ERF transcription factor RAP2.6 participates in ABA, salt and osmotic stress responses

ERF transcription factor RAP2.6 participates in ABA, salt and osmotic stress responses

Gene 457 (2010) 1–12 Contents lists available at ScienceDirect Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g ...

2MB Sizes 0 Downloads 63 Views

Gene 457 (2010) 1–12

Contents lists available at ScienceDirect

Gene j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e n e

The Arabidopsis AP2/ERF transcription factor RAP2.6 participates in ABA, salt and osmotic stress responses Qiang Zhu a, Jiantao Zhang a, Xiaoshu Gao a, Jianhua Tong b, Langtao Xiao b, Wenbin Li c, Hongxia Zhang a,⁎ a b c

Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, China Hunan Provincial Key Laboratory of Phytohormones and Growth Development, Hunan Agricultural University, Changsha 410128, China Key Laboratory of Soybean Biology in Chinese Education Ministry, Northeast Agricultural University, Haerbin 150030, China

a r t i c l e

i n f o

Article history: Received 3 November 2009 Received in revised form 10 February 2010 Accepted 23 February 2010 Available online 26 February 2010 Received by G. Theissen Keywords: ABA Abiotic stress Arabidopsis thaliana RAP2.6

a b s t r a c t AP2/ERF proteins play crucial roles in various biological processes. RAP2.6, an Arabidopsis AP2/ERF family member, has been reported to function in plant response to biotic stress, but whether it also functions in plant response to abiotic stress is not known. In this work, we demonstrate that in wild-type Arabidopsis, the expression of RAP2.6 is responsive to abscisic acid (ABA) and different stress conditions such as high salt, osmotic stress, and cold. Trans-activating ability tests in yeast demonstrate that RAP2.6 could act as a transactivator. RAP2.6 is able to bind to the GCC and CE1 cis-elements, as confirmed by both electrophoretic mobility shift assay (EMSA) and yeast one-hybrid assay. Experiments with RAP2.6-YFP fusion protein indicated that RAP2.6 is nuclear localized. Overexpression of RAP2.6 conferred hypersensitivity to exogenous ABA and abiotic stresses during seed germination and early seedling growth in Arabidopsis. The ABA content in RAP2.6 overexpressor lines decreased after being treated with salt. Furthermore, transcripts of AtABI4 and some stress inducible genes increased, and loss of ABI4 function rescues the hypersensitive phenotype of RAP2.6 overexpression lines under ABA and stress treatment. These results suggest that RAP2.6 participates in abiotic stress, possibly through the ABA-dependent pathway. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Plant hormones such as abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), and ethylene (ET) are important components in stress-related signaling pathways (Finkelstein et al., 2002; Fujita et al., 2006; Torres and Dangl, 2005; Wasilewska et al., 2008). Among them, ABA has been considered as a universal stress hormone in higher plants (Christmann et al., 2006; Finkelstein et al., 2002; Fujita et al., 2006; Wasilewska et al., 2008). Exogenous application of ABA can induce the expression of a number of stress-related genes (Shinozaki et al., 2003; Zhu 2002). However, some other genes are not responsive to exogenous ABA treatment, although they can be induced by dehydration and cold stress (Shinozaki et al., 2003; YamaguchiShinozaki and Shinozaki, 2006; Zhu 2002). Therefore, at least two pathways exist in plant responses to abiotic stresses: ABA-dependent and ABA-independent (Shinozaki et al., 2003; Yamaguchi-Shinozaki and Shinozaki, 2005). In addition, some crosstalks exist between these two pathways (Yamaguchi-Shinozaki and Shinozaki, 2005, 2006). In

Abbreviations: ABA, abscisic acid; ABRE, ABA-responsive element; AP2/ERF, APETALA2/ethylene-responsive factor; CE1, coupling element1; DRE, drought responsive element. ⁎ Corresponding author. Tel.: + 86 21 54924051; fax: + 86 21 54924015. E-mail address: [email protected] (H. Zhang). 0378-1119/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2010.02.011

Arabidopsis, many transcription factors and their cognate cis-regulatory elements that function in these two pathways have been identified (Yamaguchi-Shinozaki and Shinozaki, 2005, 2006). DREBs, AREB1, RD22BP1 and MYC/MYB are known to regulate the ABAresponsive gene expression through interacting with their corresponding cis-acting elements, such as DRE/CRT, ABRE and MYCRS/MYBRS (Yamaguchi-Shinozaki and Shinozaki, 2005). ABRE serves as the major cis-acting element in ABA-responsive gene expression, whereas DRE works as the essential cis-element in regulating the ABA-independent response to dehydration and cold (Yamaguchi-Shinozaki and Shinozaki, 2005, 2006). It has been well documented that transcription factors function in regulating the temporal and spatial expression pattern of a series of downstream genes involved in plant response to environment stresses (Shinozaki et al., 2003). In the Arabidopsis genome, over 2000 transcription factors have been identified. Based on the structure of their DNA binding domains, these transcription factors can be classified into various families (Riechmann et al., 2000). Several transcription factor families, such as MYB, Zn-finger, bHLH, NAC, AP2/ ERF, bZIP and WRKY, have been found to be associated with stress response (Agarwal et al., 2006; Eulgem and Somssich, 2007; Kang et al., 2002; Kizis et al., 2001; Singh et al., 2002). AP2/ERF is one of the most important families that are involved in plant response to biotic and abiotic stresses (Agarwal et al., 2006; Kizis et al., 2001). Based on the presence of the AP2/ERF DNA binding

