Selective media and real-time PCR assays for the effective detection of enterotoxigenic Escherichia coli in vegetables

Selective media and real-time PCR assays for the effective detection of enterotoxigenic Escherichia coli in vegetables

LWT - Food Science and Technology 114 (2019) 108409 Contents lists available at ScienceDirect LWT - Food Science and Technology journal homepage: ww...

399KB Sizes 0 Downloads 113 Views

LWT - Food Science and Technology 114 (2019) 108409

Contents lists available at ScienceDirect

LWT - Food Science and Technology journal homepage: www.elsevier.com/locate/lwt

Selective media and real-time PCR assays for the effective detection of enterotoxigenic Escherichia coli in vegetables

T

Kayoko Ohtsukaa, Kozue Hoshinoa, Natsuko Kadowakia, Misa Ohsakaa, Noriko Konishib, Hiromi Obatab, Akemi Kaib, Jun Terajimac, Yukiko Hara-Kudoc,∗ a

Saitama Institute of Public Health, 410-1, Ewai, Yoshimi-machi, Hiki-gun, Saitama, 355-0133, Japan Tokyo Metropolitan Institute of Public Health, 3-24-1, Hyakunin-cho, Shinjuku, Tokyo, 169-0073, Japan c Division of Microbiology, National Institute of Health Sciences, Kawasaki-ku, Kawasaki, 210-9501, Japan b

A R T I C LE I N FO

A B S T R A C T

Keywords: Enterotoxigenic Escherichia coli detection Selective media Real-time PCR Vegetables

Enterotoxigenic Escherichia coli (ETEC) is a major foodborne pathogen. Along with water, vegetables are one of the major food sources related to infections. Effective detection methods for ETEC in food, however, have not yet been established. This study aimed to evaluate ETEC detection methods focusing on the major serogroups (O6, O25, O27, O148, O153, O159, and O169) with steps of enrichment, isolation, and real-time PCR targeting genes encoding the heat-labile enterotoxin (LT) and heat-stable enterotoxin (ST). ETEC strains (n = 20) were grown to 7.0–8.9 log CFU/mL in modified E. coli broth (mEC) at 42 °C for 18 h. The strains formed colonies typically representing E. coli on sorbitol MacConkey agar and Shiga toxin-producing E. coli on CHROMagar STEC base agar. The minimum detection levels for real-time PCR assays targeting LT and ST genes were 1.9–3.1 log CFU/ mL of vegetable culture. Vegetables inoculated with 2.0 log CFU/g ETEC were cultured in mEC, and then ST and LT genes were detected in the culture by real-time PCR assays at low threshold cycle (Ct) values; further, ETEC in the culture was isolated by plating on agars. This study thus demonstrated effective detection methods for ETEC in vegetables.

1. Introduction Enterotoxigenic Escherichia coli (ETEC) is one of the major foodborne pathogens in developing countries, and a major cause of traveler's diarrhea in developed countries where it is associated with travel to developing countries (Cartwright, 1993;Goldsmid & Leggat, 2007). Food such as vegetables and water are recognized as major vehicles of ETEC transmission in developing countries (Lothigius et al., 2008; Okoh & Osode, 2008; Rangel-Vargas et al., 2015; Singh, Vajpayee, Ram, & Shanker, 2010). The most common ETEC O-serogroups are reportedly O6, O25, O78, O115, and O126 in Bangladesh (Begum et al., 2007), O21, O43, O148, and O159 in peri-urban Egypt (Peruski et al., 1999), O6, O25, O27, and O169 in Minnesota (Medus et al., 2016), and O6, O25, O27, O148, O153, O159, and O169 in Japan (Konishi et al., 2018). Further, some major serogroups such as O6, O25, O27, O148, and O169 coexist in these countries. Two enterotoxins, heat-labile enterotoxin (LT) and heat-stable enterotoxin (ST), are recognized as the major virulent factors of ETEC. ST has two variants, namely STp and STh. STp was discovered in a pig-derived ETEC strain and STh was

discovered in a human-derived ETEC strain. The detection of LT and ST, as well as the genes encoding these enterotoxins, is key in diagnosing ETEC infections and detecting ETEC contamination in food and water. Despite the importance of ETEC detection in food and water to prevent infection, optimal systematic procedures have not been established. Enrichment in brain heart infusion (BHI) broth and tryptone phosphate broth at 44.0 ± 0.2 °C and plating onto Levine eosin methylene blue (L-EMB) and MacConkey agar media for the detection of pathogenic E. coli in food were recommended by the Bacteriological Analytical Manual of the U.S. Food and Drug Administration (Feng, Weagant, & Jinneman, 2016); however, these procedures do not focus on ETEC. Erume, Berberov, and Moxley (2010) reported that BHI broth supplemented with 2% of casamino acids supported STb (STh) production more readily than trypticase soy broth (TSB); however, the broth has not yet been tested for the enrichment of food samples. In addition, real-time polymerase chain reaction (PCR) assays targeting ST and LT genes have also been developed (Frydendahl, Imberechts, & Lehmann, 2001; Hidaka et al., 2009; Pattabiraman, Parsons, & Bopp, 2016; West et al., 2007). These assays show high

∗ Corresponding author. Division of Microbiology, National Institute of Health Sciences, 3-25-26 Tonomachi, Kawasaki-ku, Kawasaki, 210-9501, Japan. Tel.: +81 44 270 6571; Fax:+81 44 270 6572. E-mail address: [email protected] (Y. Hara-Kudo).

https://doi.org/10.1016/j.lwt.2019.108409 Received 24 November 2018; Received in revised form 13 July 2019; Accepted 16 July 2019 Available online 18 July 2019 0023-6438/ © 2019 Published by Elsevier Ltd.

