The complete mitochondrial genome of the cyclopoid copepod Paracyclopina nana: A highly divergent genome with novel gene order and atypical gene numbers

The complete mitochondrial genome of the cyclopoid copepod Paracyclopina nana: A highly divergent genome with novel gene order and atypical gene numbers

Gene 435 (2009) 13–22 Contents lists available at ScienceDirect Gene j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / g ...

1MB Sizes 0 Downloads 6 Views

Gene 435 (2009) 13–22

Contents lists available at ScienceDirect

Gene j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / g e n e

The complete mitochondrial genome of the cyclopoid copepod Paracyclopina nana: A highly divergent genome with novel gene order and atypical gene numbers Jang-Seu Ki a, Heum Gi Park b, Jae-Seong Lee a,⁎ a b

National Research Lab of Marine Molecular and Environmental Bioscience, Department of Chemistry, College of Natural Sciences, Hanyang University, Seoul 133-791, South Korea Faculty of Marine Bioscience and Technology, College of Life Sciences, Kangnung National University, Gangneung 210-702, South Korea

a r t i c l e

i n f o

Article history: Received 21 October 2008 Received in revised form 22 December 2008 Accepted 7 January 2009 Available online 23 January 2009 Received by M. Di Giulio Keywords: Cyclopoid Copepod Paracyclopina nana Mitochondrial genome AT-rich

a b s t r a c t In this paper, we describe the complete mitogenome of the cyclopoid copepod Paracyclopina nana with emphasis on the highly rearranged gene order and high divergence against published copepod mitogenomes. The P. nana mtDNA is 15,981 bp in length (70.9% AT) and consists of 37 genes (12 protein-coding genes, 2 rRNAs, 23 tRNAs) that are atypical for metazoan mitogenomes. Unusually, it contains an extra tRNA (tRNAAla) but it does not contain the ATPase 8 gene. The P. nana mitogenome has a long putative control region with high AT content (1351 bp, 77.0% AT). The Cyt b was considerably short in length, compared to other crustaceans. Compared to typical mitogenomes of arthropods and copepods, the gene order of the P. nana mitogenome is highly rearranged with a novel gene structure. In addition, P. nana has highly divergent mt genes (mostly less than 50%), judged by amino acid substitution. We present the first complete mitogenome sequence from a cyclopoid copepod, thereby increasing our understanding of copepod and crustacean evolution from the mitochondrial point of view. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Mitochondrial (mt) genomes of the metazoans range in size from 14 to 48 kb (Crease, 1999), encoding genes for no less than 13 proteins, 22 transfer RNAs, and 2 ribosomal RNAs (rRNA). Particularly, a large non-coding (NC) region is typically present in the mitogenome that provides a role for the initiation of transcription and gene replication (Shadel and Clayton, 1997). To date, complete mtDNA sequences are widely used for deep molecular phylogenetic analyses, as they provide the most informative sequences for constructing reliable phylogenetic trees (e.g. Curole and Kocher, 1999; Boore and Brown, 2000; Le et al., 2000; Serb and Lydeard, 2003; Lavrov et al., 2004; Kilpert and Podsiadlowski, 2006; Grande et al., 2008). In addition, the mitogenome arrangements/rearrangements provide useful data for the study of evolutionary relationships among the metazoans, because these mitochondrial arrangements are relatively stable (Boore et al., 1998), particularly in the vertebrates.

Abbreviations: ATPase 6 and 8, ATPase subunits 6 and 8; bp, base pair(s); BLAST, the Basic Local Alignment Search Tool; CO1–3, cytochrome c oxidase subunits 1–3; PCGs, protein-coding genes; NC, non-coding; Cyt b, cytochrome b; mtDNA, mitochondrial DNA; ND1–6 and 4L, NADH dehydrogenase subunits 1–6 and 4L; srRNA and lrRNA, small and large subunits ribosomal RNA; H-strand, heavy strand; L-strand, light strand; nts, nucleotides; OL, origin of replication of the light strand; ORF, open reading frame; tRNA, transfer ribonucleic acid. ⁎ Corresponding author: Tel.: +82 2 2220 0769; fax: +82 2 2299 9450. E-mail address: [email protected] (J.-S. Lee). 0378-1119/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2009.01.005

Crustacean copepods are one of the most important groups of marine invertebrates in estuarine and marine systems. The copepods comprise a multitude of taxa, including 200 families, 1650 genera and 11,500 species (Humes, 1994). Phylogenetic relationships of these diversified tiny animals have been studied by the comparison of DNA sequences (Braga et al., 1999; Bucklin et al., 2003; Huys et al., 2006, 2007). There are only a few reports available that describe the complete copepod mitogenomes: Lepeophtheirus salmonis (Tjensvoll et al., 2005), Tigriopus californicus (Burton et al., 2007), and Tigriopus japonicus (Machida et al., 2002; Jung et al., 2006). In addition, the incomplete mitogenomes of the calanoid copepods Eucalanus bungii and Neocalanus cristatus (Machida et al., 2004) have been described until now. Even though a huge number of species are reported in these taxa, relatively few data of copepod mitogenomes are characterized caused by the technical difficulty to amplify the complete mitogenome by long-polymerase chain reaction (long-PCR) (Machida et al., 2004; Jung et al., 2006). The failure of amplification could be associated with several unknown factors such as gene rearrangement, an extended length of the AT-rich region, poly-A(T) tract, hairpin structures and other unidentified factors. Paracyclopina nana Smirnov 1935 (Cyclopinidae) is a planktonic brackish-water cyclopoid copepod with a tolerance to high salinity and temperature ranges (Lee et al., 2006). P. nana is regarded as an important food source for many developing larvae, post larvae and juvenile fish and crustaceans (Sun and Fleeger, 1995; Pinto et al., 2001) as well as a prey source for the aquaculture industry (Lee et al., 2006). The ecological significance of this species justifies our efforts to

14

J.-S. Ki et al. / Gene 435 (2009) 13–22

describe the complete mitogenome of P. nana, which is consisted of a new gene organization and highly divergent protein-coding genes (PCGs). Also, we compared the P. nana mitogenome with other copepod mitogenomes from the Orders Calanoida, Harpacticoida and Siphonostomatoida. These findings would provide a better understanding of the mitochondrial gene evolution in Crustacea and of copepod mitogenomics. The elucidation of the first complete mitochondrial genome will provide additional markers for the analysis of cyclopoid copepods at the population and phylogenetic level. 2. Materials and methods 2.1. Tissue sample and genomic DNA extraction P. nana were collected with a mesh from laboratory cultures, and the samples were stored at −20 °C until DNA extraction. Total genomic DNA of P. nana was isolated from the stored samples using the DNeasy tissue Kit (Qiagen, Valencia, CA) according to the manufacture's instructions.

cycles of 98 °C for 25 s and 68 °C for 12 min. After PCR amplifications, a long-PCR product was purified with the QIAquick PCR purification Kit (Qiagen GmbH, Germany) and was either sequenced directly using the above mentioned long-PCR primers or subsequent primer walking. DNA sequencing reactions were set up with a ABI PRISM® BigDye™ Terminator Cycle Sequencing Ready Reaction Kit (PE Biosystems, CA) using the PCR products (2 μL) as the template. Labeled DNA fragments were analyzed on an automated DNA sequencer (Model 3700, Applied Biosystems, CA). After sequencing the region between CO1 and Cyt b, we designed many different primer sets for amplifying the remaining mitogenome. However, amplifications of the remaining mitogenome of P. nana often failed, probably due to certain factors described previously (see Introduction). To sequence the remaining mitogenome, we used the genome walking PCR technique (Ki and Han, 2005). Table 1 lists the primer pairs used in these genome walking PCRs. All the PCR amplicons were sequenced using the methods described above. Editing and contig assembly of partial mitogenome sequences were carried out with Sequencher 4.1.4 (Gene Codes, Ann Arbor, MI). The complete mitochondrial genome of P. nana has been deposited to GenBank with the accession number EU877959.