2

Q. Zhu et al. / Gene 457 (2010) 1–12

domain, 147 genes encoding putative AP2/ERFs have been identified in Arabidopsis (Nakano et al., 2006). The AP2 domain contains 60 to 70 conserved amino acids, which are important for DNA binding activity (Magnani et al., 2004). Different members possess different DNA binding specificity. Some ERF proteins bind to the GCC-box (Gutterson and Reuber, 2004; Hao et al., 1998), and some DREB proteins bind to the DRE cis-element (Sakuma et al., 2002), whereas some of them bind to both GCC and DRE cis-elements (Park et al., 2001; Sakuma et al., 2002), suggesting that AP2/ERF proteins play different roles in both biotic and abiotic stress pathways. Previously, RAP2.6 (accession number AY114582), one of the Arabidopsis AP2/ERF family members, was identified as a COI1dependent JA-inducible transcription factor (JCTF) (Wang et al., 2008). The expression of RAP2.6 is strongly induced by bacterial virulent strains (He et al., 2004), and it was considered as a subregulon of the CBF regulon (Fowler and Thomashow, 2002). Here, we showed evidence for the first time that RAP2.6 is involved in Arabidopsis response to ABA and abiotic stress. First, we demonstrate the expression patterns and intracellular localization of RAP2.6. Second, we describe the growth characters of wild-type and RAP2.6 overexpression transgenic plants. Third, we show analysis of ABA-/ stress-related gene expression in wild-type and RAP2.6 overexpression transgenic plants. 2. Materials and methods 2.1. Plant materials and stress treatments Arabidopsis thaliana (ecotype Columbia-0) seeds were grown in the greenhouse as described previously (Pandey et al., 2005). For ABA treatment, 7-day-old seedlings were sprayed with 100 μM (±)-cis, trans-ABA solution, and incubated at room temperature under white light. For NaCl or sorbitol treatments, 150 mM NaCl or 333 mM sorbitol was added to MS plates, and the 7-day-old seedlings were incubated under normal growth condition. For cold treatment, 7-dayold seedlings were transferred to 4 °C. Total RNA was isolated with the TRIZOL Reagent (Invitrogen, Shanghai, China) following the manufacturer's instruction, and treated with RNase-free DNase (Promega, Shanghai, China). The first strand cDNA synthesis was performed with the ReverTra Ace (TOYOBO, Shanghai, China). 2.2. Reverse transcriptase-PCR and quantitative real-time PCR analyses For analyses of tissue expression of RAP2.6 (At1g43160), reverse transcriptase-mediated PCR (RT-PCR) was performed using RAP2.6 specific forward (5′-TTCTTTGCCTCCTCAACCAT T-3′) and reverse (5′CGAAGTGCTGCCGCATCATA-3) primers to amplify a PCR product of 222 bp. Expression levels of Actin-2 (At3g18780) was monitored with forward (5′-CATCCTCCGTCTTGACCTTGC-3′) and reverse (5′-CAAACGAGGGCTGGAACAAG-3′) primers to serve as a quantifying control. For quantitative real-time PCR, the cDNA was synthesized and DNA amplification was performed in the presence of SYBR Green Realtime PCR Master Mix (QPK-201) (TOYOBO) on the Rotor-Gene real-time thermocycler R3000 (Corbett Research). The relative mRNA levels of RAP2.6 or other stress genes were determined by normalizing the PCR threshold cycle number with that of Actin-2. The primers used for the stress genes are: qRAP2.6-F (5′-GCTGTGACTAAAGAATGTGAAAGC-3′), qRAP2.6-R (5′-CCTTGTGTGGGTCTCGAATCTC-3′); RAB18-F (5′-CAGCAGCAGTATG ACGAGTA-3′), RAB18-R (5′-CAGTTCCAAAGCCTTCAGTC-3′); RD29A-F (5′-ATCACT TGGCTCCACTGTTGTT C-3′), RD29A-R (5′ACAAAACACACATAAACATCCAAAGT); COR15-F (5′-GGCCACAAAGAAAGCTTCAG-3′), COR15-R (5′-CTTGTTTGCGGCTTCT TTTC-3′); RD22-F (5′-CCGGTAAAAGAACCGACGTA-3′), RD22-R (5-AAAGGGTTTGC TCCTGGTTT-3′); ABI4-F (5′-TCAATAACTCATCCACCGCCGTTG-3′), ABI4-R (5′-AGG CCAAATGGTCGAAGATCCATC-3′). All experiments were repeated three times independently, and the average was calculated.

2.3. Generation of transgenic plants overexpressing RAP2.6 We first cloned the RAP2.6 genomic DNA fragment using the forward (5′-ATGGTGTCTATGCTGACTAATG-3′) and reverse (5′TTAACCAAAAGAGGAGTAA TTG-3′) primers by PCR, then sub-cloned the amplified DNA fragment into the T-vector (Takara, Shanghai, China) for sequence confirmation. The genomic DNA fragment of RAP2.6 (intron included) was inserted into the pHB vector via the BamHI and PstI restriction sites (Mao et al., 2005). The construct was transformed into Agrobacterium strain GV3101, and wild-type Arabidopsis plants were transformed by the floral dipping method (Clough and Bent, 1998). T2 seeds from each of the selected transgenic plants were plated on germination medium containing hygromycin as selection antibiotic. Homozygous T3 progeny were then examined for the expression levels of RAP2.6 by RT-PCR. Two representative RAP2.6 overexpressing lines which have different RAP2.6 expression levels were chosen for further analyses in this manuscript. 2.4. Subcellular localization of RAP2.6-YFP fusion proteins The encoding region of RAP2.6 without the stop codon was amplified using forward (5′-GAAGATCTGATGGTGTCTATGCTGACTAATG-3′) and reverse (5′-GACTAGTACC AAAAGAGGAGTAATTG-3′) primers. The PCR fragment was fused in frame to the 5′-terminal of YFP in the pA7-YFP vector via Bgl II and SpeI sites for sequence confirmation. Then, the RAP2.6-YFP fusion was inserted downstream of the 35S promoter of Cauliflower mosaic virus. The plasmids were used for transient expression in tobacco (Nicotiana tabacum) protoplast cells as described previously (Yoo et al., 2007). We observed and recorded the results 18 to 20 h after transformation. The YFP fluorescence was imaged using a Zeiss LSM 510 META laserscanning confocal microscope. A 100× oil immersion objective were used for confocal imaging. For excitation of fluorescence proteins and chlorophyll, the following lines of argon ion laser were used: 514 nm for YFP, and 488 nm for chlorophyll. Fluorescence was detected at 530 to 600 nm for YFP and 650 nm for chlorophyll. Data was processed using Photoshop software (Adobe). 2.5. RAP2.6 promoter-β-galactosidase (GUS) expression in transgenic Arabidopsis plants To generate the RAP2.6 promoter-GUS construct, the 5′-flanking DNA of the RAP2.6 coding region was amplified with RAP2.6 specific primers (forward: 5′-ACTAAGCTTATGGGATGGTGTACTACGGATG-3′; reverse: 5′-CTGGATCCTGGCTC GTTTATGATTCTTGTT-3′). The 1.5 kb of PCR fragment was cloned into the pCAMBIA1300+pBI101 vector for sequence confirmation (Liu et al., 2003). The construct was transformed into Arabidopsis (ecotype Columbia-0) plants as described previously (Clough and Bent, 1998). Histochemical staining for GUS activity in transgenic plants or various issues was performed as the protocol described previously (Jefferson et al., 1987). Briefly, the transgenic plants were immersed in 1 mM 5-bromo-4-chloro-3indolyl-β-glucuronic acid solution in 100 mM sodium phosphate (pH 7.0), 0.1 mM EDTA, 0.5 mM ferricyanide, and 0.1% Triton X-100, then they were incubated at 37 °C for 12 h. Chlorophyll was cleared from the plant tissues by immersing them in 70% ethanol. Plants transformed with pCAMBIA1300+pBI101 were used as a parallel negative control. 2.6. Transcription activation activity analyses in yeast The yeast strain EGY48 harboring the LacZ reporter gene was used as an assay system (Ye et al., 2004). Sequence confirmed PCR fragments of full RAP2.6 ORF (primers: 5′-CCGGAATTCATGGTGTCTATGCTGACTAATG-3′ and 5′-ACGCGTCGACTTAACC AAAAGAGGAGTAATTG-3′), N-terminal ORF with the AP2 domain (primers: 5′-

Q. Zhu et al. / Gene 457 (2010) 1–12

CCGGAATTCATGGTGTCTATGCTGACTAATG-3′ and 5′-ACGCGTCGACTGAGTT CCAACATTTTCGGGG-3′) and C-terminal ORF without AP2 domain (primers: 5′-CCGGAATTCAATGTTGGAACTCAGACGATT-3′ and 5′-ACGCGTCGACTTAACCA AAAGAGGAGTAATTG-3′) were fused with GAL4 (B) in the pYF503 plasmid via EcoRI and SalI restriction sites, respectively. Vectors were introduced into yeast strain through LiAcmediated transformation method (Clontech, Shanghai, China). Yeast strain EGY48 harboring pYF504 plasmid which contains a gal4activating domain was used as a positive control. The cells were grown on tryptophan- and uracil-deficient SD medium for 2–3 days at 30 °C, and then transferred to 5-bromo-4-chloro-3-indolyl-beta-Dgalactopyranoside (X-gal) containing plates for color change observation (Ye et al., 2004). 2.7. DNA binding activity assays in yeast The encoding sequence of RAP2.6 was amplified by PCR using primers: 5′-CGGAATTCATGGTGTCTATGCTGACT-3′ and 5′-CGGGATCCGGTACCACCAAAA GAGGAGTAATTG-3′, and fused in frame with pGAD424 (Clontech, Shanghai, China). The resulting vector was introduced into yeast strain YM4271 which contains integrated reporter vectors (pHISI4 × GCC, pHISI-4 × DRE, pHISI-4 × CE1, or pHISI-4 × mu and pHISI empty vector for negative controls, respectively). The yeast cells were grown on histidine- and leucine-deficient SD medium supplemented with 40 mM 3-amino-1,2,4-triazole (3-AT) for 2– 3 days at 30 °C (Clontech, Shanghai, China). 2.8. Seed germination assays

