MyD88 signaling pathway in mice

MyD88 signaling pathway in mice

Chemosphere 237 (2019) 124437 Contents lists available at ScienceDirect Chemosphere journal homepage: www.elsevier.com/locate/chemosphere Sodium flu...

2MB Sizes 0 Downloads 127 Views

Chemosphere 237 (2019) 124437

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Sodium fluoride impairs splenic innate immunity via inactivation of TLR2/MyD88 signaling pathway in mice Ping Kuang a, 1, Hongrui Guo a, b, 1, Huidan Deng a, 1, Hengmin Cui a, b, c, *, Jing Fang a, b, Zhicai Zuo a, b, Junliang Deng a, b, Yinglun Li a, b, Xun Wang a, b, Ling Zhao a, b a b c

College of Veterinary Medicine, Sichuan Agricultural University, Wenjiang, Chengdu, 611130, China Key Laboratory of Animal Diseases and Environmental Hazards of Sichuan Province, Sichuan Agricultural University, Wenjiang, Chengdu, 611130, China Key Laboratory of Agricultural Information Engineering of Sichuan Province, Sichuan Agricultural University, Yaan, Sichuan, 625014, China

h i g h l i g h t s  NaF exposure can impair splenic innate immunity.  NaF inactivated the TLR2/MyD88 signaling pathway.  NaF induced a causal cascade response to impact immune cytokines production.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 10 June 2019 Received in revised form 4 July 2019 Accepted 22 July 2019 Available online 23 July 2019

Fluoride is known to affect the inflammatory process and autoregulation of immune responses, but the molecular mechanism by which fluoride causes innate immune injury remain largely unknown. Also, studies on sodium fluoride (NaF)-caused alteration of TLR signaling are still lacking. In the present study, we examined the effects of NaF on the mRNA and protein expression levels of TLR2/MyD88 signaling pathway molecules in the mouse spleen by using the methods of qRT-PCR and Western blotting. Consequently, we elucidated the mechanism underlying the effects of NaF on innate immunity. Two hundred and forty ICR mice were randomly divided into 4 groups with intragastric administration of distilled water in the control group and 12, 24, 48 mg/kg of NaF treatment in the experiment groups for 42 days. The findings revealed that NaF impaired splenic innate immunity in mice via inactivation of TLR2/MyD88 signaling pathway. NaF-inactivated TLR2/MyD88 signaling pathway was identified by prominently downregulated mRNA and protein expression levels of TLR2/MyD88, IRAK4, IRAK1, TRAF6, TAK1, MKK4/MKK7 and c-Jun, which ultimately altered the expression levels of IL-1b, IL-4, IL-6 and IL-8 to attenuate innate immunity. © 2019 Elsevier Ltd. All rights reserved.

Handling Editor: A. Gies Keywords: Sodium fluoride TLR2/MyD88 signaling pathway Innate immunity Spleen Mice

1. Introduction Fluorine plays important roles in maintaining healthy bones and preventing dental caries, which is benefits at low doses for both humans and animals (Hagmann, 2008). Moreover, fluorine is found in large amount in the environment and its affected area may be quite extensive. This includes but not limited to the fields of dentistry, medicine, environmental biology, toxicology etc. (Ozsvath, 2009). However, chronic high-level exposure to fluoride

* Corresponding author. College of Veterinary Medicine, Sichuan Agricultural University, Wenjiang, Chengdu, Sichuan, 611130, China. E-mail address: [email protected] (H. Cui). 1 These authors contributed equally to this work. https://doi.org/10.1016/j.chemosphere.2019.124437 0045-6535/© 2019 Elsevier Ltd. All rights reserved.

may be harmful to bones, teeth and other organs (Perumal et al., 2013). Fluorosis is a serious disease resulted from the accumulation of toxic fluoride, which occurs in different regions and affects millions of people (Barbier et al., 2010). Over recent decades, increasing attention has been paid on the roles of fluoride in the modulation of immune response, which suggests that fluoride can impair immune function (Gibson, 1998; Das et al., 2006; ndez-Castro et al., 2011; Beatriz et al., 2016). Our previous Herna works have confirmed that sodium fluoride (NaF) can induce developmental toxicity in the spleen, increase cell apoptosis and trigger blood immunotoxicity in mice (Deng et al., 2016a, 2016b, 2017; Kuang et al., 2016a, 2016b; Guo et al., 2017). Other studies have also reported that fluoride may induce pathologic alterations and disrupts the functions of cells, tissues and organs. (Basha and