LWT - Food Science and Technology 114 (2019) 108409

K. Ohtsuka, et al.

were selected as vegetable food samples. They were purchased from markets in Saitama prefecture, Japan. The aerobic bacterial counts and fecal coliform counts were 3.4 and 3.2 log CFU/g, 2.4 and < 1.0 log CFU/g, 2.1 and < 1.0 log CFU/g, and 2.9 and 2.3 log CFU/g in fresh cherry tomato, fresh leek, white radish pickles, and seaweed, respectively.

specificity and sensitivity in tests with pure cultures of strains. Studies focusing on ETEC detection in food samples, however, are limited. For Shiga toxin-producing E. coli (STEC), methods for detection in food, based on the screening of stx and O-antigen genes of the major serogroups, have been established in some countries such as the US (United States Department of Agriculture, 2014) and Japan (Hara-Kudo et al., 2016), as well as organizations like the European Food Safety Authority (European Food Safety Authority, 2009). However, it would be advantageous if the detection methods for ETEC were the same as those for STEC, as this would increase test efficiency by saving cost and labor. Therefore, in this study, selective enrichment broth and agar media for STEC were evaluated for ETEC detection in vegetables as one of the major food sources related to ETEC foodborne infections. Realtime PCR assays for ST and LT genes were also evaluated for the highsensitivity detection of ETEC.

2.3. Growth of ETEC in mEC broth and on selective agar media All ETEC strains were cultured in TSB (Becton, Dickinson and Company, Franklin Lakes, NJ, USA) at 37 °C for 18 h. Culture aliquots (10 μL) were streaked onto agars that are used for food testing for STEC as follows: sorbitol MacConkey agar (SMAC; Oxoid, Hampshire, UK), SMAC supplemented with cefixime (0.05 mg/L) and potassium tellurite (2.5 mg/L) (CT-SMAC), and CHROMagar STEC base agar (CHROMagar, Paris, France). After 20 h of incubation at 37 °C, colonies were observed. In addition, the strains were cultured in mEC (Oxoid) at 37 °C and 42 °C for 18 h, and then the cultures were serially 10-fold diluted with phosphate-buffered saline (PBS) to 10−5. Next, 0.1 mL of the 10−4 and 10−5 dilutions was plated onto trypticase soy agar (TSA; Becton, Dickinson and Company) in duplicate. Colonies were observed after 20 h of incubation at 37 °C.

2. Materials and methods 2.1. Strains ETEC strains (n = 20, 19 isolates from patients and one isolate from food related to an outbreak) belonging to seven serogroups were used in this study as follows: O6 (n = 4), O25 (n = 2), O27 (n = 2), O148 (n = 2), O153 (n = 4), O159 (n = 3), and O169 (n = 3) (Table 1). The strains were tested for growth in mEC broth and on selective agar media, and ST and LT genes were detected by real-time PCR as described as follows. Serogroups O6 (no. 627), O148 (no. 632), and O169 (no. 626) were used to inoculate vegetable culture or vegetables.

2.4. DNA extraction Bacterial DNA of the 20 strains (Table 1) was extracted from cultures incubated in TSB at 37 °C for 20 h as follows. The culture (0.1 mL) was centrifuged at 10,000 × g for 10 min. The supernatant was removed, and the pellet was suspended in sterilized distilled water. After heating at 100 °C for 10 min, the suspension was cooled on ice. The suspension was then centrifuged at 10,000 × g for 10 min, and the DNA-containing supernatant was used for real-time PCR assays.

2.2. Food samples Fresh cherry tomato, fresh leek, white radish pickles, and seaweed

Table 1 Growth of ETEC in mEC and on selective agar, and ST and LT genes detection by real-time PCR assays. Serogroup

Strain No.

Enterotoxin gene

Source

Growth in mEC (log CFU/ml)

Growth (color) on selective agar

Real-time PCRa

37 °C

SMAC

Assay 1

42 °C

CT-SMAC

CHROMagar STEC

Assay 2 Simplexb

Multiplex

O6

609 612 627 630

STh & LT LT STh & LT STh & LT

Patient Patient Patient Patient

8.6 8.6 8.0 7.9

8.2 8.0 7.7 7.0

+ + + +

(red) (red) (red) (red)

- - - -

+ + + +

(violet) (violet) (violet) (violet)

+ + + +

+ + + +

+ + + +

O25

624 631

STh STh

Patient Patient

8.0 8.5

7.8 8.0

+ (red) + (red)

- -

+ (violet) + (violet)

+ +

+ +

+ +

O27

625 629

STp STp

Patient Patient

8.5 8.3

8.4 8.1

+ (red) + (red)

- -

+ (violet) + (violet)

+ +

+ +

+ +

O148

622 632

STh STh

Patient Patient

8.5 8.7

7.3 7.8

+ (red) + (red)

- -

+ (violet) + (violet)