3

2.11. Generation of RAP2.6-RNAi lines The nonconservative 149bp fragments of RAP2.6 were amplified by PCR using two primer pairs: Forward1: 5′-GAAGATCTGATGGTGTCTATGCTGACTAATG-3′ and Reverse1: 5′-TCATCGATGGTCGTTGCCTTACTCC-3′, and Forward2: 5′-ATCTCGAGATGGTGTC TATGCTG-3′ and Reverse2: 5′-ATGGTACCGGTCGTTGCCTTACTCC-3′. The PCR fragments were cloned into pKANNIBAL vector (Wesley et al., 2001) in both sense and antisense orientations using Bgl II and Cla I or Xhol I and Kpn I sites. The construct was digested with Not I, and sub-cloned into the pART27 binary vector (Gleave, 1992), then introduced into A. tumefaciens GV3101 for Arabidopsis transformation. Five independently transformed lines were selected. Results from two lines which have lower RAP2.6 expression levels are shown in this manuscript. 2.12. Overexpression of RAP2.6 in the abi4 mutant Plasmid construction and plant transformation were done as described in Section 2.3. In total, five independent lines were obtained by hygromycin selection. Homozygous T3 progeny were then examined for the expression levels of RAP2.6 by quantitative RTPCR. Two representative lines (abi4/RAP 1, abi4/RAP 2) which showed similar RAP2.6 expression level as the above RAP2.6-OX in wild-type background were used for further analyses. 3. Results 3.1. RAP2.6 is ubiquitously expressed in Arabidopsis

12-day-old seedlings of wild-type and RAP2.6 overexpression transgenic line (RAP-OX1) were chosen for ABA content assay using liquid chromatography-mass spectrometry (LC-MS) as described previously (Welsch et al., 2008).

As a first step to reveal the possible function of RAP2.6 in plant response to abiotic stress, we examined its expression patterns in wild-type Arabidopsis grown under normal condition by RT-PCR and quantitative real-time PCR. RAP2.6 mRNA was present in various tissues including roots, stems, rosette leaves, flowers and siliques. The level of RAP2.6 transcript in roots, stems, and leaves was relatively higher than that in flowers and siliques (Fig. 1A and B). To examine the expression pattern of RAP2.6 in more details, we generated RAP2.6 promoter-GUS transgenic plants, and the RAP2.6 promoter-GUS expression pattern in transgenic Arabidopsis plants was investigated. Consistent with the RT-PCR analysis results in Fig. 1A and B, GUS activity was detected in all tissues examined, including seedlings, leaves, stems, flowers and siliques (Fig. 1C). GUS expression was detected at the root tip and in the root hair of 1-, 2and 3-day-old seedlings, but not in hypocotyls and cotyledons. GUS activity was also observed in the floral organs. In mature siliques, GUS staining pattern could be detected near both ends. No signals were observed in the negative control plants transformed with pCAMBIA1300+pBI101 empty vector (Supplemental Fig. S1).

2.10. Expression of recombinant RAP2.6 and EMSA

3.2. RAP2.6 is inducible in seedling by ABA and abiotic stress conditions

To generate His-RAP2.6 expression plasmid, full length RAP2.6 cDNA was cloned into pET-32a (Novagen) vector via EcoRI and SalI restriction sites. The His-RAP2.6 expression plasmid was transformed into the bacterial strain BL21 (DE3). The transformed cells were cultured as described previously (Huang et al., 2009). Cells were induced with IPTG (isopropyl-1-thio-b-D-galactopyranoside) for 3 h at 36 °C and harvested by centrifugation. Native fusion protein was extracted from bacterial culture, and purified with Ni-NTA resin (Qiagen). EMSA was performed with the Light Shift Chemiluminescent EMSA Kit (Pierce) according to the manufacturer's instructions. An aliquot of 0.35 µg His-RAP2.6 and 30 fmol biotin-labeled DNA was used in the binding assays for the GCC element, and 0.7 µg His-RAP2.6 and 100 fmol biotin-labeled DNA for the CE1 element. The signals were detected using Chemiluminescent nucleic acid detection module according to the manufacturer's instructions (Pierce).

Previous studies have showed that RAP2.6 expression was pathogen inducible (He et al., 2004). To understand whether RAP2.6 expression also responds to abiotic stresses, we investigated the transcript levels of RAP2.6 in 7-day-old Arabidopsis seedlings after being treated with ABA or different stresses. As shown by quantitative real-time PCR analyses in Fig. 2, stress signals including ABA, sorbitol and salt significantly induced the expression of RAP2.6. The transcript level of RAP2.6 increased up to the maximum level of 3 h after ABA treatment, and then decreased afterwards. The accumulation of RAP2.6 transcript increased 6 h after sorbitol treatment and the strongest accumulation was observed at 12 h. Under salt treatment, RAP2.6 transcript accumulated to a maximal level at 12 h followed by a reduction at 24 h. After cold treatment, RAP2.6 transcript was slightly increased, and began to decrease after 3 h. We noticed that RAP2.6 transcripts were induced more rapidly by ABA than that by

Approximately 60 seeds each from the wild-type and RAP2.6 overexpression transgenic lines (RAP-OX1 and RAP-OX2) were planted in triplicate on Murashige and Skoog (MS) medium supplemented with different concentrations of ABA, NaCl, sorbitol, or glucose, then incubated at 4 °C for 4 days before being placed at 22 °C under longday conditions. Germination (emergence of radicles) was scored on a daily basis for 6 days. The vertical germination and growth assays were performed in a similar manner, except that the plates were placed vertically on a rack. Plant growth was monitored and photographed after 7 days. The experiments were repeated at least three times. 2.9. Quantification of ABA levels

4

Q. Zhu et al. / Gene 457 (2010) 1–12

Fig. 1. Expression of the RAP2.6 gene. (A) RT-PCR analyses of RAP2.6 transcripts in different organs of Arabidopsis plants. Total RNA was isolated from various tissues (root; stem; rosette leaf; flower; silique) of 5-week-old Arabidopsis (ecotype Col-0). RT-PCR was performed with RAP2.6-specific primers. Expression of Actin-2 was analyzed as the loading control. (B) Quantitative realtime PCR analysis of (A), RAP2.6 expression level in the root was assigned a value of 1. The data shown represent mean values and standard errors obtained from three independent experiments. (C) RAP2.6 promoter activity analyses. About 1.5 kb RAP2.6 gene promoter was inserted upstream of the GUS coding sequence in the expression vector pCAMBIA1300+pBI101. Agrobacterium cells GV3101 harboring the expression construct were used to transform wild-type Arabidopsis. More than 3 independent lines were used for analyses. GUS activity is revealed by histochemical staining. i–iii, Seedling of 1, 2 and 3 days after germination; iv, stem; v, cauline leaf; vi, rosette leaf; vii, flower; viii, silique; ix, inflorescence. Scale bar =1 mm.