2

P. Kuang et al. / Chemosphere 237 (2019) 124437

Begum, 2011; Liu et al., 2011; Zhao et al., 2014). Host defense system is comprised of innate (non-specific) and adaptive (acquired) immunity. Innate immune system involves the first line of defense against various invading pathogens (Segovia et al., 2012). The recognition of pathogens can be achieved via germline-encoded cell surface toll-like receptors (TLRs)(Lehnardt et al., 2006). TLRs comprise a family of pattern-recognition receptors (PRRs), which trigger the signals involved in both innate and adaptive immunity by activating pathogen-associated molecular patterns (PAMPs) (Beutler, 2004; Chang, 2010; Cheng et al., 2017). Moreover, there is striking complexity in the downstream intracellular signaling events of TLRs pathway. The wellcharacterized pathway involves the intracellular myeloid differentiation primary response protein 88 (MyD88), TNF receptorassociated factor 6 (TRAF6) and IL-1-receptor-associated kinases (IRAK) 1e4, which ultimately lead to the activation of transcriptional factor nuclear factor-kB (NF-kB) (Takeda and Akira, 2003). MyD88 acts as a bridge to facilitate the binding of TLRs to other downstream signaling molecules (Vidya et al., 2018). TLR2 is well recognized as a targeted receptor in response to innate immunity, which contains a large repertoire of ligands (Takeuchi et al., 1999, 2000; Underhill et al., 1999; Yoshimura et al., 1999; Weber et al., 2003). TLR2 triggers MyD88-dependent intracellular signaling cascades such as the activation of extracellular signal-regulated kinase (ERK), c-Jun N-terminal kinase (JNK), mitogen-activated protein kinase (MAPK) p38 and NF-kB (Cheng et al., 2017). We have proved that NaF impairs splenic immune function by inhibiting splenic B and T lymphocyte proliferation, and relative cytokine and antibody production, which are characterized by splenic histomorphological injury, decreased T (CD3þ, CD4þ, CD8þ) and B (CD19þ) lymphocytes population, reduced levels of interferon gamma (IFN-g), interleukin-2 (IL-2), tumor necrosis factor alpha (TNF-a), transforming growth factor beta (TGF-b), immunoglobulin A (IgA), IgG and IgM (Kuang et al., 2016a, 2016b). Hence, this study is a continuation of previous research to further illustrate how NaF disrupts the immune function of mouse spleen, with a major objective of establishing an in vivo experimental model for assessing fluoride-induced immunotoxicity. Additionally, the immune system can be a target of fluoride and numerous studies have also reported that fluoride causes immunotoxicity (Das et al., 2006; Wang et al., 2009; Giri et al., 2013; Guo et al., 2017). Thus, based on our previous research, we further explored how splenic innate immunity was impaired by NaF treatment, clarified the underlying mechanisms of TLR2/MyD88mediated innate immunity, and provided evidences for the importance of innate immunity in maintaining host viability. The findings revealed that NaF altered the mRNA and protein expression levels of TLR2/MyD88 signaling pathway molecules, including TLR2, MyD88, IRAK4, IRAK1, TRAF6, transforming growth factor-bactivated kinase 1 (TAK1), MKK4/MKK7 and c-Jun. In addition, the production of cytokines such as Interleukin-1b (IL-1b), Interleukin4 (IL-4), Interleukin-6 (IL-6) and Interleukin-8 (IL-8) were changed through TLR2/MyD88-mediated intracellular signaling cascades.

those in control group (P < 0.01) after 21 and 42 days of NaF treatment. Meanwhile, compared to control group, the protein expression levels of TLR2 were significantly reduced (P < 0.05 or P < 0.01) in 24 and 48 mg/kg groups at day 21 and in the three treatment groups at day 42. Likewise, NaF markedly decreased (P < 0.01) the protein expression levels of MyD88 in 24 and 48 mg/ kg groups at both 21 and 42 days of treatment (Fig. 1). 2.1.2. Changes in the mRNA and protein expression levels of IRAK4, IRAK1 and TRAF6 The mRNA and protein levels of TLRs-related molecules such as IRAK4, IRAK1 and TRAF6 were determined by qRT-PCR and Western blot analyses, respectively (Figs. 2 and 3). The mRNA and protein expression levels of IRAK4 were remarkably reduced (P < 0.01 or P < 0.05) in the three NaF treatment groups compared to control group at both 21 and 42 days (Fig. 2aeb). The IRAK1 mRNA expression levels were markedly declined (P < 0.01 or P < 0.05) in the three NaF treatment groups (Fig. 2cleft). Meanwhile, its protein expression levels were significantly reduced (P < 0.01 or P < 0.05) in 48 mg/kg group at 21 days of treatment and in 24 and 48 mg/kg groups at 42 days of treatment when comparing with control group (Fig. 2a and 2c-right). Fig. 3aeb shows the mRNA and protein expression levels of TRAF6. Compared to control group, the mRNA and protein expression levels of TRAF6 were significantly downregulated (P < 0.01 or P < 0.05) in 24 and 48 mg/kg groups at 21 days of treatment, and in the three NaF treatment groups at day 42. 2.2. Effects of NaF on the mRNA and protein expression levels of TAK1-mediated downstream signaling molecules in the spleen 2.2.1. Changes in the mRNA and protein expression levels of TAK1 Considering that TAK1 can regulate in vivo immune response, it is crucial for NF-kB and MAPK activation in response to TLR stimulation (Sato et al., 2005). Therefore, the expression levels of TAK1 were determined in this study. As compared to control group, the mRNA expression levels of TAK1 were remarkably decreased

2. Results 2.1. Effects of NaF on the mRNA and protein expression levels of TLR2/MyD88 pathway molecules in the spleen 2.1.1. Changes in the mRNA and protein expression levels of TLR2 and MyD88 TLR2 is involved in the recognition of pathogens, and MyD88, as a universal adaptor, plays a crucial role in TLR signaling transduction. In the present study, the mRNA expression levels of TLR2 and MyD88 were lower in the three experimental groups than

Fig. 1. Changes mRNA and protein expression levels of TLR2 and MyD88 in the spleen at 21 and 42 days of the experiment. (a) The Western blot assay. (bec) The relative mRNA and protein expression levels of TLR2 and MyD88. Data are presented with the mean ± standard deviation (n ¼ 8), *p < 0.05 and **p < 0.01, compared with the control group.