+ +

+ +

+ +

O153

638 649 651 667

STh STh STh STh

Patient Cucumber Patient Patient

8.8 8.6 8.8 8.9

7.9 7.7 8.0 8.0

+ + + +

(red) (red) (red) (red)

- - - -

+ + + +

(violet) (violet) (violet) (violet)

+ + + +

+ + + +

+ + + +

O159

613 628 633

STp STp STh

Patient Patient Patient

8.2 8.4 8.4

8.1 7.4 7.4

+ (red) + (red) + (red)

- - -

+ (violet) + (violet) + (violet)

+ + +

+ + +

+ + +

O169

608 623 626

STp N/A STp

Patient Patient Patient

8.7 7.8 8.7

8.0 8.5 7.7

+ (red) + (red) + (red)

- - -

+ (violet) + (violet) + (violet)

+ - +

+ - +

+ - +

CHROMagar STEC: CHROMagar STEC base agar. +: Colonies were grown or positive reaction in real-time PCR assays; -: no colonies were grown or negative reaction in real-time PCR assays. aReaction reagents were shown in Table 2. bSimplex reaction targeting STh, STp or LT genes was performed in each strain. 2

LWT - Food Science and Technology 114 (2019) 108409

K. Ohtsuka, et al.

Table 2 Reaction mixtures for real-time PCR assays. Assay

Primer and probe

Sequence (5′-3′)

Amount (μl)

Reference

1

Multiplex

STh f-primer (10 pmol/μl) STh r-primer (10 pmol/μl) STh probe (5 pmol/μl) STp f-primer (10 pmol/μl) STp r-primer (10 pmol/μl) STp probe (5 pmol/μl) HLT-f-primer (10 pmol/μl) HLT-f-primer (10 pmol/μl) LT-probe (5 pmol/μl) Quanti-Tect Multiplex PCR solution Distilled water Template DNA Total

cctttcgctcaggatgctaaac cagtaattgctactattcatgctttcag FAM-cactagaatcaaaaaaatgtaac-MGB ctttcccctcttttagtcagtcaact gcagtaaaatgtgttgttcatattttctg FAM-tgactcttcaaaagagaaaa-MGB ttcccaccggatcaccaa caaccttgtggtgcatgatga VIC-cttggagagaagaaccct-MGB

1.25 1.25 0.25 1.0 1.0 0.3 0.25 0.25 0.25 12.5 3.7 3 25

Hidaka et al.

2

Multiplex

STh F-primer (10 pmol/μl) STh R-primer (10 pmol/μl) STh probe (5 pmol/μl) STp F-primer (10 pmol/μl) STp R-primer (10 pmol/μl) STp probe (5 pmol/μl) LT F-primer (10 pmol/μl) LT R-primer (10 pmol/μl) LT probe (5 pmol/μl) Enviromental Master Mix Distilled water Template DNA Total Forward primer (10 pmol/μl) Reverse-primer (10 pmol/μl) Probe (5 pmol/μl) Environmental Master Mix Distilled water Template DNA Total

aaagtggtcctgaaagcatgaatag cacccggtacaagcaggatt FAM-agcaattactgctgtgaattgtgtt-TAMRA gcaaaatccgtttaactaatctcaaa acagaaataaaaattgccaacattagc FAM-ttacctcccgtcatgttgtttcacggat-TAMRA ccggcagaggatggttacag gaatccagggttcttctctccaa FAM-tagcaggtttcccaccggatcacc-TAMRA

0.5 0.5 0.33 0.5 0.5 0.33 0.5 0.5 0.33 12.5 5.51 3 25 1.5 1.5 1.0 12.5 5.5 3 25

Konishi et al.

Simplexa

Frydendahl et al.

West et al.

aPrimers and probes for multiplex reactions were also used in a simplex reaction for each target gene.

homogenized by a stomacher for 1 min, and incubated at 42 °C for 20 h (Fig. 1a). Three ETEC strains (no. 627, no. 632, and no. 626) were cultured in TSB at 37 °C for 18 h (approximately 9 log CFU/ml). An aliquot (0.1 mL) of the cultures and their serial 10-fold dilutions (10−1 to 10−7) in PBS was added to 0.9 mL of vegetable culture to prepare vegetable cultures containing ETEC at the final ETEC concentrations of 2.0–8.0 log CFU/mL. To confirm the inoculation size, 0.1 mL aliquots of 10−7 dilutions were plated on TSA in duplicate. After incubation at 37 °C for 24 h, the colonies were counted. DNA extracts prepared from the vegetable cultures by the alkaline extraction method were used for real-time PCR Assay 1 and 2 (both simplex and multiplex reactions), targeting ST and LT genes, as described previously herein.

