The function of two trypsin-like serine proteases from Eriocheir sinensis involved in Spiroplasma eriocheiris infection

The function of two trypsin-like serine proteases from Eriocheir sinensis involved in Spiroplasma eriocheiris infection

Aquaculture 501 (2019) 519–526 Contents lists available at ScienceDirect Aquaculture journal homepage: www.elsevier.com/locate/aquaculture The func...

3MB Sizes 1 Downloads 9 Views

Aquaculture 501 (2019) 519–526

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

The function of two trypsin-like serine proteases from Eriocheir sinensis involved in Spiroplasma eriocheiris infection

T

Qi Gaob, Panpan Weib, Haifeng Zhoub, Wenjing Haob, Libo Houb, Mingxiao Ningb, Wei Gua,c, ⁎ ⁎⁎ Wen Wangb, , Qingguo Menga,c, a Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Marine Science and Engineering, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210023, China b College of Life Sciences, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210023, China c Co-Innovation Center for Marine Bio-Industry Technology of Jiangsu Province, Lianyungang, Jiangsu 222005, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Eriocheir sinensis Trypsin-like serine proteases Spiroplasma eriocheiris qRT-PCR RNA interference

Trypsin-like serine proteases (TLSPs), are members of the serine protease family and play important roles in innate immune responses. There are no previous studies regarding the role of TLSPs in immune responses to Spiroplasma eriocheiris in Eriocheir sinensis. In this paper, two TLSPs were identified from E. sinensis, namely EsTLSP-I and EsTLSP-II. Phylogenetic analysis showed that EsTLSP-I and EsTLSP-II clustered into two different groups that the crustaceans within each group were specifically. Tissue distribution analysis indicated that both EsTLSP-I and EsTLSP-II were mostly expressed in hemocytes, in the gill and in the intestine. The EsTLSP-I and EsTLSP-II transcription levels in hemocytes significantly increased after infection with S. eriocheiris. After dsRNA interference, the expression of both EsTLSP-I and EsTLSP-II distinctively declined from 48 h to 96 h. The expression of proPO and beta-1,3-glucan binding protein (LGBP) were also notably reduced after silencing. Compared to the control group, the copy number of S. eriocheiris increased significantly in interfering EsTLSP-I and EsTLSP-II groups during S. eriocheiris infection. Meanwhile, the mortality of crabs in the silenced EsTLSP-I and EsTLSP-II groups was higher than in the control group after the S. eriocheiris challenge. The results indicate that EsTLSP-I and EsTLSP-II play important roles in the innate immune system of Eriocheir sinensis, in combating infections of S. eriocheiris.

1. Introduction The Chinese mitten crab, Eriocheir sinensis, is an economically important species in freshwater aquaculture in southeast China. As is well established, crustaceans lack an adaptive immune system, so innate immunity plays a vital role in defending against microbial infection through interaction with microbe surface antigens (Hoffmann et al., 1999; Iwanaga and Lee, 2005). The melanization reaction is one of the most effective humoral defenses to foreign substances, and is caused by the activity of an oxidoreductase and the prophenoloxidase-activating system (proPO system) (Söderhäll and Cerenius, 1998; Amparyup et al., 2013). The proPO system is one of the more important components in the innate immune system, and is composed of proteinase, and proteinase inhibitors (Chosa et al., 1997; Gai et al., 2008). These can recognize and respond to lipopolysaccharides (LPS), or to peptidoglyans

(PGN), from bacteria and β-1,3-glucan from fungi (Söderhäll and Cerenius, 1998). ProPO is activated by proteolytic cleavage, and transforms a native proteinase to an active prophenoloxidase (Aspán et al., 1995; Chosa et al., 1997). Thus, ProPO-activating enzymes (PPAEs) convert the zymogen proPOs into the active phenoloxidases (POs), which catalyze the oxidation of phenols to quinones; these are reactive intermediate compounds for melanin synthesis at the injury site or around invading microorganisms (Cerenius and Söderhäll, 2004; Nappi and Christensen, 2005; Amparyup et al., 2012; Amparyup et al., 2013). PPAEs, a type of serine proteinase, have been isolated from crayfish (Arunee et al., 1990). The serine proteinase family plays a role in development and immunity and is divided into specific groups, such as chymotrypsin, subtilisin, lactoferrin, dystroglycan, and mucin (Gai et al., 2009). The trypsin-like serine proteases (TLSPs) belong to the chymotrypsin group. In Penaeus monodon, Penaeus vannamei and



Corresponding author. Corresponding author at: Jiangsu Key Laboratory for Aquatic Crustacean Diseases, College of Marine Science and Engineering, Nanjing Normal University, 1 Wenyuan Road, Nanjing 210023, China. E-mail addresses: [email protected] (W. Wang), [email protected] (Q. Meng). ⁎⁎

https://doi.org/10.1016/j.aquaculture.2018.12.014 Received 19 August 2018; Received in revised form 4 December 2018; Accepted 5 December 2018 Available online 06 December 2018 0044-8486/ © 2018 Published by Elsevier B.V.