P. Kuang et al. / Chemosphere 237 (2019) 124437

3

A significantly decrease in the ratio of MKK4/MKK7 mRNA expression levels were noted in 24 and 48 mg/kg groups (P < 0.01 or P < 0.05) after 42 days of treatment (Fig. 4b). Simultaneously, in comparison with control group, the ratios of phosphorylated MKK4/MKK7 protein expression (Fig. 4b-right) were significantly declined (P < 0.05) in 48 mg/kg group at day 21 as well as in 24 and 48 mg/kg groups at day 42. Interestingly, the phosphorylation levels of MKK4 (Ser257) and MKK7 (Thr275) in treatment groups were higher than those in control group (Fig. 4a). Besides, the mRNA and protein expression levels of c-Jun were remarkably decreased (P < 0.01) in 12, 24 and 48 mg/kg groups compared to those in control group during the experiment (Fig. 4a and c). 2.3. Effects of NaF on the mRNA and protein expression levels of immunity-related cytokines in the spleen

Fig. 2. Changes mRNA and protein expression levels of IRAK4 and IRAK1 in the spleen at 21 and 42 days of the experiment. (a) The Western blot assay. (bec) The relative mRNA and protein expression levels of IRAK4 and IRAK1. Data are presented with the mean ± standard deviation (n ¼ 8), *p < 0.05 and **p < 0.01, compared with the control group.

2.3.1. Changes in the mRNA and protein expression levels of IL-1b, IL-8, IL-6 and IL-4 Further, we investigated the mRNA and protein expression levels of immune-related cytokines, such as IL-1b, IL-4, IL-6 and IL8 that serve as crucial indicators in the TLRs-mediated innate immune (Figs. 5 and 6). As presented in Fig. 5b, the mRNA expression levels of IL-1b were significantly lower in the three treatment groups at day 21 (P < 0.05 or P < 0.01) and day 42 (P < 0.01) than those in control group. Moreover, the protein expression levels of IL-1b were remarkably decreased (P < 0.01) in 24 and 48 mg/kg groups compared to control group after 21 and 42 days of treatment (Figure 5a and 5b-right). The mRNA expression levels of IL-8 were significantly decreased (P < 0.01) in three treatment groups compared to control group at day 21 and 42 (Fig. 5c). Similarly, the protein expression levels of IL8 were markedly reduced (P < 0.01 or P < 0.05) in 24 and 48 mg/kg groups at day 21, and in the three treatment groups at day 42, as compared to those in control group (Figure 5a and 5c-right). Fig. 6 shows the mRNA and protein expression levels of IL-6. The mRNA expression levels of IL-6 were significantly downregulated (P < 0.01 or P < 0.05) in the three NaF treatment groups compared to control group. Similarly, the protein expression levels of IL-6

Fig. 3. Changes mRNA and protein expression levels of TRAF6 and TAK1 in the spleen at 21 and 42 days of the experiment. (a) The Western blot assay. (bec) The relative mRNA and protein expression levels of TRAF6 and TAK1. Data are presented with the mean ± standard deviation (n ¼ 8), *p < 0.05 and **p < 0.01, compared with the control group.

(P < 0.01) in 48 mg/kg group at day 21 and in the three treatment groups at day 42 (Fig. 3c-left). Furthermore, the protein expression levels of Ser439 p-TAK1 were markedly reduced (P < 0.01 or P < 0.05) in both 24 and 48 mg/kg treatment groups at day 42, but there were no significant changes in its expression levels after 21 days of treatment (Fig. 3a and 3c-right). 2.2.2. Changes in the mRNA and protein expression levels of MKK4/ MKK7 and c-Jun Next, the expression levels of downstream signaling molecules, e.g., MKK4, MKK7, and c-Jun were analyzed, which serve as critical indicators in the TLRs signaling pathway.

Fig. 4. Changes mRNA and protein expression levels of MKK4/MKK7 and c-Jun in the spleen at 21 and 42 days of the experiment. (a) The Western blot assay. (bec) The relative mRNA and protein expression levels of MKK4/MKK7 and c-Jun. Data are presented with the mean ± standard deviation (n ¼ 8), *p < 0.05 and **p < 0.01, compared with the control group.

4

P. Kuang et al. / Chemosphere 237 (2019) 124437

Fig. 5. Changes mRNA and protein expression levels of IL-1b and IL-8 in the spleen at 21 and 42 days of the experiment. (a) The Western blot assay. (bec) The relative mRNA and protein expression levels of IL-1b and IL-8. Data are presented with the mean ± standard deviation (n ¼ 8), *p < 0.05 and **p < 0.01, compared with the control group.