2.2. Mitochondrial DNA amplification using the genome walking technique

2.3. Gene identification and tRNA structures

Prior to the design of long-PCR primers, we determined the DNA sequences of partial CO1 (415 bp) and Cyt b (334 bp) genes of P. nana. The unknown CO1 genes were amplified by PCR with the universal primers, LCO1490 and HCO2198 (Folmer et al., 1994). In addition, a portion of Cyt b gene was amplified with new PCR primers (cr_CybF425, 5′-CCC TGA GGA CAA ATA TCT TTT TGA GG-3′; cr_CybR760, 5′-GGA TTA GCC GGA ATA AAA TTT TC-3′), which were designed by comparing aligned crustacean Cyt b sequences available in GenBank. By various combinations of the CO1 and Cyt b targeting primers with consideration of their potential directions, we successfully amplified long-PCR fragments (∼ 12 kb) from P. nana genomic DNA using two PCR primers (Pn-Cytb-F2, 5′-GGA TTC GCT GTA GAT AAT GC-3′; Pn-CO1-F2, 5′-ACA GGG GCT GGA ACC GGA TGA AC-3′). The mitogenome of P. nana was amplified using the long-PCR technique (Chang et al., 1994; Kim et al., 2004). Briefly, long-PCR was carried out in 35 cycles in a 50 μL reaction mixtures containing 30.5 μl distilled water, 5 μl 10 × LA PCR buffer II (TaKaRa, Japan), 8 μL dNTP (4 mM), 5 μl of each primer (5 μM), 0.5 μl LA Taq polymerase (2.5 U), and 1 μl of template. The PCR cycling was performed using an iCycler PCR machine (Bio-Rad, CA). The thermal cycle profile consisted of 35

DNA sequences were analyzed using Genetyx 7.0 software (Genetyx Corp., Japan). By comparing P. nana mtDNA or amino acid sequences with other mitogenomes, the locations of 12 PCGs were determined. The 23 tRNA genes were identified by their proposed cloverleaf secondary structure (Kumazawa et al., 1998) and anticodon sequences with the aid of tRNAscan-SE1.21 (http://www.genetics. wustl.edu/eddy/tRNAscan-SE/) with different Cove score cutoff values to get all the tRNAs in the mitogenome (Lowe and Eddy, 1997); two rRNA genes were identified by sequence comparisons against related species, including the copepods L. salmonis (NC_007215), T. californicus (DQ917373), T. japonicus (AY959338), and the barnacle Megabalanus volcano (NC_006293). A secondary structure of the putative origin of replication (OL) was estimated using the program Mfold 3.2 (http://www.bioinfo.rpi.edu/ applications/mfold/old/rna/) according to Zuker (2003). With the default option (e.g. temperature setting, T = 37 °C), Mfold predicted the secondary structures of the NC region. Considering the secondary structures and previous work (Kilpert and Podsiadlowski, 2006), we identified a putative replication origin sequence of the P. nana mitogenome.

Table 1 Primers used in genome walking PCRs Pairs S01 S02 S03 S04 S05 S06 S07 S08 S09 a

a

Sequence (5′ to 3′) For first PCR

For second PCR

Pn-Cyt b-R1: CAGCTAAAATAAGGGTGAAAC Pn-16F200: ACGCTGTTATCCCTAAAGTATC Pn-16F300: CCTTAGCACTGAGGCCGTTTAC Pn-12S-F8: AGGACCTAATTGTGGAATGG Pn-CR-F1: CAATTAGGCCCTTCGTTAGG Pn-CO1-R1: GTCAGTTAAGAGCATAGTAATAGC Pn-A6R2: TTCGACCTGTCACTGTTCAG Pn-N1F1: CGTAAGATTCTTGGATTCTCTC Pn-CR-F2a: ATACCGTTCCTCATACCTGAAG

Pn-Cyt b-R2: CCTAAAGGATTAGAAGAACC Pn-16F250: ATGTAACTTCCCCAGCTAAC Pn-16F310: CGTTTACAATGCGCACTGGG Pn-CR-F4: CTAAATCCTCTTGCAATAACC Pn-CR-F2: CCTTCGTTAGGGGTTGGAC Pn-CO1-R2: AACAGCTCATGGAAATAAGGG Pn-A6R2b: AACCAGAATTACTCCAAATGAG Pn-N1F2: CGTATTGGCCCATTTAAAGTGG Pn-NcR1: TTTAAGTGGAATCTCCTCCTAG

Strand

Target

L

Cyt b

L

srRNA

L

srRNA

L

NC

L

NC

H

CO1

H

ATPase 6

H

ND1

H, L

NC

The S09 pair of primers was used to amplify the AT-rich region, with a touchdown PCR procedure, where the annealing temperature decreased gradually from 60 °C to 50 °C.

J.-S. Ki et al. / Gene 435 (2009) 13–22

In addition, nucleic acid distribution and sequence complexities were plotted across the complete P. nana mtDNA with the BioAnnotator in Vector NTI Advance 10.3.0 (Invitrogen, Carlsbad, CA). Repeat sequence patterns in the non-coding region were checked using a web-based software server, Tandem Repeats Finder (http://tandem. bu.edu/trf/trf.basic.submit.html). 2.4. Mitogenome comparisons between P. nana and other copepods For comparison of mt genes, alignment was performed of each gene sequence with DNA or amino acid sequences of other copepods (e.g. L. salmonis, T. californicus, T. japonicus) using ClustalW 1.8 (Thompson et al., 1997). General features (e.g. genetic distance, parsimony informative sites) were characterized. Molecular similarities of each individual gene were measured separately between P. nana and other crustaceans in BioEdit 5.0.6 (North Carolina State University, NC). 2.5. Gene order comparisons Comparative analysis of the gene order was carried out using a linearized representation of the mt gene arrangement, in which the CO1 gene on the L-strand was placed at the first gene. In addition, we searched the public databases (e.g. GenBank; the Mitome: www. mitome.info/). The mitogenome of P. nana was compared with those of typical arthropod mitogenomes and other copepods. 3. Results 3.1. General features of the P. nana mitogenome The complete mtDNA sequence of P. nana is 15,981 bp, and its structural organization is shown in Fig. 1. The mitogenome consists of 37 genes: 12 PCGs, two rRNAs, 23 tRNAs, and a long NC segment (1351 bp) of the putative control region. Compared to typical mitogenomes, the P. nana mitogenome contains an extra tRNAs (tRNA-Ala), but does not include the ATPase 8 gene. Of 12 PCGs, four genes (e.g. CO1, CO3, ND4, ATPase 6) were encoded on the L-strand,