Q. Zhu et al. / Gene 457 (2010) 1–12

5

Fig. 2. Quantitative real-time PCR analyses of RAP2.6 transcripts. 7-day-old seedlings grown on MS medium were treated with ABA (100 μM), NaCl (150 mM), sorbitol (333 mM), or cold (4 °C). Samples were collected at 0, 1, 3, 6, 12 and 24 h after the initiation of treatment. Total RNA was extracted from whole seedlings, and real-time PCR analyses were performed with RAP2.6 gene specific primers. The relative expression was calculated using Actin-2 as an internal reference. The unstressed expression level was assigned a value of 1. Data represents the average of three independent experiments ± SE.

NaCl and sorbitol (Fig. 2). These data suggested that the expression of RAP2.6 can be induced by ABA, salt, osmotic and cold stresses. Numerous stress-related cis-regulatory elements have been identified in the stress responsive genes (Yamaguchi-Shinozaki and Shinozaki, 2005), we analyzed the promoter region of RAP2.6 for the presence of putative cis-elements using the motif search program PLACE (http://www.dna.affrc.go.jp/PLACE/). Many abiotic stressrelated cis-elements exist in the 1.6-kb RAP2.6 promoter region, such as ABRE (ACGTG) and DRE (ACCGACCA), cold stress-related element (TGGTTT), MYB (CAACCA), auxin and salicylic acid related element (TGACG), and DOF core element (TAAAG). Several biotic stress mediated regulatory elements, such as pathogen-responsive ciselements W-box and RAV-box (Table 1), were also observed. These results further indicated that RAP2.6 might participate in both biotic and abiotic stress pathways.

3.3. RAP2.6 has transcriptional activation activity in yeast Although many AP2/ERF members have been shown to have transcription activation or repression function (Buttner and Singh, 1997; Fujimoto et al., 2000; Ohta et al., 2001; Song et al., 2005), it is not clear whether RAP2.6 alone can activate or repress the expressions of downstream genes. A conserved ERF-associated amphiphilic repression (EAR) motif is essential for the repressive activity of

Table 1 Putative stress-related cis-elements in the RAP2.6 promoter. Putative cis-element

Positiona

Sequence

ABRE

(+)127, (+)266, (+)326, (+)475, (+)509, (+)741 (+)591, (+)1102 (+)1139, (+)445 (+)1653, (+)1125, (+)822, (+)513, (+)440, (+)171, (+)148 (+)601, (+)1518 (+)618, (+)1056 (+)249, (+)743

5′-ACGTG-3′

DRE/CRT W-box RAV-box

Guard cell-specific bZIP related sequence Auxin-related sequence a

Positions of the cis-elements are from the translation start site.

5′-ACCGAC-3′ 5′-TTGAC-3′ 5′-CAACA-3′

5′-TAAAG-3′ 5′-ACTCAT-3′ 5′-TGACG-3′

several Arabidopsis ERF proteins (Ohta et al., 2001). RAP2.6 protein does not have such a motif. So we postulated that it might act as a transcriptional activator. To test this point, we examined the transcription activation activity of the full RAP2.6 protein using a yeast expression system as described previously (Ye et al., 2004). The reporter vector pG221 contains three copies of the yeast gal4 ciselement upstream of CYC1 core promoter and the lacZ gene. Vector pYF503 contains a GAL4-binding domain, which lead to the expression of GAL4-BD/fusion proteins. After co-transformation into yeast cells, the fusion proteins could bind to the cis-element of pG221. If the protein has transactivation activity, lacZ gene would be expressed (Ye et al., 2004). The yeast strain EGY48 harboring the pG221 reporter vector was transformed with the fusion plasmid pYF503-RAP2.6, pYF503-RAP2.6ΔN, pYF503-RAP2.6ΔC, pYF503 (negative control) or pYF504 (positive control), respectively. The growth status of these transformants was subsequently evaluated. As shown in Fig. 3A, all yeast cells grew well on tryptophan- and uracil-deficient SD medium. However, only cells containing pYF503-RAP2.6, pYF503RAP2.6ΔC, pYF504 (positive control) turned blue on SD/-Trp/-Ura added X-gal medium, indicating that the reporter gene LacZ was successfully activated by RAP2.6 protein. Therefore, the transactivation activity of RAP2.6 is located in its C-terminal region (Fig. 3A). 3.4. RAP2.6 can bind to GCC or CE1 cis-element in yeast Most AP2/ERF proteins can bind to the ethylene-responsive GCC (AGCCGCC), DRE (TACCGACAT) and CE1 (TGCCACCGG) element, which are commonly found in the promoter region of many stressrelated genes (Bossi et al., 2009; Hao et al., 2002; Niu et al., 2002; Sakuma et al., 2002). To examine the binding activity of RAP2.6 protein to these cis-elements, we employed a yeast expression system (Clontech Company). The fusion plasmid pGAD424-RAP2.6 was introduced into the yeast strain YM4271 carrying the integration of GCC, DRE, CE1, a non-cis-element sequence, or empty vector, respectively. Then the growth status of all transformants was evaluated after being incubated on the histidine- and leucinedeficient SD medium for 4 days at 30 °C. As we can see from Fig. 3B, after 40 mM 3-AT was added, yeast cells integrated with pHISi-GCC or pHISi-CE1 grew well, but those with pHISi-DRE, pHISi (empty vector) or non-cis-element sequence (negative control) failed to grow (Fig. 3B), indicating that RAP2.6 can bind to GCC or CE1 cis-element in yeast. This was further confirmed by EMSA (Supplemental Fig. S2).

6

Q. Zhu et al. / Gene 457 (2010) 1–12

Fig. 3. Transactivation activity, cis-element binding and subcellular localization analyses of RAP2.6. (A) Transactivation analysis of RAP2.6 in yeast. Fusion proteins of pYF504 (positive control), pYF503 (negative control), and pYF503-RAP2.6ΔN, pYF503-RAP2.6ΔC, and pYF503-RAP2.6 were co-expressed with pG221 in yeast strain EGY48. The transformants were grown on tryptophan- and uracil-deficient SD medium. The plates were incubated for 2–3 days at 30 °C, and subjected to a β-gal assay. (B) GCC-box and CE1 ciselement binding analyses. Effecter plasmid pGAD424-RAP2.6 was transformed into yeast strain YM4271 integrated with GCC (1), DRE (2), CE1 (3), a mutant DNA sequence (4), and empty vector (5), respectively. The growth of all transformants was monitored on SD media supplemented with or without 40 mM 3-AT. Photos were taken 4 days after incubation. (C) Subcellular localization of RAP2.6. Protoplast cells of tobacco (Nicotiana tabacum) were transformed with plasmid harboring the YFP or RAP2.6-YFP fusion construct. The cells were examined under chlorophyll, fluorescence, bright field and overlay in turn. Protoplast transformed with 35S:YFP was used as a positive control. Detection of fluorescence was performed under a confocal laser-scanning microscope (wavelength: 514 nm). Scale bar = 10 μm.