Fig. 6. Changes mRNA and protein expression levels of IL-6 and IL-4 in the spleen at 21 and 42 days of the experiment. (a) The Western blot assay. (bec) The relative mRNA and protein expression levels of IL-6 and IL-4. Data are presented with the mean ± standard deviation (n ¼ 8), *p < 0.05 and **p < 0.01, compared with the control group.

were markedly reduced (P < 0.01) in 24 and 48 mg/kg groups compared to control group after 21 and 42 days of treatment (Fig. 6aeb). The mRNA and protein expression levels of IL-4 in 24 and 48 mg/ kg groups at day 21, and in three NaF treatment groups at day 42 were significantly higher (P < 0.01 or P < 0.05) than those in control group (Fig. 6a and c). 3. Discussion In our previous works, it has been shown that NaF suppresses splenic immune function, including T and B lymphocyte proliferation and antibody production. However, there are no researches on the alteration of TLR signaling induced by NaF. In this study, we found that NaF only affected TLR2 expression and there were no significant differences in the expression levels of other TLRs. TLR2 signaling contributes significantly to recognize microbial patterns

and trigger innate immunity, which plays an essential role in regulating homeostasis (Li et al., 2010). In the present study, the expression levels of TLR2 (Fig. 1) were significantly down regulated in the mouse spleen during 42 days of NaF intragastric administration, suggesting that the decreased TLR2 expression levels can influence the downstream signals cascade response. This may limit the innate immune responses via TLR2/MyD88-mediated signaling molecules including IRAK4, IRAK1, TRAF6, TAK1, MKK4/MKK7, and c-Jun, and ultimately induce host disorders. MyD88, as an adaptor protein recruited by nearly all TLRs except TLR3, plays an essential role in TLR signaling transduction. MyD88 acts as a ‘shared’ signaling component that can be activated by TLRs and interleukin-1 receptor (IL-1R) family (Kawai et al., 1999; Uematsu and Akira, 2009). Stimulation of MyD88 molecule triggers the interaction between MyD88 and IRAK4. The recruitment of IRAK4 by MyD88 leads to the formation of Myddosome complex (Lin et al., 2010). During the formation process, the IRAK4 activates IRAK1. Then, TLR2-induced dimerization of MyD88 and activation of IRAK4/IRAK1 induce the recruitment of TRAF6 (Gohda et al., 2004). In addition, IRAK1 interacts with TRAF6 to activate TAK1/ TAB (TGF-b-activated kinase). The activated TAK1/TAB complex finally stimulates JNK and NF-kB as well as cytokines production (Wang et al., 2001). JNK, as a member of the MAPK families, is a key signaling molecule that responds to mitogenic stimulis or environmental stresses, leading to the expression of corresponding proteins (Ji et al., 2016). Among the MAPKs family members, MKK4 and MKK7 are responsible for catalyzing the activation of JNK (Pearson et al., 2001), which are mainly regulated by MAPKKKs (e.g ASK1, MLK3, B-Raf, and TAK1) (Cuevas et al., 2007; Wang et al., 2007). TAK1 is indispensable for cellular response to TLR signaling, which participates in responses to adaptive and innate immunity and exerts non-redundant functions on inflammation signaling pathways (Takaesu et al., 2003; Sato et al., 2005). In this study, we found that NaF significantly downregulated the expression levels of TLR2mediated downstream signaling molecules like MyD88, IRAK-1, IRAK-4, TAK-1 and TRAF-6 (Figs. 1e3). The downregulation of TAK1 expression levels contributed to splenic innate immune injury via JNK signaling, which were characterized by the decreased expression levels of MKK4/MKK7 and c-Jun (Fig. 4). Interestingly, there were no markedly changes in the mRNA and protein expression levels of JNK in all the NaF treated groups. Paradoxically, our previous study regarding the spleen cell apoptosis induced by NaF exposure through endoplasmic reticulum (ER) stress, the results showed an upregulation of phosphorylated JNK (p-JNK)(Deng et al., 2016b). Similarly, Yanqing G et al.(Geng et al., 2014) have proved that NaF activates JNK to increase ovarian cell apoptosis via induction of oxidative stress, which is also characterized by upregulated expression levels of p-JNK. Both of them are apoptosis by NaF induction via different signal stresses. There are two explanations to the non-significant differences in JNK expression levels. The first explanation may attribute to the measurement of total JNK protein content rather than its phosphorylated form. The second possibility may be due to the fact that NaF-inactivated TLR2 mediated signaling cascade is unable to affect JNK expression. Additionally, the expression of c-Jun may have other bypass signal stimulation that results in its down regulation, ultimately leading to a decline in natural immunity. Furthermore, we focused on the TLR2/MyD88-mediated splenic innate immunity, and our results confirmed that NaF inactivated TLR2/MyD88 signaling pathway to inhibit splenic innate immune responses. Subsequently, under the whole cascade reaction of TLR2/MyD88 signaling pathway, numerous cytokines and costimulatory molecules are needed for the transcripts to evoke proper immune responses. Based on previous data, we have