15

Table 2 Start and stop codons and the genomic organization of the 12 PCGs in the mitochondrial genome of Paracyclopina nana (15,981 bp) Gene

From

To

Size (bp)

Start

Stop

CO1 tRNA-Ser(AGN)a ND4L ND6 tRNA-Lys tRNA-Val tRNA-Leu(CUN) ND3 tRNA-His ND5 tRNA-Gln tRNA-Tyr ND2 tRNA-Glu CO2 tRNA-Ser(UCN) tRNA-Arg ND4 CO3 tRNA-Leu(UUR) tRNA-Pro tRNA-Thr srRNA tRNA-Phe tRNA-Ile Cyt b tRNA-Met tRNA-Ala tRNA-Ala lrRNA Noncoding region (control region) tRNA-Cys tRNA-Asn tRNA-Asp ND1 tRNA-Gly tRNA-Trp ATPase 6

1 1567 1629 1978 2457 2533 2709 2813 3167 3230 4980 5040 5110 6100 6163 6872 6929 7012 8337 9134 9207 9271 9335 9978 10,043 10,103 11,248 11,317 11,432 11,499 12,649 14,000 14,073 14,144 14,205 15,140 15,199 15,275

1560 1625 1955 2439 2521 2595 2771 3157 3227 4906 5049 5101 6099 6160 6861 6936 6991 8337 9131 9199 9267 9334 9977 10,042 10,104 11,233 11,312 11,383 11,498 12,648 13,999 14,060 14,141 14,201 15,119 15,198 15,264 15,958

1560 59 327 462 65 63 63 345 61 1677 70 62 990 61 699 65 63 1326 795 66 61 64 643 65 62 1131 65 67 67 1150 1351 61 69 58 915 59 66 684

ATA

TAA

ATG ATA

TAA TAA

ATA

TAA

ATG

TAG

ATA

TAA

ATA

TAG

ATA ATG

TAA TAA

ATA

TAA

ATT

TAA

ATA

TAA

a

The coding genes on H-strand are underlined.

and the others were encoded on H-strand, respectively. Seventeen tRNAs and two rRNAs were found on the H-strand (Table 2). Some overlapping between mt genes was found at 4 parts: 10 bp, tRNA-GlntRNA-Tyr; 8 bp, tRNA-Ser-tRNA-Arg; 2 bp, tRNA-Ile-Cyt b; 1 bp, ND4CO3, respectively (Table 2). The P. nana mitogenome was about 800–1000 bp longer than those of L. salmonis (15,445 bp, 34.8% GC), T. japonicus (14,628 bp of the Japanese isolate, 34.8% GC; 14,301 bp of the Korean isolate, 39.5% GC), and T. californicus (14,578 bp, 38.5%). The size differences were mostly caused by the variable sequence length of the NC regions, so the overall sequence length excluding the NC was nearly identical. 3.2. Protein-coding genes

Fig. 1. Gene organization of the mitochondrial genome of the cyclopoid copepod Paracyclopina nana. Direction of gene transcription is represented by arrows. ND1, ND4 and ND5 are encoded on the L-strand and arrows indicate the direction of transcription. The ATPase 6 gene and the noncoding region (control region) are abbreviated as ATP6 and NC (CR), respectively. One letter abbreviations of amino acids are used to label the corresponding tRNA genes. Black rectangles represent other prominent NC regions. The asterisk (⁎) indicates the duplicated tRNA-Ala.

The start and stop codons of the 12 PCGs in the P. nana mitogenome are shown in Table 2. All the genes except ND1 (ATT) have complete start codons e.g. ATG and ATA, and all genes have complete stop codons, e.g. TAA, TAG. In addition, we checked the codon usage of 12 PCGs and found that 9 codons (UUA-Leu, UUA-Leu, CUU-Leu, AUU-Ile, AUA-Met, GUA-Val, UCU-Ser, AAU-Asn, AGA-Ser) were most frequently used in the P. nana mitogenome. The most frequently observed amino acid among 12 PCGs was UUU-Phe (301). The next frequently observed amino acids were AUU-Ile (247) and UUA-Leu (245). Also, the highest relative synonymous codon usage was recorded in UUA-Leu (2.61) followed by UCU-Ser (2.28) and CGAArg (2.15). All frequently used codons had an A and/or a T at their 3rd codon position. This codon bias pattern was attributed to the nature of a high AT content (77.2%) of P. nana mitogenome.

16

J.-S. Ki et al. / Gene 435 (2009) 13–22

Fig. 2. Putative secondary structures of the 23 tRNAs from the Paracyclopina nana mitogenome. The tRNAs are labeled with the abbreviations of their corresponding amino acids. Each arm and loop is illustrated in tRNA-Val. The DHU-arm, and TψC replacements are shown for tRNA-Leu (CUN) and -Glu, respectively. The boxed tRNA depicts the extra tRNA-Ala.

J.-S. Ki et al. / Gene 435 (2009) 13–22 Table 3 Percent base composition for protein coding, tRNA and rRNA genes of the mitochondrial genome of Paracyclopina nana Gene, codon position

A

T

G

C

Mitogenome Protein coding 1st codon pos. 2nd codon pos. 3rd codon pos. Totala Gene ATPase 6 CO1 CO2 CO3 Cyt b ND1 ND2 ND3 ND4 ND4L ND5 ND6 tRNAa rRNAa

37.6

33.3

13.9

15.2

AT-skew

GC-skew

24.4 17.4 22.9 21.6

31.6 42.4 37.0 37.0

29.9 23.8 27.2 27.0

14.1 16.4 12.9 14.4

−12.9 −41.8 −23.5 −26.3

35.9 18.4 35.7 30.4

28.7 28.0 32.0 26.4 24.9 26.1 30.7 27.8 32.4 29.7 28.0 26.8 35.8 36.5

38.5 34.5 35.2 36.4 42.4 42.6 44.7 46.7 37.7 41.3 41.4 45.5 37.9 40.1

15.4 19.1 18.2 19.5 17.2 17.3 12.0 13.9 14.3 17.1 14.9 14.1 14.1 13.1

17.5 18.4 14.6 17.7 15.4 14.0 12.5 11.6 15.6 11.9 15.7 13.6 12.3 10.3

−14.6 −10.4 −4.8 −15.9 −26.0 −24.0 −18.6 −25.4 −7.6 −16.3 −19.3 −25.9 −2.8 −4.7

−6.4 1.9 11.0 4.8 5.5 10.5 −2.0 9.0 −4.3 17.9 −2.6 1.8 7.0 12.0

a

Combined data for 12 PCGs excluding stop codons, 23 tRNA genes, and 2 rRNA genes, respectively.

