The differential and interactive effects of arbuscular mycorrhizal fungus and phosphorus on the lateral root formation in Poncirus trifoliata (L.)

The differential and interactive effects of arbuscular mycorrhizal fungus and phosphorus on the lateral root formation in Poncirus trifoliata (L.)

Scientia Horticulturae 217 (2017) 258–265 Contents lists available at ScienceDirect Scientia Horticulturae journal homepage: www.elsevier.com/locate...

1MB Sizes 0 Downloads 29 Views

Scientia Horticulturae 217 (2017) 258–265

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

The differential and interactive effects of arbuscular mycorrhizal fungus and phosphorus on the lateral root formation in Poncirus trifoliata (L.) Weili Chen a , Juan Li c , Honghui Zhu b , Pengyang Xu a , Jiezhong Chen a , Qing Yao a,b,∗ a College of Horticulture, South China Agricultural University, Guangdong Engineering Research Center for Litchi, Guangdong Province Key Laboratory of Microbial Signals and Disease Control, Guangzhou, 510642, China b Guangdong Institute of Microbiology, Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangdong Open Laboratory of Applied Microbiology, State Key Laboratory of Applied Microbiology (Ministry-Guangdong Province Jointly Breeding Base) South China, Guangzhou, 510070, China c Zhongkai University of Agriculture and Engineering, Guangzhou, 510225, China

a r t i c l e

i n f o

Article history: Received 19 September 2016 Received in revised form 2 February 2017 Accepted 3 February 2017 Keywords: Arbuscular mycorrhizal fungus P level Trifoliate orange Lateral root formation Auxin signaling

a b s t r a c t Both arbuscular mycorrhizal fungi (AMF) and phosphorus (P) can regulate the lateral root (LR) formation of plants; however, the differences in their regulation and whether auxin is involved in the regulation are less understood, especially for woody plants. In this study, trifoliate orange (Poncirus trifoliata (L.) Raf) plants were inoculated with AMF strain, Rhizophagus irregularis BGC JX04B, under two P levels in pot culture. The influences of AMF and P level on LR formation were investigated, and the expression of LR- and auxin-related genes were quantified. Results showed that the mycorrhizal colonization at low P level was higher than that at high P level. AMF increased shoot biomass and decreased R/S ratio. The numbers of 1st and 2nd LR were significantly increased by AMF, while high P level only increased 2nd LR number. Variation partitioning analysis indicates that AMF was more effective than P level in regulating LR formation. At 2 MAT (month after transplanting), AMF significantly increased the expression of PSK6 and RSI-1, and high P level significantly increased the expression of KRP6. At 4 MAT, AMF significantly increased the expression of PSK6, but decreased the expression of KRP6. High P level significantly inhibited the expression of NAC1, while AMF increased the expression of NAC1 at low P level at 2 MAT, promoting the LR formation. AMF also significantly increased the expression of NAC1 at 4 MAT. Besides, the development of 1st and 2nd LR presented a positively significantly relation with the expression of PSK6 and NAC1, and 2nd LR also with the expression of TIR1. Taken together, these data suggest that AMF and P level differentially affect the LR formation in P. trifoliata via auxin signaling. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Root system plays a crucial role in plant growth and development, not only functioning as the major absorptive organ for mineral nutrients and water from soil, but also responsible for supporting the aerial part (Bailey et al., 2002). The distribution of root system in soil volume is well characterized as root system architecture (RSA), referring to the spatial configuration of the root system (Lynch, 1995). Plant RSA is pivotal for improving the nutrient and water use efficiency of the root system (Heppell et al., 2015), and for

∗ Corresponding author at: College of Horticulture, South China Agricultural University, No. 483 Wushan Street, Tianhe District, Guangzhou, 510642, China. E-mail address: [email protected] (Q. Yao). http://dx.doi.org/10.1016/j.scienta.2017.02.008 0304-4238/© 2017 Elsevier B.V. All rights reserved.

affecting the construction of stable ecological community as well (Bardgett et al., 2014). Furthermore, it is also involved in maintaining soil and plant disease resistance (Cichy et al., 2007; Qu et al., 2011). In this context, the study of plant RSA shows important significance in plant growth, development and ecological stability. Among several components of plant RSA, lateral roots (LRs) are the most important (Nibau et al., 2008), and have been attracting tremendous focus in the past decade (Ivanchenko et al., 2010; Vilches-Barro and Maizel, 2015; Tatematsu et al., 2004; Zeng et al., 2010; Li et al., 2012; Zhao et al., 2015). LRs are formed postembryonically by LR primordium (LRP) derived from specific cells of pericycle, an internal tissue surrounding the central vascular cylinder (Vilches-Barro and Maizel, 2015). It is well established that plant phytohormones (i.e. auxin) are the key factors regulating LR formation (Martínez-de La Cruz et al.,