P. Kuang et al. / Chemosphere 237 (2019) 124437

examined several cytokines such as IL-1b, IL-4, IL-6, IL-8, in addition to previous data of IFN-g, IL-2, IL-10, TGF-b and TNF-a [9, 10], in order to elucidate the mechanisms underlying innate immune injury. These critical cytokines are generated from the infected cells by activating NF-kB/MAP inflammation pathway, which can establish an effective immune response for combating infection and stimulation (Morita et al., 2001; Feldmann and Maini, 2008; Segovia et al., 2012; Turner et al., 2014). Our findings demonstrated that TLR2/MyD88-mediated signaling cascade reaction decreased the expression levels of IL-1b, IL-8 and IL-6, and enhanced IL-4 expression levels in NaF-treated groups. In addition, our previous data regarding the reduced expression levels of IFN-g, IL-2, TNF-a, TGF-b, and increased IL-10 expression levels indicated that inflammation was restricted (Figs. 5 and 6). These results suggest that pathogens can not be eliminated and adaptive immune response can not be initiated, ultimately leading to immune depression and increased susceptibility to infections.

5

In conclusion, the findings of present and previous studies indicate that NaF exposure can impair splenic innate immunity through inactivating TLR2/MyD88 signaling pathway in mice. NaFinactivated TLR2/MyD88 signaling pathway is characterized by the downregulated expression levels of TLR2/MyD88, IRAK4, IRAK1, TRAF6, TAK1, MKK4/MKK7 and c-Jun, which ultimately alter the expression levels of IL-2, IFN-g, IL-1b, IL-4, IL-6, IL-8, IL-10,TNF-a, and TGF-b to attenuate the innate immunity (Fig. 7). 4. Materials and methods 4.1. Animals and treatment The ethical approval for animal experimentation was obtained from the Animal Care and Use Committee, Sichuan Agricultural University. Two hundred and forty 4-week-old ICR mice (purchased from Experimental Animal Corporation of DOSSY at Chengdu, China) were used to elucidate the mechanism underlying the effects of NaF on splenic innate immunity. All mice were given ad libitum access to food and water, divided randomly into 4 groups (n ¼ 60 in each group). The mice in experimental groups were intragastrically administered with 12, 24 and 48 mg/kg of NaF (Chengdu Kelong Chemical Co., Ltd., Chengdu, China) at 1 mL/ 100 g b.w. once daily for 42 days. The mice in control group were intragastrically administered with the same volume of distilled water. 4.2. Determination of the mRNA expression levels of TLR2/MyD88 signaling pathway molecules by qRT-PCR

Fig. 7. Sodium fluoride impairs splenic innate immunity in mouse.

After treating for 21 and 42 days, 8 mice from each group were euthanatized and their spleens were removed and cryopreserved for further mRNA detection by qPCR(Yang et al., 2019). After homogenization with mortar and pestle under liquid nitrogen, total RNA was extracted using RNAiso Plus (Takara, Japan) according to manufacturer's protocol. Subsequently, cDNA synthesis was carried

Table 1 Sequence of primers used in qRT-PCR. Gene symbol

Accession number

Primer

Primer sequence (50 -30 )

Product size

Tm ( C)

TLR2

NM-011905.3

62

NM-010851.2

197 bp

60

IRAK4

NM-029926.5

136 bp

58

IRAK1

NM-001177973.1

173 bp

59

TRAF6

NM-009424.3

184 bp

60

TAK1

NM-009316.1

94 bp

58

MKK4

NM-009157.5

178 bp

61

MKK7

NM-001164172.1

123 bp

62

c-Jun

NM-010591.2

130 bp

58

IL-1b

NM-008361

132 bp

57

IL-6

NM-031168

72 bp

58

IL-8

NM-011339

115 bp

59

IL-4

NM-021283

115 bp

61

b-actin

NM-007393

GCTCCTGCGAACTCCTATCC CAGCAGACTCCAGACACCAG TCGCTGTTCTTGAACCCTCG TCACGGTCTAACAAGGCCAG GGTGTACAAGGGCTGTGTGA GTTCTCGTGCTGACACGTTG CTCAGATCCCAGGAACAGGT GTGGTCACTACTAGAGGCTGC TTCCCTGACGGTAAAGTGCC ACAAGAAACCTGCCTCCTGG AGTGAGATGATCGAAGCGCC AAGCTCCTCTTCCGACAACC CATGCAGGGTAAGCGCAAAG CCAGTGTTGTTCAGGGGAGAT TCTGAAGGAGAAGCATGGCG GCTTTGGAGTCAACAAGGCG ACATCACCACTACACCGACC ACACTGGGAAGCGTGTTCTG AATGCCACCTTTTGACAGTGAT TGCTGCGAGATTTGAAGCTG CCCCAATTTCCAATGCTCTCC GGATGGTCTTGGTCCTTAGCC TTTCCACCGGCAATGAAG TAGAGGTCTCCCGAATTGGA GTCATCCTGCTCTTCTTTCTCG ATGGCGTCCCTTCTCCTGT GCTGTGCTATGTTGCTCTAG CGCTCGTTGCCAATAGTG