For DNA extraction from vegetable cultures, the alkaline heat DNA extraction method (Hara-Kudo et al., 2016) was performed. Briefly, 0.1 mL of culture was centrifuged at 10,000 × g for 10 min. The supernatant was removed and the pellet was suspended in 85 μL of sterilized 50 mM NaOH. After heating at 100 °C for 10 min, the suspension was cooled on the ice and neutralized with 15 μL of sterilized1M trisHCl (pH 7.0). The suspension was then centrifuged at 10,000 × g for 10 min. The DNA-containing supernatant was used for real-time PCR assays. 2.5. Real-time PCR assays targeting ST and LT genes Two different real-time PCR assays targeting STh, STp, and LT genes were performed. Assay 1 has been developed by Hidaka et al. (2009); it targets the STh, STp, and LT genes in a multiplex reaction (Table 2). The cycling conditions for real-time PCR amplification were as follows: 95 °C for 15 min, followed by 40 cycles of 95 °C for 1 min and 60 °C for 1 min. Assay 2 employed primers and probes for STh (Konishi et al., 2018), STp (Frydendahl et al., 2001), and LT (West et al., 2007) genes (Table 2). The cycling conditions for real-time PCR amplification were as follows: 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The three primer and probe sets were also independently used in a simplex run of Assay 2 (Table 2). Each DNA extract was tested in triplicate. The real-time PCR assays were performed using ABI ViiA7 (Thermo Fisher Scientific, MA, Waltham), and threshold values were automatically determined.

2.7. Detection of ETEC by enrichment, plating on agars, and real-time PCR assays in the pathogen-inoculated vegetables Three ETEC strains (no. 627, no. 632 and no. 626) were cultured in TSB at 37 °C for 18 h (approximately 9 log CFU/ml). An aliquot (0.25 mL) of 10−5 culture dilution in PBS was inoculated on 25 g of vegetables (approximately 2 log CFU/g). The inoculated vegetable was added to 225 mL of mEC, homogenized by a stomacher for 1 min, and incubated at 42 °C for 20 h (Fig. 1b). The culture (10 μL) was then streaked onto SMAC and CHROMagar STEC base agar in duplicate. After incubation at 37 °C for 18–24 h, five colonies suspected to be E. coli on each medium type were tested for biochemical characteristics in triple sugar iron and lysine-indole motility media and for agglutination with anti-O6, O148, and O169 sera (Denka Seiken, Tokyo, Japan). In addition, DNA extracts prepared from the vegetable cultures by the alkaline heat extraction method were used for real-time PCR Assay 1 and 2 (simplex reaction only), targeting ST and LT genes, as described.

2.6. Detection of ST and LT genes by real-time PCR assays in ETECinoculated vegetable cultures Each vegetable sample (25 g) was added to 225 mL mEC, 3

LWT - Food Science and Technology 114 (2019) 108409

K. Ohtsuka, et al.

no. 632 (O148) and no. 626 (O169). The results of ETEC isolation by plating onto selective agar media are shown in Table 4. The three serogroups of ETEC strains were recovered from all vegetable samples by plating onto the selective media. All colonies isolated from fresh cherry tomato, fresh leek, and white radish pickle samples were confirmed as the inoculated serogroup. Some colonies isolated from seaweed samples, however, were not ETEC. ST and LT genes were detected in all vegetable cultures; Ct values were less than 20 in both real-time PCR assays (Table 5). Based on the standard curves for all real-time PCR assays, ETEC populations were estimated to be approximately 8.0 log CFU/mL (Table 3). 4. Discussion Selective enrichment broth and agar for the specific detection of ETEC in food have not been previously established. In this study, enrichment broth and agar used for STEC detection in food were investigated for the specific detection of ETEC. Enrichment in mEC at 42 °C as one of enrichment procedures for STEC (Hara-Kudo et al., 2016) was assessed in this study, and the ETEC population reached more than 7.0 log CFU/mL after enrichment (Table 1). Thus, the enrichment procedure was used in subsequent experiments on ETEC-inoculated vegetables. In addition, selective agars for STEC isolation were tested for ETEC isolation; ETEC strains formed red colonies as typical of E. coli on SMAC (March & Ratnam, 1986) but did not grow on CT-SMAC (Chapman & Siddons, 1996). This demonstrated that SMAC is useful for distinguishing ETEC, as one type of E. coli, from competitive bacteria by testing a weaker concentration of CT than that used in CT-SMAC, and that other selective reagents might be necessary to develop an agar selective for ETEC. Although the presence of ETEC in food has been confirmed by conventional PCR assays (de la Rosa-Hernández et al., 2018; GómezAldapa et al., 2013; López-Saucedo et al., 2003; Phetkhajorn S, Sirikaew S, Rattanachuay P, & Sukhumungoon P., 2014), the sensitivities of the assays used in most of these studies had not been determined. LópezSaucedo et al. (2003) evaluated the sensitivity of a multiplex PCR assay using pure ETEC cultures. The minimum number of CFUs detected was greater than 5 log CFU/ml, which demonstrated the low sensitivity of this assay. The sensitivity of a real-time PCR assay was superior to that of a conventional PCR assay because the former utilizes equipment for the highly-sensitive detection of fluorescence, and fluorescence-stained PCR products can be visually determined using agarose gels. Some realtime PCR assays targeting ST and LT genes have been developed. Most of these, however, were evaluated using pure ETEC cultures (Guion, Ochoa, Walker, Barletta, & Cleary, 2008) or were applied to detect ETEC in water (Lothigius et al., 2008; Ram, Vajpayee, & Shanker, 2010) or fecal samples (Pattabiraman et al., 2016; Reischl, Youssef, Wolf, Hyytia-Trees, & Strockbine, 2004; Youmans et al., 2014). Although Singh et al. (2010) developed a real-time PCR assay using probes to detect ETEC in environmental water and leaf vegetables, the sensitivity was not clear. Grant, Hu, and Jinneman (2006) reported that ETEC could be detected in food such as salsa, hot sauce, lettuce, or celery inoculated with ETEC at 103 CFU/g, after enrichment, using the multiplex real-time PCR assay developed in their study. Even though enriched cultures were used, the Ct values were greater than 30 for most samples, indicating the low sensitivity of this assay. In this study, two different real-time PCR assays, namely Assay 1 and 2 performed in simplex and multiplex reactions, were investigated with respect to their sensitivity and ability to quantitatively detect ETEC in vegetables. The minimum detection levels of these two realtime PCR assays were 1.9–3.1 log CFU/mL, indicating high sensitivity of the assays. In addition, the constructed standard curves showed high correlation coefficients for all combinations of vegetable and strains (Table 3). This indicated that both assays could be used for vegetable sample testing. The sensitivity of both simplex and multiplex Assay 2 tended to be higher than that of Assay 1 (Table 3). Because