3.5. RAP2.6 is localized in the nucleus RAP2.6 is a single copy gene in Arabidopsis genome, and contains only one AP2 domain in the N-terminal (Nakano et al., 2006). A putative nuclear localization signal sequence (RPPKKYRGY), which indicates the possible nuclear localization of RAP2.6, is found near the AP2 domain. To determine the subcellular localization of the RAP2.6 protein, we fused the yellow fluorescent protein (YFP) to the Cterminus of RAP2.6 (RAP2.6-YFP), and expressed the fusion protein in tobacco mesophyll protoplasts. Compared with the signal of YFP alone, which was spread ubiquitously, the yellow fluorescent signal of RAP2.6-YFP recombinant protein was localized exclusively within the nucleus in the transfected protoplasts (Fig. 3C). This observation is consistent with a putative role of RAP2.6 acting as a transcription factor. 3.6. Transgenic plants overexpressing RAP2.6 are hypersensitive to ABA, salt and osmotic stresses during seed germination To further dissect the possible function of RAP2.6 in response to ABA and abiotic stresses, we generated transgenic Arabidopsis plants overexpressing RAP2.6, and investigated their seed germination and early seedling growth under various stress conditions. Under normal growth condition, no significant difference was seen between wildtype and transgenic plants. However, germination and early seedling development of transgenic plants (RAP-OX1, RAP-OX2) was significantly impaired on MS medium supplemented with high concentration of ABA, salt, sorbitol or glucose (Figs. 4 and 5). After three days on MS medium containing 1 μM ABA, only ∼ 25% of the transgenic seeds, but more than 75% of the wild-type seeds germinated (Fig. 5B). When sown on MS medium supplemented with 150 mM NaCl, only ∼50% of the transgenic seeds, but ∼80% of the wild-type seeds germinated after 3 days (Fig. 5C). Similarly, on MS medium supplemented with 250 mM sorbitol, only ∼40% of the transgenic seeds, but ∼80% of the wild-type seeds germinated after 3 days (Fig. 5D). On MS medium

containing 4% glucose, only ∼ 5% of the transgenic seeds, but ∼16% of the wild-type seeds germinated at day 3 (Fig. 5E). We also compared the growth of wild-type and transgenic plants after they were transferred to soil in green house, no significant difference was observed when treated with various stress conditions (data not shown). Similar observations were also seen in ABR1 (Pandey et al., 2005). These results indicate that overexpression of RAP2.6 conferred hypersensitivity to ABA, salt and osmotic stress specifically in seed germination and early seeding growth of transgenic plants. We speculate that RAP2.6 may play different roles in different stress pathways, thereby leading to various degrees of sensitivity to different stresses. 3.7. Transgenic plants overexpressing RAP2.6 accumulate less ABA than wild-type under high salt stress condition The sensitivity of transgenic plants to the imposed stresses could be a consequence of increased ABA accumulation (Finkelstein et al., 2002; Wasilewska et al., 2008). To address this possibility, we examined the ABA content in both wild-type and transgenic plants (line RAP-OX1) grown under either normal or high salt condition. No significant difference was seen in the ABA contents between wildtype and transgenic plants grown under normal condition. However, upon treatment with high salinity (300 mM NaCl), ABA level was lower in transgenic plants (Fig. 6A), indicating that the hypersensitivity of RAP2.6 overexpression lines to salt and osmotic stress was not through excess ABA accumulation in the transgenic plants. 3.8. RAP2.6 might participate in ABA-dependent pathway through ABI4-mediated signaling Since the hypersensitivity of RAP2.6 overexpression lines to ABA, salt and osmotic stresses was not a consequence of increased ABA accumulation, we hypothesized that this may be caused by altered expression of ABA signal factors in the RAP2.6 overexpression lines.

Q. Zhu et al. / Gene 457 (2010) 1–12

7

Fig. 4. Inhibition of young seedling growth in RAP2.6 overexpression transgenic plants. (A) Seeds of wild-type (WT) and two RAP2.6 overexpression lines (RAP-OX1 and RAP-OX2) were sowed on MS medium, or MS medium containing 1 μM ABA, 150 mM NaCl, 250 mM sorbitol or 4% glucose. Photos were taken on day 7 after stratification, and are representatives of three independent experiments. (B) Root length statistic analysis of (A). Results are presented as means and standard errors from three independent experiments. (n N 30). * and ** indicates significant differences in comparison to the wild-type at P b 0.05 and P b 0.01, respectively (Student's t-test).

Among the Arabidopsis loci affecting ABA sensitivity, ABI4, which also encodes an AP2/ERF transcription factor, plays an important role in ABA signaling and glucose response (Bossi et al., 2009; Soderman et al., 2000). Since both RAP2.6 and ABI4 have consistent binding ability to CE1 element, as well as the RAP2.6 overexpression lines showed an opposite phenotype to the abi4 mutant (Soderman et al., 2000), we examined the transcription levels of ABI4 in wild-type and RAP2.6 overexpression lines, and found that the expression level of ABI4 significantly increased in RAP2.6 overexpression lines under both normal and stress conditions (Fig. 6B). Furthermore, we overexpressed RAP2.6 gene in the abi4 mutant to generate abi4/RAP transgenic lines. After quantitative RT-PCR analyses, two representative lines (abi4/RAP 1 and abi4/RAP 2) which showed similar expression RAP2.6 level as the above RAP2.6-OX were chosen for further study. We analyzed the phenotype of the abi4/RAP2.6 overexpression lines under different stresses, and found that in the abi4 background, transgenic plants overexpressing RAP2.6 didn't exhibit the hypersensitive phenotype as that in the wild-type background (Fig. 7). These results suggest that RAP2.6 might function through ABI4-mediated ABA signaling pathway.

3.9. Altered stress responsive gene expression in RAP2.6 overexpression plants The above results have shown that RAP2.6 is activated strongly by ABA and stress, implicating the possible involvement of RAP2.6 in the regulation of ABA and stress responses in plants. Many genes responding to ABA and/or abiotic stress have been used as markers for monitoring stress response pathways in plants, such as RD29A, RD22, RAB18, and COR15 (Yamaguchi-Shinozaki and Shinozaki, 2005, 2006). To further examine whether the expression of ABA/stress responsive genes might be affected by RAP2.6 overexpression, we compared the expression levels of RD29A, RD22, RAB18, and COR15 in wild-type and RAP2.6 overexpression lines. Under normal growth condition, the transcriptional levels of all marker genes examined increased in RAP2.6 overexpression (RAP-OX) line (Fig. 8A and B). After ABA treatment, the transcripts of all marker genes examined were induced in both wild-type and RAP2.6 overexpression (RAP-OX) line, but the extents and kinetics of the induction were different between wild-type and RAP-OX line. After ABA treatment for 3 h, the expression levels of COR15 and RD22 were higher in transgenic plants

8

Q. Zhu et al. / Gene 457 (2010) 1–12

Fig. 5. Effect of stress on seed germination. Seeds of wild-type and RAP2.6 overexpression lines (RAP-OX1 and RAP-OX2) were sowed on MS medium (A), or MS medium containing 100 μM ABA (B), 150 mM NaCl (C), 250 mM sorbitol (D), or 4% glucose (E). Germination (emergence of radicles) was scored daily for 6 days. All results are presented as means and standard errors from three independent experiments (60 seeds for each repeat). Values shown are the mean of three biological replicates.

than in wild-type, after 24 h, RD29A, RAB18 and COR15 transcripts were higher in RAP2.6 transgenic lines (Fig. 8A). After NaCl treatment, although all examined marker gene transcripts were increased in both wild-type and RAP2.6 overexpression line, their expression patterns were not the same. After being treated with NaCl for 3 h, RAB18 and RD22 transcripts were higher in RAP2.6 overexpression lines, but the differences were not significant after 24 h (Fig. 8B). At 24 h, COR15 transcripts were higher in RAP2.6 overexpression lines than that in wild-type. These results suggested that RAP2.6 could modulate ABA and salt-induced gene expression. 4. Discussion

Fig. 6. ABA contents and ABI4 expression analyses. (A) ABA levels were determined in 12-day-old seedlings of wild-type and RAP2.6 overexpression line (RAP-OX1) after treatment with 0 mM or 300 mM NaCl for 6 h. Results are presented as means and standard errors from three independent experiments. ** indicates significant difference in comparison to the wild-type. P b 0.01 (Student's t-test). (B) Expression of the ABI4 gene. Total RNA was isolated from 7-day-old seedlings of wild-type and transgenic lines (RAP-OX1 and RAP-OX2). Quantitative real-time PCR was performed with ABI4-specific primers. Expression of Actin-2 was analyzed as a loading control. ABI4 expression level in the wild-type was assigned a value of 1. The data shown represent mean values and standard errors obtained from three independent experiments.