178 bp

MyD88

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

117 bp

60

6

P. Kuang et al. / Chemosphere 237 (2019) 124437

out using Prim-Script™ RT reagent Kit (Takara, Japan) as per the manufacturer's protocol. As listed in Table 1, the primers sequences used for qPCR assay were designed using Primer 5 software, and then synthesized by Sangon (Shanghai, China). qRT-PCR reactions were performed on a real-time PCR instrument (LightCycler 96; Roche, Mannheim, Germany) using SYBR® Premix Ex Taq™ II (Takara, Japan) according to the manufacturer's instructions. The presence of a single homogeneous peak was verified by melting curve analysis. In addition, agarose gel electrophoresis was used to evaluate the purity of PCR products. The relative changes in the mRNA expression levels of target genes at day 21 and 42 were analyzed by the 2DDCT method (Livak and Schmittgen, 2001), with b-actin as the ‘housekeeping’ reference gene. 4.3. Determination of the protein expression levels of TLR2/MyD88 signaling pathway molecules by western blotting After 21 and 42 days of treatment, 8 mice from each group were euthanatized and their splenic samples were collected for the determination of protein expression levels by Western blotting (Taylor et al., 2013; Yang et al., 2018). The protein samples were isolated using RIPA lysis buffer (Beyotime, China) and BCA Protein Assay Kit (Beyotime, China) was used to determine the total protein concentration of each sample. Equivalent quantities of protein samples were loaded and separated by 10e15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and then transferred it onto a nitrocellulose membrane. The membrane was blocked for 1 h with 5% non-fat milk, followed by overnight incubation with primary antibodies at 4  C. The primary antibodies used were as follows: TLR2, TRAF6, TAK1, c-Jun (Abcam, UK), IRAK4, MKK4, IL-6, IL-4, (CST, USA), MyD88, IRAK1, MKK7, IL-1b, and IL-8 (Absin, CHN). After washing with PBS-tween, the membrane was incubated for 1 h with each corresponding secondary antibody (CST, USA), and then washed again with PBS-tween. The blots were visualized by enhanced chemiluminescence kit (ECL; Bio-Rad, Hercules, CA, USA) and X-ray film. Finally, the protein bands were quantified by ImageJ software. 5. Statistical analysis Statistical analyses were carried out using SPSS version 19.0 software. One-way analysis of variance (ANOVA) was used to compare the statistical differences between NaF treatment groups and control group. The experimental data are presented as the mean ± standard deviation. P value of less than 0.05 and 0.01 were considered as statistical significant. Conflicts of interest The authors declare no conflict of interest. Author contributions P. Kuang, H. Guo and H. Cui designed the experiments. P. Kuang, H. Guo and H. Deng carried out the experiments. P. Kuang, H. Guo, H. Deng, and J. Fang, Z. Zuo, J. Deng., Y. Li, X. Wang and L. Zhao analyzed and interpreted the data. P. Kuang, H. Guo, H. Deng and H. Cui wrote and revised the manuscript. Acknowledgments This study was supported by the program for Changjiang scholars and innovative research team in university (IRT 0848) and

the Shuangzhi Project (03572437; 03571800).