3.3. Transfer and ribosomal RNA genes The P. nana mitogenome contained 23 tRNAs, which are interspersed, ranging in size from 58 (tRNA-Asp) to 69 (tRNA-Asn) nucleotides (Table 2). The tRNAs are predicted to fold into expected cloverleaf secondary structures with normal base pairings (Fig. 2). However, T-G (tRNA-Asp, -Gly, -Glu, -Cys, -Ile, -Pro, -Ser-AGN, -SerUCN), C-A (tRNA-Gln), T-T (tRNA-Cys) pairings, and other atypical pairings were identified in the stem regions (tRNA-Ala, -Lys). The postulated tRNA cloverleaf structures generally contained 7 bp in the aminoacyl stem, 2 to 7 bp in the TψC stem, 7 bp in the anticodon stem, and 1 to 10 bp in the didydrouridine (DHU) stem. Some tRNAs showed

17

DHU-loop replacement (e.g. tRNA-Arg) and TψC replacement (e.g. tRNA-Asp, -Glu). When compared with the typical tRNA cluster, which is the “WANCY” region of animal mitogenomes, tRNA gene clusters consisting more than 4 genes were not present in the P. nana mitogenome. As tRNA clusters, two or three tRNAs, excluding tRNAHis, -Ser, and -Glu, were found at the P. nana mitogenome (Fig. 1). Sequence lengths of the P. nana small subunit rRNA (srRNA) and large subunit rRNA (lrRNA) were determined at 643 bp and 1150 bp, respectively. The length of each P. nana rRNA was similar to other copepods, including T. japonicus (589 bp of srRNA, 1036 bp of lrRNA), L. salmonis (590 bp of srRNA, 1009 bp of lrRNA). Among them, the P. nana rRNAs were the longest (1793 bp). The srRNA and lrRNA of P. nana were located distantly on the H-strand. The two rRNAs of all four included copepod species are located continuously between CO3 and tRNA-Lys with the interruption of two tRNAs, e.g. tRNA-Phe/Ile (two T. japonicus), Gly/Thr (T. californicus), Ile/Leu (L. salmonis) at the center. 3.4. Non-coding region The P. nana mitogenome has both a long NC region (1351 bp, 77.0% AT) that is located between lrRNA and tRNA-Cys and two short NC regions, when considered regions longer than 50 bp. The first NC region (73 bp, 80.8% AT) is located between ND5 and tRNA-Gln, and the second one (113 bp, 74.3% AT) is located between tRNA-Val and Leu (UAG). Generally, NC regions fold to form secondary structures such as stems and loops, which are associated with the transcription and replication process (Wilkinson and Chapman 1991; Lunt et al., 1998). In the longest NC region of the P. nana mitogenome, we could not identify a putative replication origin (OL). On the other hand, we identified a putative OL in a short NC region of 72 bp. The candidate sequence was 49 nucleotides long (i.e. 5′-atg aat aaa taa-AAA TAA TAG TT-t act ttc tat-AAC CTT TAT TT-gtaaa-3′) on the L-strand, where the upper case letters form a double helix structure. The structure was folded into a stable stem–loop secondary structure containing 11 bp in the stem and one bulge consisted of a 10 bp loop. This suggests that the stem–loop structure in these sequences could represent a potential OL for the P. nana mitogenome.

Fig. 3. Nucleic acid distribution (% adenine and thiamine, AT) and sequence complexity in 100-bp windows across the complete mitogenome of Paracyclopina nana. The L-strand has been used, starting with the CO1 gene.

18

J.-S. Ki et al. / Gene 435 (2009) 13–22

Table 4 Percent similarities of PCGs at the amino acid level between P. nana and Lepeophtheirus salmonis (NC_007215), Tigriopus californicus (NC_008831) and T. japonicus (NC_003979) Gene ATPase 6 CO1 CO2 CO3 Cyt b ND1 ND2 ND3 ND4 ND4L ND5 ND6

Species and amino acid similarity (%) T. japonicus

T. californicus

L. salmonis

38.9 74.1 48.2 62.6 56.3 40.4 20.6 31.4 29.9 17.1 35.0 22.7

39.3 73.2 46.5 58.4 54.7 40.7 21.5 33.3 28.6 16.2 34.4 25.3

39.3 73.0 43.7 58.0 54.1 42.7 18.1 42.3 31.1 22.5 32.8 26.5

3.5. Base composition The P. nana mitogenome is an AT-rich (70.9%) genome. Nucleotide composition of mtDNA for the L-strand was recorded at A, 37.6%; T, 33.3%; G, 13.9%; C, 15.2%, respectively (Table 3). Here the nucleotide guanine (G) was the least used and the GC content was 29.1%. Frequencies of A and T of P. nana tRNAs were measured at 35.8% and 37.9%, respectively; similar frequencies of A (36.5%) and T (40.1%).were observed in the rRNAs. Overall, the mitogenome, tRNAs, and rRNAs of P. nana were AT-rich. With regard to the PCGs, base frequencies were measured at A, 21.6%; T, 37.0%; G, 27.0% and C, 14.4%, respectively. There are different frequencies for each nucleotide at all codon positions according to the genes and strands. Particularly, the P. nana mtDNA showed an over-representation of thymine at the first (31.6%), second (42.4%), and third codon (37.0%) position. The G content at the third codon position were approximately double than the C content. Hence, there was an anti-C bias (35.7%) at the third codon position of the P. nana mitogenome. To evaluate the degree of the base bias in the PCGs, we measured a base-skew proposed by Saccone et al. (1999), and found all the values of the AT-skew were negative, as well as values of the GCskew were mostly positive (Table 3). In addition, we measured the complexity distribution and AT distribution along the mitogenome of P. nana (Fig. 3). The distribution of the AT content fluctuated around 75% across the complete mitogenome. The most simple but frequent case of a low complexity zone is the AT-rich region. However, some protein coding regions showed a relatively lower AT content than the other regions such as the rRNA, tRNA, and NC regions. In the case of P. nana, a long NC region with low complexity corresponded to an AT-rich region (77.0%). 3.6. Mitogenome comparison In P. nana, the mitogenomic organization was highly rearranged, compared with those of typical mitogenomes of all arthropods, including 3 copepod species (Fig. 4). These rearrangements comprise both translocations of 6 PCGs and inversions of 6 PCGs and two rRNAs. In addition, the 23 tRNAs were severely rearranged, and did not show any particular patterns. Specifically, P. nana, the genus Tigriopus, and the fish parasite L. salmonis belong taxonomically to the order Copepoda; their mitogenomic organizations, however, are completely different. Moreover, by searching mitogenome databases, we were not able to find a similar pattern of mitogenomic gene arrangement among any eukaryote. To reveal relationships of copepod mitogenomes, we compared the P. nana mitogenome to that of other copepod species. In a preliminary analysis, we found a low DNA similarity among the compared species, indicating that P. nana PCGs would be highly divergent in genetic distance. In the present study, we compared the mt genes at the protein level. Table 4 represents low similarity scores obtained from P.