W. Chen et al. / Scientia Horticulturae 217 (2017) 258–265

2015), and so far, much information on it has been accumulating with both morphological and molecular evidence. Plant transcription factor NAC1 activated by auxin receptor TIR1 positively affect the LR formation (Xie et al., 2002), and the regulation on LR formation is dependent on auxin signal transduction members, Aux/IAA and ARF (Tatematsu et al., 2004). Besides, auxin transport carrier AUX1 enhances the transport of auxin in phloem, contributing to the LR formation (Marchant et al., 2002). Moreover, LR formation can be modified by diverse edaphic factors, e.g. soil nutrient and water. Low phosphorus (P) can induce the LR formation in Arabidopsis (Niu et al., 2013) and increase LR length and number in tomato (Xu et al., 2010), but the contrasting result was reported for maize (Li et al., 2012), indicating the differential responses of LR formation to low P among plant species. In addition, rhizosphere microorganisms also impact LR formation, and in particular, the regulation of LR formation by arbuscular mycorrhizal fungi (AMF) has been attracting tremendous focus recently. AMF have an alldimensional impact on RSA, including root biomass, root length, root diameter, root surface area, root volume, root branch, root growth angle and the formation of LR and adventitious root (Cruz et al., 2004; Gutjahr et al., 2009; Yao et al., 2009), with their effects on LR the most important (Fusconi, 2014; Padilla and Encina, 2005; Tian et al., 2014; Schellenbaum et al., 1991). However, the knowledge on how auxin is involved in the modification of LR formation by AMF and P is very limited, especially for woody species, e.g. citrus plants. There are several genes proposed to indicate LR formation. Taylor and Scheuring (1994) found that RSI-1 in tomato roots was activated at the early stage of LR primordium formation, manifesting that this gene could be used as a molecular marker of LR development. Phytosulfokines (PSKs), a peptide growth factor in plant, affect cell proliferation and differentiation and appear to play a role in the formation of adventitious roots (Lorbiecke et al., 2005; ´ Mackowska et al., 2014), for instance, the number of roots increased 2- to 2.5-fold after treatment with PSK in cucumber (Yamakawa et al., 1998). Otherwise, the expression of KRP1 leads to the decrease of LR number in Arabidopsis (Ren et al., 2008). Clearly, these genes are potential candidates indicative of LR formation, and are referred to as LR-related genes hereafter. Several reports demonstrated the modification of trifoliate orange (Poncirus trifoliata (L.) Raf) RSA by AMF (Wu et al., 2012; Yao et al., 2009), however, little information is available on the effect of AMF on LR formation and its molecular mechanism (in particular the expression of auxin responsive genes) in this species. Recently, we found that AMF and P affected LR formation in different patterns in tomato (Jiang et al., 2015), but without any molecular evidence. In this study, P. trifoliata seedlings were inoculated with AMF at two P levels in pot culture. The LR formation was characterized and the expression of LR- and auxin-related genes were monitored. We aimed to elucidate 1) how AMF and P regulate the LR formation in P. trifoliate, 2) how the auxin-related genes are involved in the regulation, and additionally, 3) the difference and interaction in the regulating patterns between AMF and P are also discussed.

2. Materials and methods 2.1. Biological material Trifoliate orange (Poncirus trifoliata (L.) Raf) and Rhizophagus irregularis BGC JX04 B (formerly known as Glomus intraradices) were used as host plant and AMF, respectively, to establish symbiosis in pot culture. P. trifoliata seeds were commercially obtained and R. irregularis was provided by Beijing Academy of Agriculture and Forestry Sciences. Fungal inocula were propagated with clover (Trifolium repense L.) and sorghum (Sorghum bicolor) as hosts for four

259

months in greenhouse. At harvest, the spore density was quantified to be 49 spores per gram inoculum. 2.2. Experimental design The experiment was a 2 × 2factorial design with two inoculation level (non-mycorrhizal and mycorrhizal) and two P levels (low P and high P), totally producing 4 treatments: low P and nonmycorrhizal (LP-NM), low P and mycorrhizal (LP-M), high P and non-mycorrhizal (HP-NM), and high P and mycorrhizal (HP-M). Each treatment comprised of 10 replicates. The pot substrate was the mixture of red soil, river sand and peat (1:1:1, v/v/v), with all autoclaved (121 ◦ C, 2 h). The soils were collected from the experimental orchard of South China Agricultural University, and the soil chemical properties were determined as follows: pH 4.60, organic matter content 1.58%, available N 65.0 mg kg−1 , available P 20.5 mg kg−1 , and available K 57.1 mg kg−1 . The substrate was additionally applied with 200 mg·kg−1 N (NH4 NO3 ), 100 mg·kg−1 K (KNO3 ), and 20 (LP) or 50 (HP) mg·kg−1 P (KH2 PO4 ). Each pot was filled with 630 g substrate and 70 g AMF inocula (for mycorrhizal treatments) or sterilized inocula (for non-mycorrhizal treatments). Seeds were surface-sterilized with 70% ethanol for 15 min, rinsed in distilled water several times, and then germinated in sterilized peat at 28 ◦ C in dark. After 4 weeks of growth, seedlings with five leaves and similar vigor were selected and transplanted to pots, with one seedling to each pot. All 40 pots grown with P. trifoliata seedlings were placed in a greenhouse, with temperature at 22 ◦ C–30 ◦ C and relative humidity at 60%–80%. Plants were harvested at 2 and 4 months after transplanting (MAT). At each harvest, 5 pots were randomly selected for each treatment. 2.3. Measurement of plant biomass, quantification of LR and root colonization At harvest, each plant was separated into shoot and root, and the respective fresh weight was recorded. During the whole experimental course, the 1st order LR and the 2nd order LR were observed (referred to as 1st LR and 2nd LR, respectively), but the 3th order LR did not appear. The numbers of 1st and 2nd LR were counted. Then roots were cut into fragments of ∼1 cm length and randomly divided into two aliquots for later analysis. One aliquot (about 100 fragments) was taken for the measurement of mycorrhizal colonization. Root fragments were stained with 0.1% trypan blue (Phillips and Hayman, 1970) and mycorrhizal colonization was measured according to Giovannetti and Mosse (1980). 2.4. The qRT-PCR of LR- and auxin-related genes The quantitative real time PCR (qRT-PCR) was performed to quantify the expression of LR- and auxin-related genes. The total RNA in roots (0.2 g) was extracted using Quick Isolation Kit (Huayueyang Biotech Co. Ltd, Beijing) according to the manufacturer’s protocol. With the extracted RNA as template, cDNA was synthesized using iScriptTM cDNA Synthesis Kit (Bio-Rad, USA). The expression of LR-related genes (PSK6, KRP6, RSI-1) and auxin-related genes (NAC1, ARF1, ARF18, TIR1, AUX2) in roots were quantified, with 18S rRNA gene as internal reference (Yan et al., 2012). The sequence of each primer was designed using Batchprimer3 (http://probes.pw.usda.gov/batchprimer3/) (shown in Table 1) and the specificity was checked using Blasting Tool of NCBI. Primer sets were synthesized by Shanghai Sangon BioTech Co. PCR was conducted with iTaqTM Universal SYBR Green Supermix Kit (Bio-Rad, USA) using CFX96 Real-Time System. The volume of aach reaction mixture was 20 ␮l, containing 5 ␮l diluted cDNA