of

Sichuan

Agricultural

University

References Barbier, O., Arreola-Mendoza, L., Del Razo, L.M., 2010. Molecular mechanisms of fluoride toxicity. Chem. Biol. Interact. 188, 319e333. Basha, P.M., Begum, S., 2011. Evaluation of fluoride-induced oxidative stress in rat brain: a multigeneration study. Biol. Trace Elem. Res. 142, 623e637. Beatriz, D., Marta, V., Rene, R.A., Devesa, V., Dinoraz, V., 2016. Effects of sodium fluoride on immune response in murine macrophages. Toxicol. In Vitro 34, 81e87. Beutler, B., 2004. Inferences, questions and possibilities in Toll-like receptor signaling. Nature 430, 257e263. Chang, Z.L., 2010. Important aspects of Toll-like receptors, ligands and their signaling pathways. Inflamm. Res. 59, 791e808. Cheng, Y., Wang, D., Wang, B., Li, H., Xiong, J., Xu, S., Chen, Q., Tao, K., Yang, X., Zhu, Y., He, S., 2017. HMGB1 translocation and release mediate cigarette smokeinduced pulmonary inflammation in mice through a TLR4/MyD88-dependent signaling pathway. Mol. Biol. Cell 28, 201e209. Cuevas, B.D., Abell, A.N., Johnson, G.L., 2007. Role of mitogen-activated protein kinase kinase kinases in signal integration. Oncogene 26, 3159e3171. Das, S.S., Maiti, R., Ghosh, D., 2006. Fluoride-induced immunotoxicity in adult male albino rat: a correlative approach to oxidative stress. J. Immunotoxicol. 3, 49. Deng, H., Kuang, P., Cui, H., Chen, L., Fang, J., Zuo, Z., Deng, J., Wang, X., Zhao, L., 2016a. Sodium fluoride induces apoptosis in cultured splenic lymphocytes from mice. Oncotarget 7, 67880e67900. Deng, H., Kuang, P., Cui, H., Chen, L., Luo, Q., Fang, J., Zuo, Z., Deng, J., Wang, X., Zhao, L., 2016b. Sodium fluoride (NaF) induces the splenic apoptosis via endoplasmic reticulum (ER) stress pathway in vivo and in vitro. Aging 8, 3552. Deng, H., Kuang, P., Cui, H., Luo, Q., Liu, H., Lu, Y., Fang, J., Zuo, Z., Deng, J., Li, Y., 2017. Sodium fluoride induces apoptosis in mouse splenocytes by activating ROSdependent NF-kB signaling. Oncotarget 8, 114428e114441. Feldmann, M., Maini, S.R., 2008. Role of cytokines in rheumatoid arthritis: an education in pathophysiology and therapeutics. Immunol. Rev. 223, 7e19. Geng, Y., Qiu, Y., Liu, X., Chen, X., Ding, Y., Liu, S., Zhao, Y., Gao, R., Wang, Y., He, J., 2014. Sodium fluoride activates ERK and JNK via induction of oxidative stress to promote apoptosis and impairs ovarian function in rats. J. Hazard Mater. 272, 75e82. Gibson, S.L., 1998. Effects of fluoride on immune system function. Community Dent. Health 15, 121. Giri, D.K., Ghosh, R.C., Mondal, M., Dewangan, G., Kashyap, D.K., 2013. Immunotoxic potential of sodium fluoride following subacute exposure in Wistar rats. Afr. J. Agric. Res. 8, 3372e3380. Gohda, J., Matsumura, T., Inoue, J., 2004. Cutting edge: TNFR-associated factor (TRAF) 6 is essential for MyD88-dependent pathway but not toll/IL-1 receptor domain-containing adaptor-inducing IFN-beta (TRIF)-dependent pathway in TLR signaling. J. Immunol. 173, 2913e2917. Guo, H., Kuang, P., Luo, Q., Cui, H., Deng, H., Liu, H., Lu, Y., Fang, J., Zuo, Z., Deng, J., 2017. Effects of sodium fluoride on blood cellular and humoral immunity in mice. Oncotarget 8, 85504e85515. Hagmann, W.K., 2008. The many roles for fluorine in medicinal chemistry. J. Med. Chem. 51, 4359e4369. ndez-Castro, B., Vigna-Pe rez, M., Doníz-Padilla, L., Ortiz-Pe rez, M.D., Jime nezHerna lez-Amaro, R., Baranda, L., 2011. Effect of fluoride exposure Capdeville, E., Gonza on different immune parameters in humans. Immunopharmacol. Immunotoxicol. 33, 169e177. Ji, B.M., Van-Long, T., Se-Yeon, K., Giang, N.X.N., Mira, J., Hong, S.G., Jong-Won, L., Woo-Sik, J., 2016. Induction of Nrf2/ARE-mediated cytoprotective genes by red ginseng oil through ASK1eMKK4/7eJNK and p38 MAPK signaling pathways in HepG2 cells. J. Ginseng Res. 40, 423e430. Kawai, T., Adachi, O., Ogawa, T., Takeda, K., Akira, S., 1999. Unresponsiveness of MyD88-deficient mice to endotoxin. Immunity 11, 115e122. Kuang, P., Deng, H., Cui, H., Chen, L., Fang, J., Zuo, Z., Deng, J., Wang, X., Zhao, L., 2016a. Sodium fluoride (NaF) causes toxic effects on splenic development in mice. Oncotarget 8, 4703. Kuang, P., Deng, H., Cui, H., Chen, L., Guo, H., Fang, J., Zuo, Z., Deng, J., Wang, X., Zhao, L., 2016b. Suppressive effects of sodium fluoride on cultured splenic lymphocyte proliferation in mice. Oncotarget 7, 61905e61915. Lehnardt, S., Henneke, P., Lien, E., Kasper, D.L., Volpe, J.J., Bechmann, I., Nitsch, R., Weber, J.R., Golenbock, D.T., Vartanian, T., 2006. A mechanism for neurodegeneration induced by group B streptococci through activation of the TLR2/ MyD88 pathway in microglia. J. Immunol. 177, 583e592. Li, Y., Wang, L., Chen, S., 2010. Endogenous toll-like receptor ligands and their biological significance. J. Cell Mol. Med. 14, 2592e2603. Lin, S.C., Lo, Y.C., Wu, H., 2010. Helical assembly in the MyD88:IRAK4:IRAK2 complex in TLR/IL-1R signaling. Nature 465, 885. Liu, H., Sun, J.C., Zhao, Z.T., Zhang, J.M., Xu, H., Li, G.S., 2011. Fluoride-induced oxidative stress in three-dimensional culture of OS732 cells and rats. Biol. Trace Elem. Res. 143, 446e456. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 25, 402e408. Morita, Y., Yamamura, M., Kawashima, M., Aita, T., Harada, S., Okamoto, H., Inoue, H.,