Plants have evolved different mechanisms to cope with biotic and abiotic stresses. Although progresses in the study of these two distinct stress responsive pathways have been made in recent years, our knowledge on the crosstalk between them is still limited (AbuQamar et al., 2006; Cheong et al., 2002; Fujita et al., 2006). Ethylene (ET), salicylate (SA), jasmonate (JA) and abscisic acid (ABA) are important phytohormones in the crosstalk (Cheong et al., 2002; Fujita et al., 2006). Previously, it was shown that RAP2.6 can be activated by JA, ethylene, SA, and two virulent strains (He et al., 2004; Wang et al., 2008). Our results demonstrated that the expression of RAP2.6 can be induced by ABA and abiotic stress factors, such as salt, osmotic stress and cold (Fig. 2). Further study revealed that RAP2.6 promoter contains both abiotic (ABRE, DRE, MYBR) and biotic (W-box and RAVbox) related cis-regulatory elements (Table 1). Therefore, RAP2.6 may serve as an important cross-talk node and function in both biotic and abiotic signaling.

Q. Zhu et al. / Gene 457 (2010) 1–12

9

Fig. 7. Loss of ABI4 function rescues the hypersensitive phenotype of RAP2.6 overexpression lines under ABA or stress treatment. (A) Growth of Col-0, RAP-OX1, abi4 and progeny of abi4/RAP2.6 overexpression lines (abi4/RAP 1 and abi4/RAP 2) under ABA and different stress conditions. Photos were taken on day 5 after stratification. (B) Root length statistic analysis of (A). Results are presented as means and standard errors from more than three independent experiments. (n N 30).

Our study indicated that RAP2.6 was expressed in all of the organs analyzed by RT-PCR method (Figs. 1A and B). To determine the temporal and spatial expression patterns of RAP2.6 in more details, we analyzed transgenic Arabidopsis plants expressing the RAP2.6 promoter-glucuronidase (GUS) fusion gene. The results also indicated that RAP2.6 exhibits a constitutive expression pattern, and the

transcript levels of RAP2.6 are different in the adult plants and seedlings. We noticed that the RAP2.6-overexpressing seedlings showed severe growth inhibition in response to glucose and to NaCl but less pronounced effects in the presence of ABA and sorbitol. We speculated that RAP2.6 is a transcription factor, which may be involved in different

10

Q. Zhu et al. / Gene 457 (2010) 1–12

Fig. 8. Expression of stress responsive genes in wild-type and RAP2.6 overexpression line after treated with ABA or NaCl. Seven-day-old seedlings of wild-type (WT) and transgenic line RAP-OX1 (RAP) were examined by quantitative real-time PCR after being treated with 100 μM ABA (A) or 300 mM NaCl (B). Samples were collected at 0 h (WT0 and RAP0), 3 h (WT3 and RAP3) and 24 h (WT24 and RAP24) after the initiation of treatment. Total RNA was extracted from whole seedlings, and real-time PCR analyses were performed with RD22, RD29A, RAB18 and COR15 gene specific primers. The relative expression was calculated using Actin-2 as an internal reference. The data shown represent mean values and standard errors obtained from three independent experiments.

stress pathways, but plays different roles in different stress pathways. Many reports have indicated that changes in the expression level of a transcription factor may lead to various degrees of sensitivity to different stresses, such as XERICO (Ko et al., 2006), ABR1 (Pandey et al., 2005).By genetic screening, a number of gene mutants that affect ABA response have been identified (Finkelstein et al., 2002; Leung and Giraudat, 1998). Generally, these mutants can be divided into two types: mutants with altered ABA accumulation, such as aba1-4 (Christmann et al., 2006; Nambara and Marion-Poll, 2005; Wasilewska et al., 2008; Xiong and Zhu, 2003), which has lowered ABA levels, and mutants with altered ABA sensitivity, such as abi1-8 (Brocard-Gifford et al., 2004; Christmann et al., 2006; Finkelstein et al., 2002; Leung and Giraudat, 1998). We measured the ABA contents in wild-type and RAP2.6 overexpression plants. No significant difference was observed when grown under normal condition. These results indicate that overexpression of RAP2.6 does not affect the ABA biosynthesis under normal growth condition. The hypersensitivity of RAP2.6 overexpression lines to ABA and abiotic stress may be due to altered ABA sensitivity in the transgenic plants. Similar feedback regulation in ABA levels has also been observed in ERD15 gene study (Kariola et al., 2006).

ABI4, another AP2/ERF member, plays important roles in ABA and glucose signaling during seed development and germination (Finkelstein et al., 1998; Soderman et al., 2000). The expression of ABI4 is regulated by several factors such as ABA, glucose and trehalose (Arenas-Huertero et al., 2000; Arroyo et al., 2003; Ramon et al., 2007). Up to now, only two ABI4 homologs which share high identity to ABI4 (over 50%) within the AP2 domain have been reported (Soderman et al., 2000). Both ABI4 and its homolog in maize (ZmABI4) can bind to CE1 cis-element (Bossi et al., 2009; Busk et al., 1997; Niu et al., 2002). RAP2.6 has the same binding ability to the CE1 cis-element, and the conserved amino acid similarity among ABI4, ZmABI4 and RAP2.6 is nearly 70% (Fig. 9). Interestingly, the transcriptional level of ABI4 was much higher in transgenic lines. In the abi4 mutant, overexpression of RAP2.6 plants did not confer the hypersensitivity to the transgenic plants. All these results led us to speculate that RAP2.6 may act as a regulator in ABA signaling pathway, possibly through modulating the transcripts of ABI4, although the precise relationship between ABI4 and RAP2.6 is still not clear. We also tested stomatal movements, drought, and salt tolerance in adult wild-type and transgenic plants. No significant difference

Q. Zhu et al. / Gene 457 (2010) 1–12

11

Fig. 9. Clustal X alignments of the amino acid sequences of RAP2.6, ABI4 from Arabidopsis thaliana (GenBank accession no. AAD25937) and ZmABI4 from maize (GenBank accession no. AY125490). Residues are highlighted in black, dark gray and light gray according the level of conservation. The highly conserved motif was indicated by a single underline.