260

W. Chen et al. / Scientia Horticulturae 217 (2017) 258–265

Table 1 Primers of quantitative real time PCR (qRT-PCR). Gene

Accession number

Sequence of primer(5 -3 )

Product size (bp)

18SrRNA

FJ356261.1

120

TIR1

Cs5g32500.1

NAC1

FJ619349.1

RSI-1

Cs6g17190

PSK6

CsiDB2011 11

KRP6

CsiDB2011 11

AUX2

XM 006480924.1

ARF1

NM 001288860.1

ARF18

XM 006481402.1

F: TCGGGTGTTTTCACGTCTCA R: CGAAGGGTCGCCGTAGGT F: TGTTTTCGTTCGTTCAGTCG R: CGAGGACTCACTGCGTAACA F: AATCTCCCCTGCCTCAATTT R: TGGATTGGTCTTGCATCAAA F: GCTCCGGTCATCAGGTAATT R: CCGAACACCGATAAGAACA F: GTGCTTTTCTCCTCCTCATC R: CAGGCTCATAGCTGAAACATG F: AGGATCAGACCTCAATGGACAA R: CAAACGGAGGACTTACTTCTCA F: CGACCGATTGGATAAAAGGA R: AGGCCAAGAAAGGACCAAAT F: GACGAATTGATTGCCGAACT R: CCAACAAGCATCATGTCACC F: GTCGGACCTCCACCTCAATA R: TGCTTGGCTTCTGAAGGATT

template, 1 ␮l 250 nmol·L−1 of forward and backward primer, 10 ␮l SYBR Green supermix and 4 ␮l sterilized ddH2 O. The two-step qRTPCR was run as follows: 95 ◦ C for 30 s, 39 cycles of 95 ◦ C for 5 s and 60 ◦ C for 30 s in 96-well plates (Bio-Rad, USA). All samples were amplified in triplicate from the same RNA preparation and the mean values were taken for data analysis. The relative expression of each target gene was calculated by using 2−Ct method (Livak and Schmittgen, 2001).

2.5. Data analysis and statistics All data were the average of 5 replicates. Multiple range test, two-way analysis of variance (ANOVA) and relationship analysis were performed using IBM SPSS v.21 statistical software (SPSS Inc., Chicago, IL). To quantify the contributions of AMF and P level to LR formation in P. trifoliate, we performed variation partitioning based on redundancy analysis. Variation partitioning analysis (Peres-Neto et al., 2006) of two explanatory variables was conducted using ‘varpart’ function in R vegan package (Oksanen et al., 2016), and the generated fractions (appeared as percentage) of variation were explained by different variables with or without covariable. Normally, the explanatory variable (AMF or P level herein) with higher percentage contributes more greatly to the response variable (LR formation herein) than the other explanatory variable with lower percentage (Peres-Neto et al., 2006).

3. Results 3.1. Plant growth as affected by AMF and P level No mycorrhizal colonization was observed in the noninoculated roots. For mycorrhizal plants, high P level significantly inhibited the mycorrhizal colonization at both 2 (P = 0.025) and 4 MAT (P = 0.000) (Table 2). AMF significantly increased the shoot biomass at 2 (P = 0.001) and 4 MAT (P = 0.000), while high P level significantly increased it only at 4 MAT (P = 0.006), indicating the earlier promotive effect of AMF on shoot biomass than high P level (Table 2). In contrast, root biomass was not affected except that high P level significantly (P = 0.005) increased it at 2 MAT. It is notable that the promotive effect of AMF on plant biomass was greater at low P level than at high P level. Moreover, AMF significantly decreased the R/S, while high P level did not (Table 2).

127 125 167 120 170 108 116 119

3.2. Differential effects of AMF and P level on LR formation and their respective contributions AMF significantly increased the numbers of 1st LR and 2nd LR at both 2 MAT and 4 MAT, however, P level only significantly increased the number of 2nd LR (Table 3). These results indicate that there existed a difference between the regulation of AMF and P level on LR formation, at least the formation of 1st LR, and that AMF exerted a greater impact on LR formation than P level. Variation partitioning analysis showed that AMF (24.82% fraction) showed greater effect than P level (8.37% fraction) on the LR formation (Table 4). Due to the inhibition of AMF colonization by high P level (a negative interaction), their shared fraction was negative (-12.03% fraction), and their total fraction was 45.22%. If the covariable is not considered, the fractions explained by AMF and P level were 36.85% and 20.40%, respectively (Table 4). 3.3. The expression of LR- and auxin-related genes as affected by AMF and P level The qRT-PCR analysis indicate that P level did not affect the expression of PSK6, KRP6, or RSI-1, while AMF showed significant influence on them (Table 5). In detail, AMF significantly increased the expression of KSP6 at both 2 MAT and 4 MAT (P = 0.015 and P = 0.031). Moreover, AMF significantly increased the expression of RSI-1 at 2 MAT (P = 0.035). In contrast, AMF significantly decreased the expression of KRP6 at 4 MAT (P = 0.035) (Fig. 1, Table 5). The molecular evidence is well in accordance with the morphological evidence, and also suggests that the enhanced expression of PSK6 and RSI-1, and the reduced expression of KRP6 can be indicative of increased LR formation in P. trifoliate. The qRT-PCR analysis of the auxin-related genes showed that only the expression of NAC1 was significantly affected by AMF and/or P level, while the expression of ARF1, ARF18, AUX2, TIR1 were not affected (Fig. 2, Table 6). For NAC1, high P level significantly suppressed its expression at 2 MAT (P = 0.011), while AMF significantly enhanced its expression at 4 MAT (P = 0.002). AMF also enhanced its expression at low P level at 2 MAT. These data suggest that transcript factor NAC1 seems involved in the regulation of LR formation by AMF and P level in P. trifoliate. 3.4. The relations between LR formation and LR-, aunxin-related genes As showed in Table 7, there was no significant relation between LR formation and related genes at 2 MAT, however, significant rela-