Fig. 1. The flow of detection of ST and LT genes or ETEC in ETEC-inoculated food cultures (a) or food (b).

3. Results 3.1. Growth of ETEC in mEC and on selective agar media ETEC populations in mEC culture reached 7.8–8.9 (mean ± SD, 8.4 ± 0.3) and 7.0–8.5 (7.8 ± 0.4) log CFU/mL after 18 h at 37 °C and 42 °C, respectively (Table 1). All strains formed red colonies typical of E. coli on SMAC but none grew on CT-SMAC (Table 1). In addition, the strains formed violet colonies similar to STEC on CHROMagar STEC base agar. 3.2. Detection of ST and LT genes by real-time PCR assays in ETEC culture in TSB and pathogen-inoculated vegetable cultures The presence of STh, STp, and LT genes corresponded to the results of the real-time PCR assays for all strains (Table 1). Because growth in mEC and on selective agar media was similar among the ETEC strains tested in this study, three strains were selected for further analysis. Standard curves were prepared using threshold cycle (Ct) values and the numbers of ETEC bacteria inoculated in vegetable culture. The R2 value of each curve was > 0.985 (Table 3). The minimum detection levels of ST and LT genes in all real-time PCR assays for all combinations of vegetable and strains were 1.9–3.1 log CFU/mL (Table 3). 3.3. Detection of ETEC by enrichment, plating on agars, and real-time PCR assays for pathogen-inoculated vegetables ETEC was detected in the pathogen-inoculated vegetables by enrichment, plating, and real-time PCR assays. The inoculum sizes in vegetables were 1.9 log CFU/g for no. 627 (O6) and 2.1 log CFU/g for 4

LWT - Food Science and Technology 114 (2019) 108409

K. Ohtsuka, et al.

Table 3 Standard curves and minimum detection levels of real-time PCR assays targeting ST and LT genes in vegetable culture inoculated with ETEC. Assay

1

Multiplex

Vegetable

Serogroup of strain (strain no.)a

ST LT ST ST

0.990 0.990 0.996 0.996

y = −3.923x+49.2074 y = −3.8572x+45.3724 y = −3.3566x+46.671 y = −3.3311x+46.9296

2.9 1.9 3.1 2.1

ST LT ST ST

0.992 0.994 0.996 0.987

y = −3.5541x+47.6434 y = −3.577x+45.7173 y = −3.4121x+46.121 y = −3.5351x+47.4938

2.9 1.9 2.1 3.1

ST LT ST ST

0.996 0.996 0.992 0.993

y = −3.4988x+47.5217 y = −3.507x+45.618 y = −3.3968x+45.5748 y = −3.2596x+45.9828

2.9 1.9 2.1 2.1

O148 (632) O169 (626)

ST LT ST ST

0.985 0.988 0.991 0.996

y = −3.7581x+48.7617 y = −3.6834x+46.3935 y = −3.6728x+48.6193 y = −3.3739x+48.4092

2.9 1.9 3.1 3.1

Cherry tomato

O6 (627) O148 (632) O169 (626)

ST and LT ST ST

0.992 0.997 0.995

y = −3.5824x+46.1073 y = −3.3136x+46.5352 y = −3.3496x+43.6704

1.9 3.1 2.1

Leek

O6 (627) O148 (632) O169 (626)

ST and LT ST ST

0.994 0.990 0.989

y = −3.4307x+45.0695 y = −3.3937x+47.5906 y = −3.6134x+45.8493

1.9 2.1 2.1

Radish pickles

O6 (627) O148 (632) O169 (626)

ST and LT ST ST

0.996 0.992 0.997

y = −3.3116x+44.3193 y = −3.3413x+47.0751 y = −3.3924x+44.5296

1.9 2.1 2.1

Seaweed

O6 (627) O148 (632) O169 (626)

ST and LT ST ST

0.988 0.996 0.996

y = −3.7459x+46.1555 y = −3.5047x+47.3089 y = −3.3647x+43.8736

1.9 2.1 2.1

Cherry tomato

O6 (627)

ST LT ST ST

0.989 0.992 0.995 0.996

y = −3.5715x+47.7554 y = −3.6379x+45.6422 y = −3.2501x+46.3798 y = −3.3363x+43.4822

1.9 1.9 3.1 2.1

ST LT ST ST

0.993 0.994 0.991 0.992

y = −3.36133x+48.4168 y = −3.497x+45.399 y = −3.4002x+47.9661 y = −3.5817x+45.6304

