representative immunofluorescence images of double-staining of IbaⅠ (red)

lP

and iNOS (M1 markers, green) in the spinal cord at 7 days post-SCI (n=6/group, scale bar: 50 μm).

na

(b) Quantification of of iNOS+/IbaⅠ+ double-labeled cells (% of total IbaⅠ+ cells) in each group. Data represents mean ± SEM, p < 0.01 (**), One-Way analysis of variance (ANOVA) variance

Jo

ur

followed by Tukey’s post hoc analysis.

21

ro of

Figure 4. Riluzole promotes the polarization of M2 microglia/macrophages after SCI. (a)

-p

Immunofluorescence images of double-staining of IbaⅠ (red) and CD206 (M2 marker) in the spinal

re

cord at 7 days post-SCI (n=6/group, scale bar: 50 μm). (b) Quantification of CD206+/IbaⅠ+ doublelabeled cells (% of total IbaⅠ+ cells) in each group. Data represents mean ± SEM, p < 0.001 (***),

Jo

ur

na

lP

One-Way analysis of variance (ANOVA) variance followed by Tukey’s post hoc analysis.

22

ro of -p

Figure 5. Changes in the mRNA levels of M1 and M2 markers after SCI. (a-g) The mRNA levels

re

of CD16 (a), CD32 (b), TNF-α (c), iNOS (d), TGF-β (e), CD206 (f) and Arg-1 (g) in the spinal cord at

lP

7 days post-SCI after sham operation, SCI+Vehicle and SCI+Riluzole treatments (n=6/group). Data are presented as mean ± SEM, p < 0.001 (***), p < 0.01 (**), p < 0.05 (*), One-Way analysis of

Jo

ur

na

variance (ANOVA) variance followed by Tukey’s post hoc analysis.

23

ro of -p re

lP

Figure 6. Changes in pro-inflammatory and anti-inflammatory cytokine levels in the spinal cord at 7 days post-SCI and riluzole treatment. (a-e) Levels of IL‐6 (a), IL-1β (b), TNF-α (c), IL-13

na

(d), and TGF-β (e) in the spinal cord were detected by ELISA on day 7 after sham operation, SCI+Vehicle and SCI+Riluzole treatments (n=6/group). Data are presented as mean ± SEM, p <

ur

0.001 (***), p < 0.01 (**), p < 0.05 (*), One-Way analysis of variance (ANOVA) variance followed by

Jo

Tukey’s post hoc analysis.

Graphical Abstract. (a). Molecular formula of riluzole. (b). Riluzole reduces lesion size and improves functional restoration after SCI. Riluzole may inhibit the polarization of M1 and induce the

24

polarization of M2 microglia/macrophages after SCI, and hence may hold promise as a therapeutic

Jo

ur

na

lP

re

-p

ro of

candidate for SCI.

25

Table 1. Antibody information

MBP

Synthetic peptide correspondin g to amino acids 69-86 of the guinea pig protein. AA 134 to 147 from rat IbaⅠ Synthetic peptide correspondin g to MouseiNOS aa 1,126– 1,144 of mouse origin CD206 (15-2) is a mouse monoclonal antibody raised against CD206 of human origin. Gamma Immunoglobi ns Heavy and Light chains Gamma Immunoglobi ns Heavy

IbaⅠ

INOS

1:50

AB_260781

1:200

AB_214035 1

Isotype control Mouse IgG1

Rabbit IgG

AB5864, Rabbit

Wako, 019 19741, Rabbit pAb Abcam, ab49999, Mouse mAb

1:100

AB_839504

Rabbit IgG

AB_881438

Mouse IgG

1:200

n/a

Mouse IgG

Invitrogen, A32723

1:100

AB_263327 5

n/a

Invitrogen, A32754

1:100

AB_276282 7

n/a

1:100

Santa Curz Biotechnology , sc-58986, mouse

Jo

Goat antiMouse IgG

ur

na

CD206

Millipore,

RRID

ro of

pig spinal cord

Concentration

-p

NF200

Manufacture, Catalogue # Sigma, N5389-.2ML, mouse

re

Immunogen

lP

Antibody

Donkey antirabbit IgG

26

Jo

ur

na

lP

re

-p

ro of

and Light chains

27

Table 2

Forward primers 5ATCGTGGGCCGCCCTAGGCACC3′ 5′AGCTGCTGTCGCTGGAAT3′ 5′TGTGGGAAAAGCCAATGAAC3′ 5′AGGCGGTGCTCGCTTTGTA3′ 5′GCATGCTACTTACGGTTTCC3′ 5′AGCTGCTGTCGCTGGAAT3′ 5′GCCGATTTGCCACTTCATAC3′ 5′CAGCATCCACGCCAAGAA3′

Reverse primers 5′CTCTTTAATGTCACGATTTC3′ 5′GGATGCTTGAGAAGTGAATAGG3′ 5′GGTGTCAGCGGAGTGTTG3′ 5′ATTGCGTTGTTGCGGTCC3′ 5′TGCGAGATGAGGCTTTTGT3′ 5′GGATGCTTGAGAAGTGAATAGG3′ 5′GGACTCCGTGATGTCTAAGTAC3′ 5′CAACTCGCTCCAAGATCCCT3′

Jo

ur

na

lP

re

-p

ro of

Genes β-actin CD206 Arg1 TGF-β CD16 CD32 TNF-α iNOS

Primers used for Real-time PCR

28