W. Chen et al. / Scientia Horticulturae 217 (2017) 258–265

261

Table 2 Influence of AMF and P levels on the growth of trifoliate orange. MAT: months after transplanting, R/S: root biomass/shoot biomass, P: phosphorus level, M: AMF inoculation; Different letters mean significant difference between the treatments (Duncan’s multiple range test, P = 0.05) and P values below 0.05 are highlighted in bold. Treatment

LP-NM LP-M HP-NM HP-M

2 MAT

4 MAT

Colonization (%)

Shoot FW (g)

Root FW (g)

R/S

Colonization (%)

Shoot FW (g)

Root FW (g)

R/S

0.00 ± 0.00c 22.50 ± 1.44a 0.00 ± 0.00c 16.89 ± 1.67b

0.41 ± 0.01c 0.53 ± 0.03a 0.47 ± 0.02b 0.51 ± 0.02ab

0.30 ± 0.01c 0.34 ± 0.01b 0.39 ± 0.01a 0.33 ± 0.02ab

0.72 ± 0.03ab 0.65 ± 0.04b 0.83 ± 0.05a 0.66 ± 0.04b

0.00 ± 0.00c 32.94 ± 0.91a 0.00 ± 0.00c 17.87 ± 1.02b

0.55 ± 0.04c 0.71 ± 0.04b 0.63 ± 0.03bc 0.90 ± 0.05a

0.43 ± 0.05b 0.43 ± 0.02b 0.44 ± 0.01b 0.55 ± 0.04a

0.77 ± 0.05a 0.60 ± 0.02b 0.70 ± 0.02ab 0.61 ± 0.02b

0.311 0.001 0.038

0.005 0.674 0.001

0.174 0.019 0.274

0.000 0.000 0.000

0.006 0.000 0.164

0.083 0.133 0.151

0.299 0.003 0.237

Two-way ANOVA (P value) 0.025 P 0.000 M 0.025 P×M

Fig. 1. The effects of AMF and P level on the relative expression of LR-related genes. LP-NM: low P and non-mycorrhizal; LP-M: low P and mycorrhizal; HP-NM: high P and non-mycorrhizal; HP-M: high P and mycorrhizal. MAT: months after transplanting. Bars with the same letter are not significantly different (Duncan’s multiple range test, P = 0.05).

Table 3 Influence of AMF and P levels on the lateral root growth of trifoliate orange seedlings. MAT: months after transplanting, LR: lateral root, P: P level, M: AMF inoculation; Different letters mean significant difference between the treatments (Duncan’s multiple range test, P = 0.05) and P values below 0.05 are highlighted in bold. Treatment

LP-NM LP-M HP-NM HP-M

2 MAT

4 MAT

1st LR No.

2nd LR No.

1st LR No.

2nd LR No.

9.00 ± 0.89c 14.33 ± 0.88b 9.67 ± 1.45c 18.75 ± 1.38a

6.20 ± 0.66b 14.67 ± 1.45ab 13.00 ± 1.53b 16.50 ± 1.55a

12.00 ± 0.00b 20.00 ± 3.06a 14.00 ± 1.15a 25.00 ± 4.36a

12.33 ± 3.38b 22.67 ± 2.85b 18.00 ± 0.58b 36.00 ± 6.66a

0.006 0.001 0.078

0.235 0.008 0.597

0.045 0.008 0.367

Two-way ANOVA (P value) P 0.061 0.000 M 0.067 P×M

tion was observed between them at 4 MAT. The 1st LR number shows a significant and positive relationship with the expression of PSK6 (P < 0.01) and NAC1 (P < 0.05), and the 2nd LR number

Table 4 Variation partitioning based on redundancy analysis to explain the effects of explanatory variables (AM colonization and P level) on the lateral root number of Poncirus trifoliata seedlings. All fractions (shown as percentages) explained were significant (P < 0.05). Response variable: Lateral root number

df

Fraction explained (%)

Explanatory variables AMF fraction (with covariable P level) P level fraction (with covariable AM colonization) Total fraction Shared fraction Residuals AMF fraction (without covariable) P level fraction (without covariable)

1 1 2 0 – 1 1

24.82 8.37 45.22 −12.03 54.79 36.85 20.40

shows a significant and positive relation with the expression of PSK6 (P < 0.05), NAC1 (P < 0.05) and TIR1 (P < 0.05) (Table 7). Taken together, these data indicate that PSK6, NAC1, and TIR1 probably play a vital role in the LR formation in P. trifoliate.

262

W. Chen et al. / Scientia Horticulturae 217 (2017) 258–265

Fig. 2. The effects of AMF and P level on the relative expression of auxin-related genes. LP-NM: low P and non-mycorrhizal; LP-M: low P and mycorrhizal; HP-NM: high P and non-mycorrhizal; HP-M: high P and mycorrhizal. MAT: months after transplanting. Bars with the same letter are not significantly different (Duncan’s multiple range test, P = 0.05).