2.9 1.9 2.1 2.1

ST LT ST ST

0.995 0.993 0.998 0.997

y = −3.2687x+46.4139 y = −3.4778x+45.2446 y = −3.5559x+48.5651 y = −3.3151x+43.9481

1.9 1.9 3.1 2.1

ST LT ST ST

0.986 0.989 0.994 0.997

y = −3.6125x+46.9418 y = −3.6262x+45.2728 y = −3.4884x+47.9141 y = −3.3449x+43.6169

1.9 1.9 2.1 2.1

Cherry tomato

O6 (627)

O6 (627) O148 (632) O169 (626)

Radish pickles

O6 (627) O148 (632) O169 (626)

Seaweed

Simplex

Minimum detection level (log CFU/ml)

Formula

Leek

Multiplex

Standard curve R2

O148 (632) O169 (626)

2

Target gene (ST/LT)

O6 (627)

O148 (632) O169 (626) Leek

O6 (627) O148 (632) O169 (626)

Radish pickles

O6 (627) O148 (632) O169 (626)

Seaweed

O6 (627) O148 (632) O169 (626)

a No. 627: STh< no. 632: STh; no. 626: STp.

CFU, based on an experiment with volunteers (Levine et al., 1977), it was also reported that this dose is 1.4–3.0 log CFU, based on an outbreak related to pickles contaminated with the pathogen at a concentration of < 1.6 log CFU/g (Hara-Kudo & Takatori, 2011). Because the infectious dose has not been determined yet, lower contamination levels such as 1.0 log CFU/g might be appropriate for evaluating ETEC detection methods with vegetables. Whereas DNA-extraction efficiencies might be different among food types, the quality and quantity of DNA extracted by the alkaline heat extraction method and a kit including purification steps with a silica membrane were not found to be related the sensitivity of a real-time PCR assay based on eight types of food such as ground beef, pork, lettuce, and spinach (Mori et al.,

Environmental Master Mix, which is known to alleviate the inhibitory effects on amplification associated with food composition, was employed in simplex and multiplex Assay 2 but not in Assay 1, and thus, the high sensitivity of Assay 2 might be associated with the use of the Environmental Master Mix. ETEC inoculated onto vegetables (approximately 2.0 log CFU/g) was easily isolated by a combination of enrichment in mEC and plating onto selective agars. However, colonies with similar morphology to ETEC were observed in seaweed samples, indicating that more selective agars are required. In addition, ETEC inoculums used for vegetable cultures, calculated based on standard curves, exceeded 8.4 log CFU/ mL. Although it was reported that the infectious dose of ETEC is 8.0 log 5

6

8.3 15.1 + - - + + + O6 (627) O148 (632) O169 (626) Seaweed

a Strains of no. 627, no. 632 and no. 626 are harvoring of STh<, STh and STp, respectively. +: Positive reaction; -: negative reaction.

8.3 15.7 + - -

O6 (627) O148 (632) O169 (626) Leek

8.4 8.6 8.5

+ + + 8.6 14.9 + - -

O6 (627) O148 (632) O169 (626) Radish pickles

8.6 8.8 8.6

16.6 17.6 15.4 17.3 16.9 19.8 + + +

8.4 8.7 8.5

8.7 15.0 + - - 8.6 8.7 8.5 17.0 16.0 17.2 + + +

17.4 18.4 15.2

16.0 14.9 16.0 + + +

O6 (627) O148 (632) O169 (626)

Calculated bacteria number (log CFU/ml)

Cherry tomato

This research was supported by the Health Science Research Grants of the Ministry of Health, Labour and Welfare, Japan. Strains of ETEC O153 were kindly provided by Kazuhiko Sugimura, The Public Health Center of Kurashiki City; Takeru Sato, The Public Health Center of Fujisawa City; and Hiroshi Narimatsu, Oita Prefectural Institute of Health and Environment.

14.5

16.0 17.3 17.5 + + +

Calculated bacteria number (log CFU/ml) Ct value

Acknowledgments

+ - -

Detection Ct value Detection

The authors have no conflict of interest.

Serogroup (strain no.)a

Conflicts of interest

Vegetable

Table 5 Detection of ETEC by real-time PCR assays in vegetable inoculated with the pathogen.

Specific methods for ETEC detection from vegetables were established focusing on O6, O25, O27, O148, O153, O159, and O169 as the major ETEC serogroups in this study. The enrichment in mEC at 42 °C for 18 h, real-time PCR assays targeting ST and LT genes, and plating onto SMAC and CHROMagar STEC base agar were confirmed as highly sensitive approaches for ETEC detection from vegetables. ETEC screening methods based on real-time PCR assays performed on vegetable cultures enriched with mEC at 42 °C for 18 h would be particularly beneficial for ETEC isolation from vegetables, which could be followed by plating cultures positive for ST and LT genes onto agar media. However, further studies to develop selective media for ETEC are necessary to improve isolation efficiently.

9.0 8.8 9.0

ST LT ST

5. Conclusion

16.9 17.4 14.1

Assay 2 (simplex) Assay 1

personal communications). In the present study, tests were investigated to distinguish ETEC from other bacteria. We specially tested the application of media for STEC even though there are no previous reports on the application of such media to isolate ETEC. If the same media could be used for both STEC and ETEC, testing efficiency would ultimately be improved. The discovery of selective reagents specific for ETEC is still very important to develop selective media for this pathogen, and this represents an important and necessary future research area. Food sources other than vegetables were not used in this study. Hence, it would be valuable to evaluate this method for various food sources such as meat, dairy, or seafood.