nana and three other copepods (L. salmonis, T. californicus, and T. japonicus). However, similarities of the CO1 gene were the highest (around 74%), followed by the Cyt b gene (around 55%). The others showed considerably low similarity scores of amino acids. The lowest (16.2%) was detected in the ND4L gene between P. nana and T. californicus. 4. Discussion 4.1. Mitogenome with genome walking technique The crustacean copepods are common inhabitants of marine and fresh waters, and are considered as the most numerically abundant groups (c.a. 11,500 species; Humes, 1994). However, to date only 4 mitogenomes of the copepods (e.g. one L. salmonis, one T. californicus, and two T. japonicus) have been published. As noted, the main reason for this might be that long-PCR is not practical. In the case of P. nana, long-PCR was partly applicable for the amplification of its mitogenome (see Materials and Methods), probably due to AT-rich areas (77.0% AT; Fig. 3) within the long NC region. In addition, we found many polyT (or A) tracts, more than 5 bp in the NC region, where they probably formed a stable hairpin structure that hinders the PCR amplification. By a genome walking PCR technique (Ki and Han, 2005), we successfully amplified the remaining mitogenome of P. nana. This kind of PCR walking approach, including long-PCR, is considered as one of alternative ways to get the complete mitogenome information from primitive types of animals, particularly in AT-rich or little known mitogenomes. Using the same tools, we have identified a linear mitogenome from 2 jellyfish species (unpublished data). 4.2. Mitogenome of copepod and general features The complete mitogenome of the cyclopoid copepod P. nana was sequenced which encoded for two rRNAs, 23 tRNAs, and 12 PCGs. The P. nana mitogenome is the first published genome from the free-living cyclopoids, while mitogenomes of 2 copepod groups (e.g. the harpacticoid Tigriopus and the siphonostomatoid L. salmonis) are available (Machida et al., 2002; Tjensvoll et al., 2005; Jung et al., 2006; Burton et al., 2007). The cyclopoid P. nana has atypical mitogenome structures: 12 PCGs, 23 tRNAs, AT-rich, and highly rearranged gene orders (Figs. 1 and 4). These observations are unusual in crustaceans, because most species have typical mt gene contents: 13-PCGs, 2 rRNA, 22 tRNA, and a NC region. 4.3. Absence of the ATPase 8 gene and presence of extra tRNAs The P. nana mitogenome contains 12 PCGs (ATPase 8 is absent) that are commonly found in animal mitogenomes. In order to find PCR errors that were possibly generated when amplifying the P. nana mitogenome, we investigated each PCR product that was amplified from the neighbouring individual intergenic spacers by PCR with adjacent PCG targeting primers (data not shown). However, we were not able to detect different sizes of fragments when comparing these with expected lengths of PCR products derived from the complete mitogenome. In addition, we examined all open reading frames (ORFs) using the ORF finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). This analysis predicted 3 ORFs from the long NC region (1351 bp), more than 30 amino acids in length. Among them, we could not identify an ATPase 8-like ORF both by comparison with other crustacean mitogenomes and by BLAST-P searches in the NCBI database. These data indicated that the P. nana mitogenome consists of 12-PCGs but lacks the ATPase 8 gene. One of possible reasons would be the short amino acid length of ATPase 8. Of the mt PCGs, ATPase 8 is the smallest protein, which is ∼ 60 amino acids in size. In addition, the ATPase 8 protein in other copepods is considerably shorter (e.g. 32 amino acids in T. californicus and T. japonicus). Furthermore, in the

J.-S. Ki et al. / Gene 435 (2009) 13–22

19

Fig. 4. Gene organization of the mitochondrial genomes of the cyclopoid copepod Paracyclopina nana, the harpacticoid copepods Tigriopus californicus, T. japonicus, the siphonostomatoid copepod L. salmonis, and other arthropods (Penaeus notialis, Drosophila yakuba, and Daphnia pulex). Protein-coding, rRNA and tRNA genes are transcribed from left to right except those indicated by an asterisk (⁎), which are transcribed from right to left. The tRNA genes are designated by uppercase-letter amino acid codes except those encoding leucine and serine, which are labeled L1 (tRNA-Leu[CUN]), L2 (tRNA-Leu[UUR]), S1 (tRNA-Ser[UCN]), and S2 (tRNA-Ser[AGN]). Thick lines between pairs of mitogenomes represent translocations and inversions, combined. Thin lines denote translocations, only. The gene order comparisons did not include tRNAs due to the high rearrangements of these genes.

case of L. salmonis, Tjensvoll et al. (2005) has missed to annotate ATPase 8 in GenBank (NC_007215). Furthermore, several other species were also supporting our findings that ATPase 8 is frequently absent in mitogenomes as demonstrated in the bivalve mollusk Mytilus edulis (Boore et al., 2004), the pacific oyster (Crassostrea gigas, AF177226), platyhelminthes (Le et al., 2000), the rotifer Brachionus plicatilis (Suga et al., 2008), and secernentean nematodes (Okimoto et al., 1992). In conclusion, ATPase 8 in the copepod mitogenomes is relatively short in size or even absent in the case of P. nana. In addition, the P. nana mitogenome has an extra number of tRNAs (23 tRNAs vs. the typical 22 tRNAs), as it consists of both typical 22 tRNAs and an extra tRNA-Ala. By structural and sequence comparisons, two tRNA-Ala genes in the P. nana mitogenome are perfectly identical, and were located continuously on the H-strand (Fig. 2). This suggests that the extra tRNA could be functional. Previously, Segawa and Aotsuka (2005) reported the presence of 3 functional tRNA-Leu genes in the Japanese freshwater crab, Geothelphusa dehaani (Crustacea: Brachyura). By searching 37 crustacean mitogenomes available in the database, we found that 3 mitogenomes have extra tRNAs, e.g. 23

tRNAs in G. dehaani (Segawa and Aotsuka, 2005), 23 tRNAs in Speleonectes tulumensis (Lavrov et al., 2004) and 24 tRNAs in Pollicipes polymerus (Lavrov et al., 2004). In contrast, there were 2 reports available indicating deficiencies of tRNAs in mitogenomes; e.g. 18 tRNAs in Shinkaia crosnieri (Yang and Yang, 2008) and 21 tRNAs in Ligia oceanica (Kilpert and Podsiadlowski, 2006). In addition, unusual numbers of tRNAs were found from the acranian chordate Branchiostoma lanceolatum (Spruyt et al., 1998), the black chiton, Katharina tunicata (Boore and Brown, 1994), and the blue mussel M. edulis (Hoffman et al., 1992). By comparing all copepod mitogenomes that are available, we could not find extra tRNAs in the coding mitogenomes. Considering the tRNA numbers, a difference of tRNAs among 37 crustacean mitogenomes was found in at least 13.5%, indicating that it is frequently found in mitogenomes of these taxa. 4.4. Replication origin (OL) in non-coding regions The P. nana mitogenome has three prominent non-coding regions (see Section 3.4). Each of them would be large enough to be a