Table 5 Two-way ANOVA (P value) for the expression of LR formation-related genes in roots. MAT: months after transplanting, LR: lateral root, P: P level, M: AMF inoculation. Note: P values below 0.05 are highlighted in bold. Variation source

P M P×M

2 MAT

4 MAT

PSK6

KRP6

RSI-1

PSK6

KRP6

RSI-1

0.545 0.015 0.697

0.109 0.352 0.369

0.219 0.035 0.705

0.921 0.031 0.317

0.994 0.032 0.547

0.864 0.110 0.885

4. Discussion Citrus plants are typical of sparse root hair, and thus highly dependent on the formation of mycorrhiza with AMF for the uptake of nutrients, especially P (Antunes and Cardoso, 1991; Peng et al., 1993). When both AMF and P can affect the LR formation in many annual species (Olah et al., 2005; Ronco et al., 2008; Mukherjee and Ané, 2011), less information is available in woody species. Moreover, the comparison between the effects of AMF and P level on LR

formation is of special importance, when AMF and P interaction is considered. In this study, we provided morphological as well as molecular evidence to demonstrate that both AMF and P level modified the LR formation in P. trifoliate. It is well known that AMF can affect many components of plant RSA, however, most of these experiments have been conducted with annual plants as hosts, such as Capsicum annuum (Ronco et al., 2008), Medicago truncatula (Olah et al., 2005), Oryza sativa (Gutjahr et al., 2009; Mukherjee and Ané, 2011), Zea mays (Mukherjee and Ané, 2011). Among the components of RSA, LR formation is of special importance due to its key role in constructing RSA (Charlton, 1991). According to Ronco et al. (2008), the number of 1st LR was increased by almost 50% by Glomus mosseae in C. annuum, and more notably, the increase was more than 2-fold under 10% glyphosate stress. Similarly, it is also demonstrated that AMF always promoted LR formation in perennial woody species, such as Platanus acerifolia (Tisserant et al., 1996), Prunus cerasifera (Berta et al., 1995), Vitis vinifera (Schellenbaum et al., 1991). In previous work in P. trifoliate, we reported that three out of four AMF isolates increased the number of 2nd LR (Yao et al., 2009), indicat-

W. Chen et al. / Scientia Horticulturae 217 (2017) 258–265

263

Table 6 Two-way ANOVA (P value) for the expression of auxin-related genes in roots. MAT: months after transplanting, P: P level, M: AMF inoculation. Note: P values below 0.05 are highlighted in bold. Variation source

P M P×M

2 MAT

4 MAT

NAC1

TIR1

ARF

ARF18

AUX2

NAC1

TIR1

ARF

ARF18

AUX2

0.011 0.116 0.083

0.169 0.418 0.579

0.133 0.448 0.867

0.219 0.816 0.758

0.52 0.820 0.892

0.663 0.002 0.563

0.976 0.073 0.483

0.868 0.402 0.471

0.882 0.630 0.867

0.812 0.721 0.764

Table 7 Relationships between lateral root number and genes related to lateral root development. MAT: months after transplanting, LR: lateral root. Note: Coefficients with significant relationship are highlighted in bold, with * and ** indicating significance at P = 0.05 and P = 0.01, respectively (Spearman’s coefficients, two-tailed). Sampling time

2 MAT 4 MAT

LR No.

1st LR 2nd LR 1st LR 2nd LR

Genes related to lateral root development PSK6

KRP6

RSI-1

NAC1

TIR1

ARF1

ARF18

AUX2

0.547 0.359 0.797** 0.672*

−0.225 0.087 −0.465 −0.504

0.384 0.427 −0.011 0.074

0.033 −0.109 0.706* 0.666*

−0.268 −0.084 0.562 0.660*

−0.307 −0.333 0.455 0.401

0.159 0.392 0.141 0.313

−0.212 0.052 0.391 0.408

ing the effect of AMF on LR formation dependent on plant and/or fungal species (Wang et al., 2010). The effect of P level on LR formation is complex. Although previous work repeatedly suggest that low P level enhances LR formation (López-Bucio et al., 2003; and references therein), recent research demonstrate that high P level can be promotive of LR formation in several species, such as maize (Li et al., 2012), barley (Vysotskaya et al., 2016), wheat (Talboys et al., 2014). Similarly, in our study with a woody species as test plants, high P level increased the number of 2nd LR independent of sampling time. Vysotskaya et al. (2016) argued that the effect of low P on LR formation is likely to be species specific and depend on experimental design. Using the analysis of variation partitioning, we showed that AMF was more effective than P level in promoting LR formation, contrasting to the reports that P level can strongly regulate LR formation (Xu et al., 2010; Li et al., 2012; Niu et al., 2013). This inconsistency is probably related to the range of P levels. In this study, the final range of the available P was approximately 30 ∼ 60 mg·kg−1 considering the exogenous P application, the available P in tested soils, and the strong immobilization of P in red soils. It is a relative high and narrow range compared with those reported previously. It is interesting that the shared fraction of AMF and P level is negative, contrary to the positive value in other report (Mardhiah et al., 2016). In fact, the negative value in this study indicates the suppression of high P level on AMF, as shown in Table 2. Peres-Neto et al. (2006) pointed out that the shared fraction between variables with suppression interrelation can be always negative. More importantly, this negative value of shared fraction clearly demonstrates the interactive effects of AMF and P level on LR formation, although the interaction was weak at 2 MAT (Table 3). The interactive effect of AMF and P level on LR formation in annual plants is scarcely reported, and thus the comparison between woody plants and annual plants is impossible presently; however, higher sensitivity of annual plants to AMF probably indicates that AMF and P level can interactively affect the LR formation of annual plants (Yao et al., 2005; Chandrasekaran et al., 2014). Therefore, much work is necessary to address this question in the future. Auxin is versatile phytohormone, involved in the regulation of AMF colonization (Foo, 2013). In this study, we demonstrated that auxin signaling was also involved in the modification of LR formation by AMF and P level. This was evidenced by up-regulated expression of NAC1 in parallel with increased LR formation by AMF and P level. NAC1, the member of NAC transcription factor family, can be activated by auxin receptor TIR1, then the expression of downstream genes, DBP and AIR3, were started to promote the LR