Ct value

CHROMagar STEC: CHROMagar STEC base agar. a Strains of no. 627, no. 632 and no. 626 are harvoring of STh<, STh and STp, respectively. b No. of colony positive for the serogroup/no. of tested colony.

+ + +

5/5 3/5 4/5

9.0

4/5 5/5 2/5

14.1

O6 (627) O148 (632) O169 (626)

+ - -

Seaweed

9.0 9.0 9.0

5/5 5/5 5/5

8.4

5/5 5/5 5/5

15.0

O6 (627) O148 (632) O169 (626)

+ - -

Radish pickles

8.5 8.7 8.7

5/5 5/5 5/5

17.3 18.0 14.3

5/5 5/5 5/5

+ + +

O6 (627) O148 (632) O169 (626)

8.3

Leek

13.2

5/5 5/5 5/5

+ - -

5/5b 5/5 5/5

8.5 8.8 8.8

O6 (627) O148 (632) O169 (626)

Ct value

Cherry tomato

Detection

SMAC

Calculated bacteria number (log CFU/ml)

CHROMagar STEC

Detection

Serogroup (strain no.)a

LT

Vegetable

Calculated bacteria number (log CFU/ml)

Table 4 Detection of ETEC in vegetable inoculated with the pathogen by plating after enrichment.

8.9

LWT - Food Science and Technology 114 (2019) 108409

K. Ohtsuka, et al.

LWT - Food Science and Technology 114 (2019) 108409

K. Ohtsuka, et al.

References

Lothigius, Å., Janzon, A., Begum, Y., Sjöling, Å., Qadri, F., Svennerholm, A. M., et al. (2008). Enterotoxigenic Escherichia coli is detectable in water samples from an endemic area by real-time PCR. Journal of Applied Microbiology, 104, 1128–1136. March, S.,B., & Ratnam, S. (1986). Sorbitol-MacConkey medium for detection of Escherichia coli O157:H7 associated with hemorrhagic colitis. Journal of Clinical Microbiology, 23, 869–872. Medus, C., Besser, J. M., Juni, B. A., Koziol, B., Lappi, V., Smith, K. E., et al. (2016). Longterm sentinel surveillance for enterotoxigenic Escherichia coli and non-O157 Shiga toxin-producing E. coli in Minnesota. Open Forum Infectious Diseases, 3, ofw003. Okoh, A. I., & Osode, A. N. (2008). Enterotoxigenic Escherichia coli (ETEC): A recurring decimal in infants' and travelers' diarrhea. Reviews on Environmental Health, 23, 135–148. Pattabiraman, V., Parsons, M. B., & Bopp, C. A. (2016). Real-time TaqMan PCR assay for the detection of heat-labile and heat-stable enterotoxin genes in a geographically diverse collection of enterotoxigenic Escherichia coli strains and stool specimens. Foodborne Pathogens and Diseases, 13, 212–220. Peruski, L. F., Jr., Kay, B. A., El-Yazeed, R. A., El-Etr, S. H., Cravioto, A., Wierzba, T. F., et al. (1999). Phenotypic diversity of enterotoxigenic Escherichia coli strains from a community-based study of pediatric diarrhea in periurban Egypt. Journal of Clinical Microbiology, 37, 2974–2978. Phetkhajorn, S., Sirikaew, S., Rattanachuay, P., & Sukhumungoon, P. (2014). Most probable number-polymerase chain reaction-based quantification of enterotoxigenic Escherichia coli from raw meats in Southern Thailand. Southeast Asian Journal of Tropical Medicine and Public Health, 45, 1385–1391. Ram, S., Vajpayee, P., & Shanker, R. (2010). Enterotoxigenic Escherichia coli in sewageimpacted waters and aquatic weeds: Quantitative PCR for culture- independent enumeration. Journal of Applied Microbiology, 108, 1007–1014. Rangel-Vargas, E., Gómez-Aldapa, C. A., Torres-Vitela Mdel, R., Villarruel-López, A., Gordillo-Martínez, A. J., & Castro-Rosas, J. (2015). Presence and correlation of some enteric indicator bacteria, diarrheagenic Escherichia coli pathotypes, and Salmonella serotypes in alfalfa sprouts from local retail markets in Pachuca, Mexico. Journal of Food Protection, 78, 609–614. Reischl, U., Youssef, M. T., Wolf, H., Hyytia-Trees, E., & Strockbine, N. A. (2004). Realtime fluorescence PCR assays for detection and characterization of heat-labile I and heat-stable I enterotoxin genes from enterotoxigenic Escherichia coli. Journal of Clinical Microbiology, 42, 4092–4100. de la Rosa-Hernández, M. C., Cadena-Ramírez, A., Téllez-Jurado, A., Gómez-Aldapa, C. A., Rangel-Vargas, E., Chávez-Urbiola, E. A., et al. (2018). Presence of multidrugresistant Shiga toxin-producing Escherichia coli, enteropathogenic Escherichia coli, and enterotoxigenic Escherichia coli on fresh cheeses from local retail markets in Mexico. Journal of Food Protection, 81, 1748–1754. Singh, G., Vajpayee, P., Ram, S., & Shanker, R. (2010). Environmental reservoirs for enterotoxigenic Escherichia coli in south Asian Gangetic riverine system. Environmental Science and Technology, 44, 6475–6480. United States Department of Agriculture (2014). Laboratory guidebook MLG 5B.05. Detection and isolation of non-O157 Shiga toxin-producing Escherichia coli (STEC) from meat products and carcass and environmental sponges. West, D. M., Sprigings, K. A., Cassar, C., Wakeley, P. R., Sawyer, J., & Davies, R. H. (2007). Rapid detection of Escherichia coli virulence factor genes using multiplex realtime TaqMan PCR assays. Veterinary Microbiology, 122, 323–332. Youmans, B. P., Ajami, N. J., Jiang, Z. D., Petrosino, J. F., DuPont, H. L., & Highlander, S. K. (2014). Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples. The American Journal of Tropical Medicine and Hygiene, 90, 124–132.