20

J.-S. Ki et al. / Gene 435 (2009) 13–22

candidate for the control region that is responsible for initiating the replication of mtDNA. Other NC regions, ranging in size from 1 to 48 bp, are significantly shorter than expected for a control region that should have a length of 69 bp or more as Kilpert and Podsiadlowski (2006) suggested. Concerning the two prominent NC regions of the P. nana mitogenome, a short NC could function as a replication origin, as this contained structural base pairings (Kilpert and Podsiadlowski, 2006). However, mt replication in Crustacea and other taxa is as yet poorly understood, except in Drosophila where both origins of replication are located in the AT-rich region near a conserved stem– loop structure (Saito et al., 2005). In some arthropods, including the Crustacea, the AT-rich region is reported to have some or all of these four different motifs: tandemly repeated sequences, a long sequence of T's, a subregion of even higher AT-richness, and stem–loop structures (Zhang and Hewitt, 1996; Shao and Barker, 2003). In the present study, we did not identify certain motifs (e.g. replication origin, termination-associated sequence) from the long NC region of the P. nana mitogenome. In addition, we did not detect tandem repeat sequences with the Tandem Repeat Finder program (see Materials and Methods), while other copepods, like T. californicus and T. japonicus kept the repeated sequences within the long NC region (Burton et al., 2007). The long NC in the P. nana mitogenome was larger than those in T. californicus (697 bp, 56.2% AT), in T. japonicus #Japan isolate (582 bp, 56.2% AT), and in T. japonicus #Korean isolate (243 bp, 57.6% AT), while it was shorter than that in L. salmonis (1442 bp, 65.9% AT). These findings showed that the NC regions as a putative control region in copepods are considerably variable, even in the same species (e.g. T. japonicus). In addition, a comparison of aligned NC sequences showed none of the homologous regions among the five copepod NC regions (e.g. Burton et al., 2007; this study). 4.5. AT-rich of cyclopoid P. nana mitogenome The identified PCG sequences made up 10,911 nucleotides, which represent 68.3% of the total length of the mitogenome of P. nana. This was lower than those of other copepod mitogenomes (e.g. 75% in T. californicus, 70% in L. salmonis, 74% in T. japonicus). However, the percentage of the P. nana mt PCGs is generally similar to those of 37 crustacean species, that range from 60% (S. tulumensis, NC_005938) to 75% (T. californicus, NC_008831). In addition, the average value measured from 15 decapod mitogenomes was 69.1% (standard deviation, SD = 1.58), ranging from 61% (G. dehaani, NC_007379) to 73% (S. crosnieri, NC_011013). These observations suggest that the percentage of PCGs in mitogenomes is independent among crustacean lineages. On the other hand, the P. nana mitogenome contains 27 intergenic regions, including a long NC region, ranging between 2 and 113 bp (Table 2). They made up a total of 1836 bp (78.1% AT), i.e. 11.5% of the total length of the P. nana mitogenome. Of the intergenic sequences, a long NC region (1351 bp; 73.6% of all NC sequences) was found, and two short NC regions of 72 bp and 113 bp represented 3.9% and 6.2%, respectively. With regard to the AT content, P. nana has a AT-rich (70.9%) mitogenome when compared to 37 other available crustacean mitogenomes (average 67.8% AT, SD = 4.0). The lowest AT content in the crustaceans was recorded at 60.9% from L. oceanica (Isopoda, NC_008412), and the highest content (77.8%) was provided from Argulus americanus (Branchiura, NC_005935), respectively. Within the copepods, the P. nana mitogenome was considerably higher than those of other copepods (e.g. 61–66% AT). In addition, a long NC region of P. nana, designated as a control region tentatively, has a high AT composition (77.0%). Overall, the value in the NC region is both higher than the rest of the mitogenome (Fig. 3) and higher than the published copepod mitogenomes (56.2–65.9% in the AT-rich control regions). The mitogenome of the cyclopoid copepod P. nana, is AT-rich, particularly in the NC region, as it was found frequently in other crustaceans e.g. decapod and arthropod mitogenomes (at least 70%). This finding is in accordance with the general consideration that

arthropod mitogenomes have typically a long AT region in the NC region as compared to the coding regions (Cook, 2005). 4.6. Gene rearrangement as a novel structure Another peculiarity of the P. nana mitogenome is their highly rearranged mt genes (Fig. 4). In the case of P. nana, the mitogenome is heavily rearranged, compared to other arthropods (e.g. Drosophila yakuba and the crustacean cladoceran Daphnia magna — see Miller et al., 2005; Place et al., 2005; Sun et al., 2005). Regarding the gene rearrangement of the mitogenome, several mechanisms have been suggested. It is most reasonable to assume that the tandem duplication of gene regions is a result of slipped-strand mispairing, followed by the deletion of genes (Macey et al., 1997, Kumazawa et al., 1998). Previously, Sun et al., (2005) suggested a hypothetical mechanism of gene rearrangement in the Chinese mitten crab Eriocheir sinenesis. However, in the mt gene rearrangement of P. nana, this mechanism remains still unclear. It is likely that rearrangements in the P. nana mitogenome involved an inversion of the coding orientation (e.g. Machida et al., 2002). As Kilpert and Podsiadlowski (2006) showed for the rearrangement of other crustacean mt genes, certain gene clusters such as ND5-ND4L-ND4, srRNA-lrRNA, CO1–CO2 would be an ancestral gene order in the Crustacea (e.g. Crease, 1999; Davolos and Maclean, 2005). However, we did not find this kind of consistency in gene clusters from the P. nana mitogenome (Figs. 1 and 4), indicating that this would be an example of a novel gene organization from Crustacea. Also, this finding supports a previous suggestion that the rearrangements of the mt genes are relatively common events among crustaceans (Kilpert and Podsiadlowski, 2006). As mentioned, several studies attempted to use gene rearrangements in phylogenetic reconstructions (Boore et al., 1998; Rokas and Holland, 2000; Shao and Barker, 2003; Kilpert and Podsiadlowski, 2006). However, the phylogenetic use of mt gene rearrangements remained arbitrary as yet for the Crustacea. Although the mitogenomes of D. yakuba and Daphnia pulex are generally accepted to represent putative ancestral arthropod mitogenomic structures (Clary and Wolstenholme, 1985; Crease, 1999), a phylogenetic pattern of mt gene rearrangements has not been revealed, even though several crustaceans and arthropods have been investigated. Rearrangements of the mitogenome should be relatively rare events at evolutionary scale (Cook, 2005). Such rare events could provide useful characters for the understanding of arthropod evolution (Boore et al., 1998). However, the mt gene rearrangement phenomenon seem to occur frequently and independently in copepod mitogenomes and, therefore, possibly restricting its phylogenetic applications (Kilpert and Podsiadlowski, 2006). 4.7. High divergence of mt genes in copepods The gene order of the P. nana mitogenome and of other copepods, is probably derived from their distant taxonomic relationships within the copepod group and from highly divergent mitogenomes among copepods (Table 4). Inference from amino acid sequences of the protein-coding genes between P. nana with L. salmonis, T. californicus and T. japonicus, resulted in high levels of divergence (average 60.2%, SD = 16.2). At the extreme, the ND4L variation between P. nana and T. californicus was 83.8% amino acid substitutions, while in the CO1 gene, P. nana showed 25.9% difference with T. japonicus. This indicates that the CO1 gene is relatively conserved in evolutionary history among the 12 PCGs of the four studied copepod species. In contrast, other genes evolve rapidly. By comparing individual mt genes and their divergences, we correlated the degree of similarity against amino acid length. The relationship between similarity and amino acid length was not significant (one-factor ANOVA test: F = 2.954, df = 1, sum of squares = 528.369, p = 0.095), suggesting that gene length does not affect the amino acid substitution and that divergence is an independent event in the copepod mitogenome.