formation in Arabidopsis (Xie et al., 2000). Moreover, it seems that TIR1 was also involved in this modification because its expression is significantly related with LR formation in this study. Our result is consistent with previous report (Pérez-Torres et al., 2008), where low P altered the LP formation via the increase of TIR1 expression in Arabidopsis. Taken together, these data suggest that AMF and P level regulate the LR formation via auxin signaling, namely, activating auxin receptor (TIR1) and the transcription regulation of auxin signaling (NAC1). Other components in auxin signaling have been demonstrated to be involved in LR formation, such as AUX1. Marchant et al. (2002) showed that, during the LR formation, AUX1 transported auxin to the pericyclic cell, then increased LR emergence. Zhao et al. (2015) also found that it controlled the LR formation in rice. In this study, however, the expression of AUX1 was not affected by AMF or P level. Similarly, it was the case for ARF18 and ARF1, although the increased expression of ZmARF1 promoted the growth of crown root in maize (Afifi and Swanton, 2012). Therefore, although auxin signaling is involved in LR formation in most plant species, the key components with essential effects can be different depending on plant species (P. trifoliate in this study) or environmental triggers (AMF and P level in this study). Molecular indicator of LR formation is essential to recognition of early LR primordium. The expression of PSK, KRP6, and RSI-1 have been proposed to be indicative of LR formation (Lorbiecke et al., 2005; Ren et al., 2008; Taylor and Scheuring, 1994). PSK, the plant peptide growth factor, shows obvious promotion in root growth (Stührwohldt et al., 2011; Sauter, 2015). KRP proteins are cyclin/cyclin-dependent kinase (CDK) subunit inhibitors, and their high expression level could hinder the transition from G1 to S phase in cell cycle (de Jesús Juárez et al., 2008). In this study, P level showed no influence on the expression of these genes. In contrast, AMF significantly increased the expression of PSK6 and RSI-1, and decreased the expression of KRP6. These results are in parallel with the data that increased expression of PSK6 and RSI-1 promote LR formation while increased expression of KRP6 suppresses it (Himanen ´ et al., 2014; Taylor and Scheuring, 1994). et al., 2002; Mackowska Additionally, we identified PSK6 as the key gene indicative of LR formation, at least in P. trifoliate, using correlation analysis.

5. Conclusion In conclusion, our study provides morphological and molecular evidences that AMF and P level can affect LR formation in P. trifoliate with different patterns. AMF is more effective than P level,

264

W. Chen et al. / Scientia Horticulturae 217 (2017) 258–265

at least within the range of P levels tested in this study, significantly increasing the numbers of 1st and 2nd LR at both 2 and 4 MAT. Moreover, the increased expression of PSK6 can be well indicative of LR formation. Auxin signaling is involved in the regulation of LR formation by AMF and P level. AMF and high P level increase the expression of NAC1, and the expression of NAC1 and TIR1 are significantly related with LR formation. These results provide a comprehensive and novel insight into the regulation of AMF and P level on LR formation, especially in woody plants. Acknowledgements This research was financially supported by National Natural Science Foundation of China [31270448] and Guangdong Higher Education Talents Project, China [(2013)246]. References Afifi, M., Swanton, C., 2012. Early physiological mechanisms of weed competition. Weed Sci. 60, 542–551. Antunes, V., Cardoso, E.J., 1991. Growth and nutrient status of citrus plants as influenced by mycorrhiza and phosphorus application. Plant Soil 131, 11–19. Bailey, P.H., Currey, J.D., Fitter, A.H., 2002. The role of root system architecture and root hairs in promoting anchorage against uprooting forces in Allium cepa and root mutants of Arabidopsis thaliana. J. Exp. Bot. 53, 333–340. Bardgett, R.D., Mommer, L., De Vries, F.T., 2014. Going underground: root traits as drivers of ecosystem processes. Trends Ecol. Evol. 29, 692–699. Berta, G., Trotta, A., Fusconi, A., Hooker, J.E., Munro, M., Atkinson, D., Giovannetti, M., Morini, S., Fortuna, P., Tisserant, B., Gianinazzi-Pearson, V., Gianinazzi, S., 1995. Arbuscular mycorrhizal induced changes to plant growth and root system morphology in Prunus cerasifera. Tree Physiol. 15, 281–293. Chandrasekaran, M., Boughattas, S., Hu, S., Oh, S.H., Sa, T., 2014. A meta-analysis of arbuscular mycorrhizal effects on plants grown under salt stress. Mycorrhiza 24, 611–625. Charlton, W.A., 1991. Lateral root initiation. In: Waisel, Y., Eshel, A., Kafkafi, Y. (Eds.), Plant Roots: The Hidden Half. Marcel Dekker, New York, pp. 103–129. Cichy, K.A., Snapp, S.S., Kirk, W.W., 2007. Fusarium root rot incidence and root system architecture in grafted common bean lines. Plant Soil 300, 233–244. Cruz, C., Green, J.J., Watson, C.A., Wilson, F., Martins-Loucao, M.A., 2004. Functional aspects of root architecture and mycorrhizal inoculation with respect to nutrient uptake capacity. Mycorrhiza 14, 177–184. Foo, E., 2013. The interaction between auxin and strigolactone in pea mycorrhizal symbioses. J. Plant Physiol. 170, 523–528. Fusconi, A., 2014. Regulation of root morphogenesis in arbuscular mycorrhizae: what role do fungal exudates, phosphate, sugars and hormones play in lateral root formation? Ann. Bot. 113, 19–33. Giovannetti, M., Mosse, B., 1980. An evaluation of techniques for measuring vesicular arbuscular mycorrhizal infection in roots. New Phytol. 84, 489–500. Gutjahr, C., Casieri, L., Paszkowski, U., 2009. Glomus intraradices induces changes in root system architecture of rice independently of common symbiosis signaling. New Phytol. 182, 829–837. Heppell, J., Talboys, P., Payvandi, S., Zygalakis, K.C., Fliege, J., Withers, P.J.A., Jones, D.L., Roose, T., 2015. How changing root system architecture can help tackle a reduction in soil phosphate (P) levels for better plant P acquisition. Plant Cell Environ. 38, 118–128. Himanen, I.K., Boucheron, E., Vanneste, S., de Almeida Engler, J., Inze, D., Beeckman, T., 2002. Auxin-mediated cell cycle activation during early lateral root initiation. Plant Cell 14, 2339–2351. Ivanchenko, M.G., Napsucialy-Mendivil, S., Dubrovsky, J.G., 2010. Auxin-induced inhibition of lateral root initiation contributes to root system shaping in Arabidopsis thaliana. Plant J. 64, 740–752. Jiang, X., Chen, W.L., Xu, C.X., Zhu, H.H., Yao, Q., 2015. Influences of arbuscular mycorrhizal fungus and phosphorus level on the lateral root formation of tomato seedlings. Chin. J. Appl. Ecol. 26, 1186–1192. López-Bucio, J., Cruz-Ramírez, A., Herrera-Estrella, L., 2003. The role of nutrient availability in regulating root architecture. Curr. Opin. Plant Biol. 6, 280–287. Li, Z.X., Xu, C.Z., Li, K.P., Yan, S., Qu, X., Zhang, J.R., 2012. Phosphate starvation of maize inhibits lateral root formation and alters gene expression in the lateral root primordium zone. BMC Plant Biol. 12, 89. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−Ct method. Methods 25, 402–408. Lorbiecke, R., Steffens, M., Tomm, J.M., Scholten, S., von Wiegen, P., Kranz, E., Wienand, U., Sauter, M., 2005. Phytosulphokine gene regulation during maize (Zea mays L.) reproduction. J. Exp. Bot. 56, 1805–1819. Lynch, J., 1995. Root architecture and plant productivity. Plant Physiol. 109, 7–13. ´ Mackowska, K., Jarosz, A., Grzebelus, E., 2014. Plant regeneration from leaf-derived protoplasts within the Daucus genus: effect of different conditions in alginate embedding and phytosulfokine application. Plant Cell Tiss. Org. 117, 241–252. Marchant, A., Bhalerao, R., Casimiro, I., Eklöf, J., Casero, P.J., Bennett, M., Sandberg, G., 2002. AUX1 promotes lateral root formation by facilitating indole-3-acetic