Begum, Y. A., Talukder, K. A., Nair, G. B., Khan, S. I., Svennerholm, A. M., Sack, R. B., et al. (2007). Comparison of enterotoxigenic Escherichia coli isolated from surface water and diarrhoeal stool samples in Bangladesh. Canadian Journal of Microbiology, 53, 19–26. Cartwright, R. Y. (1993). Travellers' diarrhoea. British Medical Bulletin, 49, 348–362. Chapman, P. A., & Siddons, C. A. (1996). A comparison of immunomagnetic separation and direct culture for the isolation of verocytotoxin-producing Escherichia coli O157 from cases of bloody diarrhea, non-bloody diarrhea and asymptomatic contacts. Journal of Medical Microbiology, 44, 267–271. Erume, J., Berberov, E. M., & Moxley, R. A. (2010). Comparison of the effects of different nutrient media on production of heat-stable enterotoxin-b by Escherichia coli. Veterinary Microbiology, 144, 160–165. European Food Safety Authority (2009). Technical specifications for the monitoring and reporting of verotoxigenic Escherichia coli (VTEC) on animals and food (VTEC surveys on animals and food). EFSA Journal, 11, 1366. Feng, P., Weagant, S. D., & Jinneman, K. (2016). Diarrheagenic Escherichia coli. Chapter 4A. Bacteriological analytical manual. U. S. Food and Drug Administration. Frydendahl, K., Imberechts, H., & Lehmann, S. (2001). Automated 5' nuclease assay for detection of virulence factors in porcine Escherichia coli. Molecular and Cellular Probes, 15, 151–160. Goldsmid, J. M., & Leggat, P. A. (2007). The returned traveler with diarrhoea. Australian Family Physician, 36, 322–327. Gómez-Aldapa, C. A., Torres-Vitela Mdel, R., Acevedo-Sandoval, O. A., Rangel-Vargas, E., Villarruel-López, A., & Castro-Rosas, A. (2013). Presence of Shiga toxin-producing Escherichia coli, enteroinvasive E. coli, enteropathogenic E. coli, and enterotoxigenic E. coli on tomatoes from public markets in Mexico. Journal of Food Protection, 76, 1621–1625. Grant, M. A., Hu, J., & Jinneman, K. C. (2006). Multiplex real-time PCR detection of heatlabile and heat-stable toxin genes in enterotoxigenic Escherichia coli. Journal of Food Protection, 69, 412–416. Guion, C. E., Ochoa, T. J., Walker, C. M., Barletta, F., & Cleary, T. G. (2008). Detection of diarrheagenic Escherichia coli by use of melting-curve analysis and real-time multiplex PCR. Journal of Clinical Microbiology, 46, 1752–1757. Hara-Kudo, Y., Knish, N., Otsuka, K., Iwabuchi, K., Kikuchi, R., Isobe, J., et al. (2016). An interlaboratory study on efficient detection of Shiga toxin-producing Escherichia coli O26, O103, O111, O121, O145, and O157 in food using real-time PCR assay and chromogenic agar. International Journal of Food Microbiology, 230, 81–88. Hara-Kudo, Y., & Takatori, K. (2011). Contamination level and ingestion dose of foodborne pathogens associated with infections. Epidemiology and Infection, 139, 1505–1510. Hidaka, A., Hokyo, T., Arikawa, K., Fujiwara, S., Ogasawara, J., Hase, A., et al. (2009). Multiplex real-time PCR for exhaustive detection of diarrhoeagenic Escherichia coli. Journal of Applied Microbiology, 106, 410–420. Konishi, N., Obata, O., Kai, A., Ohtsuka, K., Nishikawa, Y., Terajima, J., et al. (2018). Major vehicles and o-serogroups in foodborne enterotoxigenic Escherichia coli outbreaks in Japan, and effective detection of the pathogen in food associated with an outbreak. Japanese Journal of Food Hygiene, 59, 161–166. Levine, M. M., Caplan, E. S., Waterman, D., Cash, R. A., Hornick, R. B., & Snyder, M. J. (1977). Diarrhea caused by Escherichia coli that produce only heart-stable enterotoxin. Infection and Immunity, 17, 78–82. López-Saucedo, C., Cerna, J. F., Villegas-Sepulveda, N., Thompson, R., Velazquez, F. R., Torres, J., et al. (2003). Single multiplex polymerase chain reaction to detect diverse loci associated with diarrheagenic Escherichia coli. Emerging Infectious Diseases, 9, 127–131.

7