P. Kuang et al. / Chemosphere 237 (2019) 124437 Makino, H., 2001. Differential in vitro effects of IL-4, IL-10, and IL-13 on proinflammatory cytokine production and fibroblast proliferation in rheumatoid synovium. Rheumatol. Int. 20, 49e54. Ozsvath, D.L., 2009. Fluoride and environmental health: a review. Rev. Environ. Sci. Biotechnol. 8, 59e79. Pearson, G., Robinson, F., Beers, T.G., Xu, B.E., Karandikar, M., Berman, K., Cobb, M.H., 2001. Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr. Rev. 22, 153. Perumal, E., Paul, V., Govindarajan, V., Panneerselvam, L., 2013. A brief review on experimental fluorosis. Toxicol. Lett. 223, 236e251. Sato, S., Sanjo, H., Takeda, K., Ninomiya-Tsuji, J., Yamamoto, M., Kawai, T., Matsumoto, K., Takeuchi, O., Akira, S., 2005. Essential function for the kinase TAK1 in innate and adaptive immune responses. Nat. Immunol. 6, 1087e1095. Segovia, J., Sabbah, A., Mgbemena, V., Tsai, S.Y., Chang, T.H., Berton, M.T., Morris, I.R., Allen, I.C., Ting, J.P., Bose, S., 2012. TLR2/MyD88/NF-kappaB pathway, reactive oxygen species, potassium efflux activates NLRP3/ASC inflammasome during respiratory syncytial virus infection. PLoS One 7, e29695. Takaesu, G., Surabhi, R.M., Park, K.J., Ninomiya-Tsuji, J., Matsumoto, K., Gaynor, R.B., 2003. TAK1 is critical for IkappaB kinase-mediated activation of the NF-kappaB pathway. J. Mol. Biol. 326, 105e115. Takeda, K., Akira, S., 2003. Toll receptors and pathogen resistance. Cell Microbiol. 5, 143e153. Takeuchi, O., Hoshino, K., Kawai, T., Sanjo, H., Takada, H., Ogawa, T., Takeda, K., Akira, S., 1999. Differential roles of TLR2 and TLR4 in recognition of gramnegative and gram-positive bacterial cell wall components. Immunity 11, 443e451. Takeuchi, O., Kaufmann, A., Grote, K., Kawai, T., Hoshino, K., Morr, M., Mühlradt, P.F., Akira, S., 2000. Cutting edge: preferentially the R-stereoisomer of the mycoplasmal lipopeptide macrophage-activating lipopeptide-2 activates immune cells through a toll-like receptor 2- and MyD88-dependent signaling pathway. J. Immunol. 164, 554e557. Taylor, S.C., Berkelman, T., Yadav, G., Hammond, M., 2013. A defined methodology for reliable quantification of Western blot data. Mol. Biotechnol. 55, 217e226. Turner, M.D., Nedjai, B., Hurst, T., Pennington, D.J., 2014. Cytokines and chemokines:

7

at the crossroads of cell signalling and inflammatory disease. Biochim. Biophys. Acta 1843, 2563e2582. Uematsu, S., Akira, S., 2009. Toll-like receptors and innate immunity. J. Mol. Med. 388, 621e625. Underhill, D.M., Ozinsky, A., Hajjar, A.M., Stevens, A., Wilson, C.B., Bassetti, M., Aderem, A., 1999. The Toll-like receptor 2 is recruited to macrophage phagosomes and discriminates between pathogens. Nature 401, 811e815. Vidya, M.K., Kumar, V.G., Sejian, V., Bagath, M., Krishnan, G., Bhatta, R., 2018. Tolllike receptors: significance, ligands, signaling pathways, and functions in mammals. Int. Rev. Immunol. 37, 20e36. Wang, C., Deng, L., Hong, M., Akkaraju, G.R., Inoue, J., Chen, Z.J., 2001. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412, 346e351. Wang, X., Destrument, A., Tournier, C., 2007. Physiological roles of MKK4 and MKK7: insights from animal models. Biochim. Biophys. Acta 1773, 1349e1357. Wang, H., Zhou, B., Cao, J., Gu, X., Cao, C., Wang, J., 2009. Effects of dietary protein and calcium on thymus apoptosis induced by fluoride in female rats (Wistar rats). Environ. Toxicol. 24, 218. Weber, J.R., Freyer, D.C., Schroder, N.W., Reiss, A., Kuster, C., Pfeil, D., Tuomanen, E.I., Schumann, R.R., 2003. Recognition of pneumococcal peptidoglycan. An expanded, pivotal role for LPS binding protein. Immunity 19, 269e279. Yang, X., Yu, K., Wang, H., Zhang, H., Bai, C., Song, M., Han, Y., Shao, B., Li, Y., Li, X., 2018. Bone impairment caused by AlCl3 is associated with activation of the JNK apoptotic pathway mediated by oxidative stress. Food Chem. Toxicol. 116, 307e314. Yang, X., Zhang, X., Zhang, J., Ji, Q., Huang, W., Zhang, X., Li, Y., 2019. Spermatogenesis disorder caused by T-2 toxin is associated with germ cell apoptosis mediated by oxidative stress. Environ. Pollut. 251, 372e379. Yoshimura, A., Lien, E., Ingalls, R.R., Tuomanen, E., Dziarski, R., Golenbock, D., 1999. Cutting edge: recognition of gram-positive bacterial cell wall components by the innate immune system occurs via toll-like receptor 2. J. Immunol. 163, 1e5. Zhao, J., Wang, H., Tian, E., Dong, F., Zhou, B., 2014. Toxic effects of fluoride on primary lymphoid organs and white blood cells in female mice. Fluoride 47, 227e234.