acid distribution between sink and source tissues in the Arabidopsis seedling. Plant Cell 14, 589–597. Mardhiah, U., Caruso, T., Gurnell, A., Rillig, M.C., 2016. Arbuscular mycorrhizal fungal hyphae reduce soil erosion by surface water flow in a greenhouse experiment. Appl. Soil Ecol. 99, 137–140. Martínez-de La Cruz, E., García-Ramírez, E., Vázquez-Ramos, J.M., de la Cruz, H.R., López-Bucio, J., 2015. Auxins differentially regulate root system architecture and cell cycle protein levels in maize seedlings. J. Plant Physiol. 176, 147–156. Mukherjee, A., Ané, J.M., 2011. Germinating spore exudates from arbuscular mycorrhizal fungi: molecular and developmental responses in plants and their regulation by ethylene. Mol. Plant-Microbe Interact. 24, 260–270. Nibau, C., Gibbs, D.J., Coates, J.C., 2008. Branching out in new directions: the control of root architecture by lateral root formation. New Phytol. 179, 595–614. Niu, Y.F., Chai, R.S., Jin, G.L., Wang, H., Tang, C.X., Zhang, Y.S., 2013. Responses of root architecture development to low phosphorus availability: a review. Ann. Bot. 112, 391–408. Oksanen, J., Blanchet, F.G., Kindt, R., Legendre, P., Minchin, P.R.O., Hara, R.B., Simpson, G.L., Solymos, P., Stevens, M.H.H., Wagner, H., 2016. Vegan: Community Ecology Package. R Package Vegan, Vers 2. 3–5, https://cran.rproject. org/web/packages/vegan/index.html. Olah, B., Brière, C., Bécard, G., Dénarie, J., Gough, C., 2005. Nod factors and a diffusible factor from arbuscular mycorrhizal fungi stimulate lateral root formation in Medicago truncatula via the DMI1/DMI2 signalling pathway. Plant J. 44, 195–207. Pérez-Torres, C., López-Bucio, J., Cruz-Ramírez, A., Ibarra-Laclette, E., Dharmasiri, S., Estelle, M., Herrera-Estrella, L., 2008. Phosphate availability alters lateral root development in Arabidopsis by modulating auxin sensitivity via a mechanism involving the TIR1 auxin receptor. Plant Cell 20, 3258–3272. Padilla, I., Encina, C.L., 2005. Changes in root morphology accompanying mycorrhizal alleviation of phosphorus deficiency in micropropagated Annona cherimola Mill. Plants. Sci. Hortic. 106, 360–369. Peng, S., Eissenstat, D.M., Graham, J.H., Williams, K., Hodge, N.C., 1993. Growth depression in mycorrhizal citrus at high-phosphorus supply (analysis of carbon costs). Plant Physiol. 101, 1063–1071. Peres-Neto, P.R., Legendre, P., Dray, S., Borcard, D., 2006. Variation partitioning of species data matrices: estimation and comparison of fractions. Ecology 87, 2614–2625. Phillips, J.M., Hayman, D.S., 1970. Improved procedures for clearing roots and staining parasitic and vesicular-arbuscular mycorrhizal fungi for rapid assessment of infection. Trans. Brit. Mycol. Soc. 55, 118–158. Qu, Z.Q., Liu, L.Y., Lü, Y.L., 2011. Psammophyte architecture and its relations with anti-wind erosion capability: a review. Chin. J. Ecol. 30, 357–362. Ren, H., Santner, A., Pozo, J.C.D., Murray, J.A., Estelle, M., 2008. Degradation of the cyclin-dependent kinase inhibitor KRP1 is regulated by two different ubiquitin E3 ligases. Plant J. 53, 705–716. Ronco, M.G., Ruscitti, M.F., Arango, M.C., Beltrano, J., 2008. Glyphosate and mycorrhization induce changes in plant growth and in root morphology and architecture in pepper plants (Capsicum annuum L.). J. Hortic. Sci. Biotechnol. 83, 497–505. Sauter, M., 2015. Phytosulfokine peptide signalling. J. Exp. Bot. 66, 5161–5169. Schellenbaum, L., Berta, G., Ravolanirina, F., Tisserant, B., Gianinazzi, S., Fitter, A.H., 1991. Influence of endomycorrhizal infection on root morphology in a micropropagated woody plant species (Vitis vinifera L.). Ann. Bot. 68, 135–141. Stührwohldt, N., Dahlke, R.I., Steffens, B., Johnson, A., Sauter, M., 2011. Phytosulfokine-␣ controls hypocotyl length and cell expansion in Arabidopsis thaliana through phytosulfokine receptor 1. PLoS One 6, e21054. Talboys, P.J., Healey, J.R., Withers, P.J.A., Jones, D.L., 2014. Phosphate depletion modulates auxin transport in Triticum aestivum leading to altered root branching. J. Exp. Bot. 65, 5023–5032. Tatematsu, K., Kumagai, S., Muto, H., Sato, A., Watahiki, M.K., Harper, R.M., Liscum, E., Yamamoto, K.T., 2004. MASSUGU2 encodes Aux/IAA19, an auxin-regulated protein that functions together with the transcriptional activator NPH4/ARF7 to regulate differential growth responses of hypocotyl and formation of lateral roots in Arabidopsis thaliana. Plant Cell 16, 379–393. Taylor, B.H., Scheuring, C.F., 1994. A molecular marker for lateral root initiation: the RSI-1 gene of tomato (Lycopersicon esculentum Mill) is activated in early lateral root primordia. Mol. Gen. Genet. 243, 148–157. Tian, H., De Smet, I., Ding, Z., 2014. Shaping a root system: regulating lateral versus primary root growth. Trends Plant Sci. 19, 426–431. Tisserant, B., Gianinazzi, S., Gianinazzi-Pearson, V., 1996. Relationships between lateral root order, arbuscular mycorrhiza development, and the physiological state of the symbiotic fungus in Platanus acerifolia. Can. J. Bot. 74, 1947–1955. Vilches-Barro, A., Maizel, A., 2015. Talking through walls: mechanisms of lateral root emergence in Arabidopsis thaliana. Curr. Opin. Plant Biol. 23, 31–38. Vysotskaya, L.B., Trekozova, A.W., Kudoyarova, G.R., 2016. Effect of phosphorus starvation on hormone content and growth of barley plants. Acta Physiol. Plant 38, 1–6. Wang, X., Pan, Q., Chen, F., Yan, X., Liao, H., 2010. Effects of co-inoculation with arbuscular mycorrhizal fungi and rhizobia on soybean growth as related to root architecture and availability of N and P. Mycorrhiza 21, 173–181. Wu, Q.S., He, X.H., Zou, Y.N., Liu, C.Y., Xiao, J., Li, Y., 2012. Arbuscular mycorrhizas alter root system architecture of Citrus tangerine through regulating metabolism of endogenous polyamines. Plant Growth Regul. 68, 27–35. Xie, Q., Frugis, G., Colgan, D., Chua, N.H., 2000. Arabidopsis NAC1 transduces auxin signal downstream of TIR1 to promote lateral root development. Gene. Dev. 14, 3024–3036.