J.-S. Ki et al. / Gene 435 (2009) 13–22

In addition, the divergence at the level of conspecific species is extraordinarily high, even within populations (Jung et al., 2006; Burton et al., 2007). For example, populations of T. japonicus showed 22% nucleotide substitutions (4% amino acid substitutions) in the CO1 gene (Jung et al., 2006).Willett and Burton (2004) showed that in T. californicus populations both the uncorrected divergence at synonymous nucleotide sites at Cyt b and the inferred amino acid sequences exceeded 60% among the nucleotides and differed approximately 7% among the amino acids. In our study, CO1 and Cyt b showed a high similarity level when compared to those of the other species. However, excluding these two genes, P. nana mt genes showed considerably low similarity scores (less than 50%) compared to those of other crustaceans, including other copepods (Table 4). These findings imply that copepod mitogenomes are very divergent among the crustacean lineages over evolutionary times. Moreover, this high divergence level suggests that they exhibit saturated mutation rates. Evolutionary divergence is expected to be higher at between more distantly related copepods compared to the closely related species (Burton et al., 2007). A high divergence would affect frequencies of gene translocations in copepod mitogenomes (Fig. 4). This supports the notion that gene rearrangements would frequently occur as a general feature of copepod mitogenomes. They would occur independently over evolutionary time scales in certain taxa rather than display similar patterns of gene order for a larger group of taxa. Acknowledgements We thank Drs. Nick Schizas and Hans-U. Dahms for their comments on the revised manuscript. Also we thank two anonymous reviewers for their constructive comments. This work was supported by a grant from the Korea Research Foundation funded to Heum Gi Park (2006; C00699). In addition, Jang-Seu Ki was a recipient of a post-doctoral fellowship funded by the Korea Research Foundation Grant (KRF2007-355-C00059). References Boore, J.L., Brown, W.M., 1994. Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicata. Genetics 138, 423–443. Boore, J.L., Brown, W.M., 2000. Mitochondrial genomes of Galathealinum, Helobdella, and Platynereis: sequence and gene arrangement comparisons indicate that Pogonophora is not a phylum and Annelida and Arthropoda are not sister taxa. Mol. Biol. Evol. 17, 87–106. Boore, J.L., Lavrov, D.V., Brown, W.M., 1998. Gene translocation links insects and crustaceans. Nature 392, 667–668. Boore, J.L., Medina, M., Rosenberg, L.A., 2004. Complete sequences of the highly rearranged Molluscan mitochondrial genomes of the Scaphopod Graptacme eborea and the Bivalve Mytilus edulis. Mol. Biol. Evol. 21, 1492–1503. Braga, E., Zardoya, R., Meyer, A., Yen, J., 1999. Mitochondrial and nuclear rRNA based copepod phylogeny with emphasis on the Euchaetidae (Calanoida). Mar. Biol. 133, 79–90. Bucklin, A., Frost, B.W., Bradford-Grieve, J., Allen, L.D., Copley, N.J., 2003. Molecular systematic and phylogenetic assessment of 34 calanoid copepod species of the Calanidae and Clausocalanidae. Mar. Biol. 142, 333–343. Burton, R.S., Byrne, R.J., Rawson, P.D., 2007. Three divergent mitochondrial genomes from California populations of the copepod Tigriopus californicus. Gene 403, 53–95. Chang, Y.-C., Hunag, F.-L., Lo, T.-B., 1994. The complete nucleotide sequence and gene organization of carp (Cyprinus carpio) mitochondrial genome. J. Mol. Evol. 38, 138–155. Clary, D.O., Wolstenholme, D.R., 1985. The mitochondrial DNA molecule of Drosophila yakuba: nucleotide sequence, gene organization, and genetic code. J. Mol. Evol. 22, 252–271. Cook, C.E., 2005. The complete mitochondrial genome of the stomatopod crustacean Squilla mantis. BMC Genomics 6, 105. Crease, T.J., 1999. The complete sequence of the mitochondrial genome of Daphnia pulex (Cladocera: Crustacea). Gene 233, 89–99. Curole, A.P., Kocher, T.D., 1999. Mitogenomics: digging deeper with complete mitochondrial genomes. Trends Ecol. Evol. 14, 394–398. Davolos, D., Maclean, N., 2005. Mitochondrial COI-NC-COII sequences in talitrid amphipods (Crustacea). Heredity 94, 81–86. Folmer, O., Black, M., Hoeh, W., Lutz, R., Vrijenhoek, R., 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 3, 294–297. Grande, C., Templado, J., Zardoya, R., 2008. Evolution of gastropod mitochondrial genome arrangements. BMC Evol. Biol. 8, 61.