was observed (data not shown), suggesting that RAP2.6 plays a role in ABA response specifically in seed germination and early seedling growth stage, but not in ABA-induced stomatal closure or later growth. Similar results were also described with CIPK3 and ABR1 (Kim et al., 2003; Pandey et al., 2005). To further investigate the function of RAP2.6, we constructed RAP2.6 RNAi transgenic plants. However, no obvious phenotype difference was seen between wildtype and RNAi transgenic plants grown under either normal or different stress conditions (Supplemental Fig. 3). A possible explanation of this is that a functional redundancy may exist between RAP2.6 and other ERF members. In Arabidopsis, ERF subfamily contains 65 members (Sakuma et al., 2002). Most of them are responsive to the same stimuli and could bind to the same regulatory element, thereby activating or repressing the same downstream gene sets. Co-expressed genes are always involved in related biological pathways (Eisen et al., 1998; Stuart et al., 2003). By transcriptome coexpression analysis on ATTED-II public database (Obayashi et al., 2009), we found that RAP2.6 is co-expressed with three ABAresponsive gene: At3g50970 (XERO2/LTI30), At4g05100 (MYB74) and At4g27410 (RD26) (Supplemental Table 1). At3g50970, a member of the dehydrin protein family, is involved in ABA and cold response (Chung and Parish, 2008). At4g05100 (MYB74) is a stressrelated transcription factor. Its promoter region contains many stress responsive elements, such as ABRE, CE1 and W-box. Furthermore, its homologue gene AtMYB102 could also be induced by drought, salt, and ABA (Kranz et al., 1998). At4g27410 (RD26), which encodes a NAC transcription factor, could be induced by desiccation, ABA and salt (Fujita et al., 2004). These results suggest that some connections between RAP2.6 and these putative co-expression factors may exist. The induction of stress-related genes has been taken as a hallmark of stress adaptation in plants (Thomashow, 1999). Here, we observed that overexpression of RAP2.6 under the control of the CaMV 35S promoter triggered an increased expression of various stress

responsive genes in transgenic lines. These results imply that RAP2.6 may act in one or more signal transduction pathway(s) by affecting the activity of stress-related genes. Although the precise mode of action of RAP2.6 in plant response to ABA and stress remains elusive, the findings in this work provide direct evidence that alteration of RAP2.6 expression can significantly modify tolerance to ABA and various abiotic stresses in transgenic plants. Further study of downstream targets of RAP2.6 will add more information to the understanding of this transcription factor's molecular functions. Acknowledgements This work was supported by the following grants: the National Basic Research Program of China (grant nos. 2006CB100106; 2010CB126600); the National Natural Science Foundation of China (grant nos. 30571196; 0933ZF11C1; 0933Z411C1); the Ministry of Science and Technology of China (grant no. 2007AA10Z187); Shanghai Science and Technology Commission (grant no. 08DZ2270800), and Key Laboratory of Soybean Biology in Chinese Education Ministry. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.gene.2010.02.011. References AbuQamar, S., et al., 2006. Expression profiling and mutant analysis reveals complex regulatory networks involved in Arabidopsis response to Botrytis infection. Plant J. 48, 28–44. Agarwal, P.K., Agarwal, P., Reddy, M.K., Sopory, S.K., 2006. Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 25, 1263–1274. Arenas-Huertero, F., Arroyo, A., Zhou, L., Sheen, J., Leon, P., 2000. Analysis of Arabidopsis glucose insensitive mutants, gin5 and gin6, reveals a central role of the plant hormone ABA in the regulation of plant vegetative development by sugar. Genes Dev. 14, 2085–2096.

12

Q. Zhu et al. / Gene 457 (2010) 1–12

Arroyo, A., Bossi, F., Finkelstein, R.R., Leon, P., 2003. Three genes that affect sugar sensing (abscisic acid insensitive 4, abscisic acid insensitive 5, and constitutive triple response 1) are differentially regulated by glucose in Arabidopsis. Plant Physiol. 133, 231–242. Bossi, F., Cordoba, E., Dupre, P., Mendoza, M.S., Roman, C.S., Leon, P., 2009. The Arabidopsis ABA-INSENSITIVE (ABI) 4 factor acts as a central transcription activator of the expression of its own gene, and for the induction of ABI5 and SBE2.2 genes during sugar signaling. Plant J. 59, 359–374. Brocard-Gifford, I., Lynch, T.J., Garcia, M.E., Malhotra, B., Finkelstein, R.R., 2004. The Arabidopsis thaliana ABSCISIC ACID-INSENSITIVE8 encodes a novel protein mediating abscisic acid and sugar responses essential for growth. Plant Cell 16, 406–421. Busk, P.K., Jensen, A.B., Pages, M., 1997. Regulatory elements in vivo in the promoter of the abscisic acid responsive gene rab17 from maize. Plant J. 11, 1285–1295. Buttner, M., Singh, K.B., 1997. Arabidopsis thaliana ethylene-responsive element binding protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts with an ocs element binding protein. Proc. Natl. Acad. Sci. U. S. A. 94, 5961–5966. Cheong, Y.H., Chang, H.S., Gupta, R., Wang, X., Zhu, T., Luan, S., 2002. Transcriptional profiling reveals novel interactions between wounding, pathogen, abiotic stress, and hormonal responses in Arabidopsis. Plant Physiol. 129, 661–677. Christmann, A., Moes, D., Himmelbach, A., Yang, Y., Tang, Y., Grill, E., 2006. Integration of abscisic acid signalling into plant responses. Plant Biol. (Stuttg.) 8, 314–325. Chung, S., Parish, R.W., 2008. Combinatorial interactions of multiple cis-elements regulating the induction of the Arabidopsis XERO2 dehydrin gene by abscisic acid and cold. Plant J. 54, 15–29. Clough, S.J., Bent, A.F., 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743. Eisen, M.B., Spellman, P.T., Brown, P.O., Botstein, D., 1998. Cluster analysis and display of genome-wide expression patterns. Proc. Natl. Acad. Sci. U. S. A. 95, 14863–14868. Eulgem, T., Somssich, I.E., 2007. Networks of WRKY transcription factors in defense signaling. Curr. Opin. Plant Biol. 10, 366–371. Finkelstein, R.R., Wang, M.L., Lynch, T.J., Rao, S., Goodman, H.M., 1998. The Arabidopsis abscisic acid response locus ABI4 encodes an APETALA2 domain protein. Plant Cell 10, 1043–1054. Finkelstein, R.R., Gampala, S.S., Rock, C.D., 2002. Abscisic acid signaling in seeds and seedlings. Plant Cell 14, S15–S45. Fowler, S., Thomashow, M.F., 2002. Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14, 1675–1690. Fujimoto, S.Y., Ohta, M., Usui, A., Shinshi, H., Ohme-Takagi, M., 2000. Arabidopsis ethylene-responsive element binding factors act as transcriptional activators or repressors of GCC box-mediated gene expression. Plant Cell 12, 393–404. Fujita, M., et al., 2004. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J. 39, 863–876. Fujita, M., et al., 2006. Crosstalk between abiotic and biotic stress responses: a current view from the points of convergence in the stress signaling networks. Curr. Opin. Plant Biol. 9, 436–442. Gleave, A.P., 1992. A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20, 1203–1207. Gutterson, N., Reuber, T.L., 2004. Regulation of disease resistance pathways by AP2/ERF transcription factors. Curr. Opin. Plant Biol. 7, 465–471. Hao, D., Ohme-Takagi, M., Sarai, A., 1998. Unique mode of GCC box recognition by the DNA-binding domain of ethylene-responsive element-binding factor (ERF domain) in plant. J. Biol. Chem. 273, 26857–26861. Hao, D., Yamasaki, K., Sarai, A., Ohme-Takagi, M., 2002. Determinants in the sequence specific binding of two plant transcription factors, CBF1 and NtERF2, to the DRE and GCC motifs. Biochemistry 41, 4202–4208. He, P., et al., 2004. Activation of a COI1-dependent pathway in Arabidopsis by Pseudomonas syringae type III effectors and coronatine. Plant J. 37, 589–602. Huang, X.Y., Chao, D.Y., Gao, J.P., Zhu, M.Z., Shi, M., Lin, H.X., 2009. A previously unknown zinc finger protein, DST, regulates drought and salt tolerance in rice via stomatal aperture control. Genes Dev. 23, 1805–1817. Jefferson, R.A., Kavanagh, T.A., Bevan, M.W., 1987. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J. 6, 3901–3907. Kang, J.Y., Choi, H.I., Im, M.Y., Kim, S.Y., 2002. Arabidopsis basic leucine zipper proteins that mediate stress-responsive abscisic acid signaling. Plant Cell 14, 343–357. Kariola, T., Brader, G., Helenius, E., Li, J., Heino, P., Palva, E.T., 2006. EARLY RESPONSIVE TO DEHYDRATION 15, a negative regulator of abscisic acid responses in Arabidopsis. Plant Physiol. 142, 1559–1573. Kim, K.N., Cheong, Y.H., Grant, J.J., Pandey, G.K., Luan, S., 2003. CIPK3, a calcium sensorassociated protein kinase that regulates abscisic acid and cold signal transduction in Arabidopsis. Plant Cell 15, 411–423. Kizis, D., Lumbreras, V., Pages, M., 2001. Role of AP2/EREBP transcription factors in gene regulation during abiotic stress. FEBS Lett. 498, 187–189. Ko, J.H., Yang, S.H., Han, K.H., 2006. Upregulation of an Arabidopsis RING-H2 gene, XERICO, confers drought tolerance through increased abscisic acid biosynthesis. Plant J. 47, 343–355.