W. Chen et al. / Scientia Horticulturae 217 (2017) 258–265 Xie, Q., Guo, H.S., Dallman, G., Fang, S.Y., Weissman, A.M., Chua, N.H., 2002. SINAT5 promotes ubiquitin-related degradation of NAC1 to attenuate auxin signals. Nature 419, 167–170. Xu, L., Zhang, Z., Wang, Y.P., Tan, G.J., 2010. Effects of phosphorus stress on the growth of tomato seedlings. J. of Anhui Agric. Sci. 38, 6062–6064. Yamakawa, S., Sakuta, C., Matsubayashi, Y., Sakagami, Y., Kamada, H., Satoh, S., 1998. The promotive effects of a peptidyl plant growth factor, phytosulfokine-␣, on the formation of adventitious roots and expression of a gene for a root-specific cystatin in cucumber hypocotyls. J. Plant Res. 111, 453–458. Yan, J.W., Yuan, F.R., Long, G.Y., Qin, L., Deng, Z.N., 2012. Selection of reference genes for quantitative real-time RT-PCR analysis in citrus. Mol. Biol. Rep. 39, 1831–1838. Yao, Q., Zhu, H.H., Chen, J.Z., Christie, P., 2005. Influence of an arbuscular mycorrhizal fungus on competition for phosphorus between sweet orange and a leguminous herb. J. Plant Nutr. 28, 2179–2192.

265

Yao, Q., Wang, L.R., Zhu, H.H., Chen, J.Z., 2009. Effect of arbuscular mycorrhizal fungal inoculation on root system architecture of trifoliate orange (Poncirus trifoliata L. Raf.) seedlings. Sci. Horti. 121, 458–461. Zeng, H.Q., Zhu, Y.Y., Bao, Y., Shen, Q.R., Guo, K., Huang, S.Q., Yang, Z.M., 2010. Relationship between the development of tomato lateral roots and expression of miR164, NAC1 under P deficiency. Plant Nutr. Fert. Sci. 16, 166–171. Zhao, H.M., Ma, T.F., Wang, X., Deng, Y.T., Ma, H.L., Zhang, R.S., Zhao, J., 2015. OsAUX1 controls lateral root initiation in rice (Oryza sativa L.). Plant Cell Environ. 38, 2208–2222. de Jesús Juárez, N., Mancilla, A., Garcia, E., Vázquez-Ramos, J.M., 2008. Expression and activity of a Kip-related protein Zeama; KRP1, during maize germination. Seed Sci. Res. 18, 67–76.