21

Hoffman, R.J., Boore, J.L., Brown, W.M., 1992. A novel mitochondrial genome organization for the blue mussel Mytilus edulis. Genetics 131, 397–412. Humes, A.G., 1994. How many copepods? Hydrobiologia 292/293, 1–7. Huys, R., Llewellyn-Hughes, J., Conroy-Dalton, S., Olson, P.D., Spinks, J.N., Johnston, D.A., 2007. Extraordinary host switching in siphonostomatoid copepods and the demise of the Monstrilloida: integrating molecular data, ontogeny and antennulary morphology. Mol. Phylogenet. Evol. 43, 368–378. Huys, R., Llewellyn-Hughes, J., Olson, P.D., Nagasawa, K., 2006. Small subunit rDNA and Bayesian inference reveal Pectenophilus ornatus (Copepoda incertae sedis) as highly transformed Mytilicolidae, and support assignment of Chondracanthidae and Xarifiidae to Lichomolgoidea (Cyclopoida). Biol. J. Linn. Soc. 87, 403–425. Jung, S.-O., Lee, Y.-M., Park, T.-J., Park, H.G., Hagiwara, A., Leung, K.M.Y., Dahms, H.-U., Lee, W., Lee, J.-S., 2006. The complete mitochondrial genome of the intertidal copepod Tigriopus sp. (Copepoda, Harpacticidae) from Korea and phylogenetic considerations. J. Exp. Mar. Biol. Ecol. 333, 251–262. Ki, J.-S., Han, M.-S., 2005. Efficient 5′ ETS walking from conserved 18S rDNA sequences of dinoflagellates Alexandrium and Akashiwo sanguinea (Dinophyceae). J. Appl. Phycol. 17, 475–481. Kilpert, F., Podsiadlowski, L., 2006. The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda) bears a novel gene order and unusual control region features. BMC Genomics 7, 241. Kim, I.-C., Kweon, H.-S., Kim, Y.J., Kim, C.-B., Gye, M.C., Lee, W.-O., Lee, Y.-S., Lee, J.-S., 2004. The complete mitochondrial genome of the javeline goby Acanthogobius hasta (Perciformes, Gobiidae) and phylogenetic considerations. Gene 336, 147–153. Kumazawa, Y., Ota, H., Nishida, M., Ozawa, T., 1998. The complete nucleotide sequence of a snake (Dinodon semicarinatus) mitochondrial genome with two identical control regions. Genetics 150, 313–329. Lavrov, D.V., Brown, W.M., Boore, J.L., 2004. Phylogenetic position of the Pentastomida and (pan)crustacean relationships. Proc. Biol. Sci. 271, 537–544. Le, T.H., Blair, D., Agatsuma, T., Humair, P.F., Campbell, N.J., Iwagami, M., Littlewood, D.T., Peacock, B., Johnston, D.A., Bartley, J., Rollinson, D., Herniou, E.A., Zarlenga, D.S., McManus, D.P., 2000. Phylogenies inferred from mitochondrial gene orders—a cautionary tale from the parasitic flatworms. Mol. Biol. Evol. 17, 1123–1125. Lee, K.-W., Park, H.G., Lee, S.M., Kang, H.K., 2006. Effects of diets on the growth of the brackish water cyclopoid copepod Paracyclopina nana Smirnov. Aquaculture 256, 346–353. Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 955–964. Lunt, D.H., Whipple, L.E., Hyman, B.C., 1998. Mitochondrial DNA variable number tandem repeats (VNTRs): utility and problems in molecular ecology. Mol. Ecol. 7, 1441–1455. Macey, J.R., Larson, A., Ananjeva, N.B., Fang, Z., Papenfuss, T.J., 1997. Two novel gene orders and the role of light-strand replication in the rearrangement of the vertebrate mitochondrial genome. Mol. Biol. Evol. 14, 91–104. Machida, R.J., Miya, M.U., Nishida, M., Nishida, S., 2002. Complete mitochondrial DNA sequence of Tigriopus japonicus (Crustacea: Copepoda). Mar. Biotechnol. 4, 406–417. Machida, R.J., Miya, M.U., Nishida, M., Nishida, S., 2004. Large-scale gene rearrangements in the mitochondrial genomes of two calanoid copepods Eucalanus bungii and Neocalanus cristatus (Crustacea), with notes on new versatile primers for the srRNA and COI genes. Gene 332, 71–78. Miller, A.D., Murphy, N.P., Burridge, C.P., Austin, C.M., 2005. Complete mitochondrial DNA sequences of the decapod crustaceans Pseudocarcinus gigas (Menippidae) and Macrobrachium rosenbergii (Palaemonidae). Mar. Biotechnol. 7, 339–349. Okimoto, R., Macfarlane, J.L., Clary, D.O., Wolstenholme, D.R., 1992. The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum. Genetics 130, 471–498. Pinto, C.S.C., Souza-Santos, L.P., Santos, P.J.P., 2001. Development and population dynamics of Tisbe biminiensis (Copepoda: Harpacticoida) reared on different diets. Aquaculture 198, 253–267. Place, A.R., Feng, X., Steven, C.R., Fourcade, H.M., Boore, J.L., 2005. Genetic markers in blue crabs (Callinectes sapidus). II. Complete mitochondrial genome sequence and characterization of genetic variation. J. Exp. Mar. Biol. Ecol. 319, 15–27. Rokas, A., Holland, P.W.H., 2000. Rare genomic changes as a tool for phylogenetics. Trends Evol. Ecol. 15, 454–459. Saccone, S., Giorgi, C.D., Gissi, C., 1999. Evolutionary genomics in Metazoa: the mitochondrial DNA as a model system. Gene 238, 195–209. Saito, S., Tamura, K., Aotsuka, T., 2005. Replication origin of mitochondrial DNA in insects. Genetics 171, 1695–1705. Segawa, R.D., Aotsuka, T., 2005. The mitochondrial genome of the Japanese freshwater crab, Geothelphusa dehaani (Crustacea: Brachyura): evidence for its evolution via gene duplication. Gene 355, 28–39. Serb, J.M., Lydeard, C., 2003. Complete mtDNA sequence of the North American freshwater mussel, Lampsilis ornata (Unionidae): an examination of the evolution and phylogenetic utility of mitochondrial genome organization in Bivalvia (Mollusca). Mol. Biol. Evol. 20, 1854–1866. Shadel, G.S., Clayton, D.A., 1997. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 66, 409–435. Shao, R., Barker, S.C., 2003. The highly rearranged mitochondrial genome of the plague thrips, Thrips imaginis (Insecta: Thysanoptera): convergence of two novel gene boundaries and an extraordinary arrangement of rRNA genes. Mol. Biol. Evol. 20, 362–370. Spruyt, N., Delarbre, C., Gachelin, G., Laudet, V., 1998. Complete sequence of the amphioxus (Branchiostoma lanceolatum) mitochondrial genome: relations to vertebrates. Nucleic Acids Res. 26, 3279–3285. Suga, K., Mark Welch, D.B., Tanaka, Y., Sakakura, Y., Hagiwara, A., 2008. Two circular chromosomes of unequal copy number make up the mitochondrial genome of the rotifer Brachionus plicatilis. Mol. Biol. Evol. 25, 1129–1137.

22

J.-S. Ki et al. / Gene 435 (2009) 13–22

Sun, H., Zhou, K., Song, D., 2005. Mitochondrial genome of the Chinese mitten crab Eriocheir japonica sinensis (Brachyura: Thoracotremata: Grapsoidea) reveals a novel gene order and two target regions of gene rearrangements. Gene 349, 207–217. Sun, B., Fleeger, J.W., 1995. Sustained mass culture of Amphiascoides atopus a marine harpacticoid copepod in a recirculating system. Aquaculture 136, 313–321. Tjensvoll, K., Hodneland, K., Nilsen, F., Nylund, A., 2005. Genetic characterization of the mitochondrial DNA from Lepeophtheirus salmonis (Crustacea; Copepoda). A new gene organization revealed. Gene 353, 218–230. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X window interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24, 4876–4882.

Wilkinson, G.S., Chapman, A.M., 1991. Length and sequence variation in evening bat Dloop mtDNA. Genetics 128, 607–617. Willett, C.S., Burton, R.S., 2004. Evolution of interacting proteins in the mitochondrial electron transport system in a marine copepod. Mol. Biol. Evol. 21, 443–453. Yang, J.S., Yang, W.J., 2008. The complete mitochondrial genome sequence of the hydrothermal vent galatheid crab Shinkaia crosnieri (Crustacea: Decapoda: Anomura): a novel arrangement and incomplete tRNA suite. BMC Genomics 9, 257. Zhang, D.X., Hewitt, G.M., 1996. Nuclear integrations: challenges for mitochondrial DNA markers. Trends Ecol. Evol. 11, 247–251. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.