Kranz, H.D., et al., 1998. Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. Plant J. 16, 263–276. Leung, J., Giraudat, J., 1998. Abscisic acid signal transduction. Annu. Rev. Plant Physiol. 49, 199–222. Liu, W., Xu, Z.H., Luo, D., Xue, H.W., 2003. Roles of OsCKI1, a rice casein kinase I, in root development and plant hormone sensitivity. Plant J. 36, 189–202. Magnani, E., Sjolander, K., Hake, S., 2004. From endonucleases to transcription factors: evolution of the AP2 DNA binding domain in plants. Plant Cell 16, 2265–2277. Mao, J., Zhang, Y.C., Sang, Y., Li, Q.H., Yang, H.Q., 2005. From the cover: a role for Arabidopsis cryptochromes and COP1 in the regulation of stomatal opening. Proc. Natl. Acad. Sci. U. S. A. 102, 12270–12275. Nakano, T., Suzuki, K., Fujimura, T., Shinshi, H., 2006. Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol. 140, 411–432. Nambara, E., Marion-Poll, A., 2005. Abscisic acid biosynthesis and catabolism. Annu. Rev. Plant Biol. 56, 165–185. Niu, X., Helentjaris, T., Bate, N.J., 2002. Maize ABI4 binds coupling element1 in abscisic acid and sugar response genes. Plant Cell 14, 2565–2575. Obayashi, T., Hayashi, S., Saeki, M., Ohta, H., Kinoshita, K., 2009. ATTED-II provides coexpressed gene networks for Arabidopsis. Nucleic Acids Res. 37, 987–991. Ohta, M., Matsui, K., Hiratsu, K., Shinshi, H., Ohme-Takagi, M., 2001. Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 13, 1959–1968. Pandey, G.K., Grant, J.J., Cheong, Y.H., Kim, B.G., Li, L., Luan, S., 2005. ABR1, an APETALA2domain transcription factor that functions as a repressor of ABA response in Arabidopsis. Plant Physiol. 139, 1185–1193. Park, J.M., Park, C.J., Lee, S.B., Ham, B.K., Shin, R., Paek, K.H., 2001. Overexpression of the tobacco Tsi1 gene encoding an EREBP/AP2-type transcription factor enhances resistance against pathogen attack and osmotic stress in tobacco. Plant Cell 13, 1035–1046. Ramon, M., Rolland, F., Thevelein, J.M., Van, D.P., Leyman, B., 2007. ABI4 mediates the effects of exogenous trehalose on Arabidopsis growth and starch breakdown. Plant Mol. Biol. 63, 195–206. Riechmann, J.L., et al., 2000. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290, 2105–2110. Sakuma, Y., Liu, Q., Dubouzet, J.G., Abe, H., Shinozaki, K., Yamaguchi-Shinozaki, K., 2002. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration- and cold-inducible gene expression. Biochem. Biophys. Res. Commun. 290, 998–1009. Shinozaki, K., Yamaguchi-Shinozaki, K., Seki, M., 2003. Regulatory network of gene expression in the drought and cold stress responses. Curr. Opin. Plant Biol. 6, 410–417. Singh, K., Foley, R.C., Onate-Sanchez, L., 2002. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol. 5, 430–436. Soderman, E.M., Brocard, I.M., Lynch, T.J., Finkelstein, R.R., 2000. Regulation and function of the Arabidopsis ABA-insensitive4 gene in seed and abscisic acid response signaling networks. Plant Physiol. 124, 1752–1765. Song, C.P., et al., 2005. Role of an Arabidopsis AP2/EREBP-type transcriptional repressor in abscisic acid and drought stress responses. Plant Cell 17, 2384–2396. Stuart, J.M., Segal, E., Koller, D., Kim, S.K., 2003. A gene-coexpression network for global discovery of conserved genetic modules. Science 302, 249–255. Thomashow, M.F., 1999. Plant cold acclimation: freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 571–599. Torres, M.A., Dangl, J.L., 2005. Functions of the respiratory burst oxidase in biotic interactions, abiotic stress and development. Curr. Opin. Plant Biol. 8, 397–403. Wang, Z., et al., 2008. Identification and characterization of COI1-dependent transcription factor genes involved in JA-mediated response to wounding in Arabidopsis plants. Plant Cell Rep. 27, 125–135. Wasilewska, A., et al., 2008. An update on abscisic acid signaling in plants and more.... Mol. Plant 1, 198–217. Welsch, R., Wust, F., Bar, C., Al-Babili, S., Beyer, P., 2008. A third phytoene synthase is devoted to abiotic stress-induced abscisic acid formation in rice and defines functional diversification of phytoene synthase genes. Plant Physiol. 147, 367–380. Wesley, S.V., et al., 2001. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 27, 581–590. Xiong, L., Zhu, J.K., 2003. Regulation of abscisic acid biosynthesis. Plant Physiol. 133, 29–36. Yamaguchi-Shinozaki, K., Shinozaki, K., 2005. Organization of cis-acting regulatory elements in osmotic- and cold-stress-responsive promoters. Trends Plant Sci. 10, 88–94. Yamaguchi-Shinozaki, K., Shinozaki, K., 2006. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu. Rev. Plant Biol. 57, 781–803. Ye, R., Yao, Q.H., Xu, Z.H., Xue, H.W., 2004. Development of an efficient method for the isolation of factors involved in gene transcription during rice embryo development. Plant J. 38, 348–357. Yoo, S.D., Cho, Y.H., Sheen, J., 2007. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat. Protoc. 2, 1565–1572. Zhu, J.K., 2002. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 53, 247–273.