Aquaculture 501 (2019) 519–526

Q. Gao et al.

of TLSPs involved in S. eriocheiris infection, however, has not been studied clearly. Two TLSP genes (EsTLSP-I and EsTLSP-II) of E. sinensis were identified during the study of the function of TLSPs in S. eriocheiris infections. In this study, EsTLSP-I and EsTLSP-II were expressed highest in the hemocytes, and they also were expressed higher in crabs that were infected with S. eriocheiris compared to the control group. Given the above two experimental results, the role that EsTLSP-I and EsTLSP-II play in the innate immune system response was elucidated. Then, further investigations on how the EsTLSP-I and EsTLSP-II RNAs provide interference during the infective process were investigated; the expression level of proPO was lower in the presence of EsTLSP-I and EsTLSP-II RNAs than in the control group. The copies of S. eriocheiris, and the crab death rate, were clearly increased with elevated levels of EsTLSP-I and EsTLSP-II RNAi. This provided evidence that EsTLSP-I and EsTLSP-II take part in the proPO system by participation in the serine protease cascade. This study will be helpful to definitively establish the pathogenic mechanism and the function of proPO system in S. eriocheiris infection.

Table 1 Primers used for real-time quantitative and RNAi of EsTLSP-I and EsTLSP-II. Primers

Sequence (5′-3′)

EsTLSP-I-QF EsTLSP-I-QR EsTLSP-II-QF EsTLSP-II-QR EsTLSP-IdsRNA-F EsTLSP-IdsRNA-R EsTLSP-IIdsRNA-F EsTLSP-IIdsRNA-R GFP-dsRNA-F GFP-dsRNA-R EsproPO-QF EsproPO-QR EsLGBP-QF EsLGBP-QR EsGAPDH-QF EsGAPDH-QR Se-QF Se-QR

CATAGGCCCATCCCAGTAAAA ACTGCCCCAACACTCCAGTTC TACCCCATCCAGAAACAACAC ACCCAAACTATGTGCCATCAC GCGTAATACGACTCACTATAGGCTCGCCTGCCTGCCAAGT GCGTAATACGACTCACTATAGGCACTGCCCCAACACTCCA GCGTAATACGACTCACTATAGGTATGTGTGCTGGTGGAGAG GCGTAATACGACTCACTATAGGATTGTAATGATATGTGTCA GCGTAATACGACTCACTATAGGTGGTCCCAATTCTCGTGGAAC GCGTAATACGACTCACTATAGGCTTGAAGTTGACCTTGATGCC GTGAAGGCAAGCGGGTGA CCCTGTGAGCGTTGTCCG TCATCAAGCCGCAACTCAC TCCGAAGCCTGGCACTCA CTGCCCAAAACATCATCCCATC CTCTCATCCCCAGTGAAATCGC CGCAGACGGTTTAGCAAGTTTGGG AGCACCGAACTTAGTCCGACAC

2. Materials and methods 2.1. Sequence analysis of EsTLSP-I and EsTLSP-II The nucleotide and protein sequence of EsTLSP-I and EsTLSP-II were acquired from NCBI GenBank. Using SignalP 4.1 program (http:// www.cbs.dtu.dk/ services/SignalP/) to predict the presence and location of signal peptides, the domains were predicted using the Simple Modular Architecture Research Tool (http://smart.emblheidelberg.de/ ). Multiple sequence alignments were conducted with the ClustalW2 (http://www.ebi.ac.uk/Tools/msa/ clustalw2/). A cladogram was constructed using the neighbor-joining (NJ) algorithm (Molecular Evolutionary Genetics Analysis).

Fenneropenaeus chinensis, TLSPs are involved in innate defense reactions against different pathogens, and also in the processes of digestion (Lehnert and Johnson, 2002; Muhliaalmazán et al., 2003; Shi et al., 2009). Tremor disease (TD) is one of the most devastating diseases of E. sinensis and causes great financial losses (Meng et al., 2010). The pathogen of TD has been identified as Spiroplasma eriocheiris (Wang et al., 2002; Srisala et al., 2018). Spiroplasma eriocheiris was observed in the hemocytes at an early stage of infection, and subsequently was detected within the muscles, nerves and connective tissues of crab (Wang et al., 2004). The proPO system has an important role in the infection of E. sinensis by S. eriocheiris (Yuan et al., 2018; Xu et al., 2018). The function

2.2. The spatiotemporal transcripts of EsTLSP-I and EsTLSP-II Healthy E. sinensis (25 ± 5 g) were purchased from an aquaculture

Fig. 1. Nucleotide and deduced amino acid sequence of EsTLSP-I (A) and EsTLSP-II (B) from Eriocheir sinensis. The start codon (ATG) and stop codon (TAA) are underlined, the poly (A) signal is boxed and the Tryp-SPc domain is shaded. The stop codons are indicated by asterisks (*). 520

Aquaculture 501 (2019) 519–526

Q. Gao et al.

Fig. 2. Phylogenetic tree construction of serine proteins from various species. A phylogenetic tree based on the full-length amino acid sequences of TLSPs was constructed by the neighbor-joining method and bootstrapped 1000 times using the MEGA 6.0 software.

The melt curves of qRT-PCR products were determined by the specificity of PCR amplification. The samples were repeated three times. All data were analyzed by the 2−ΔΔCT method (Livak and Schmittgen, 2001) and used to establish the relative expression levels of EsTLSP-I, EsTLSP-II as means ± S.E.

market in Nanjing, Jiangsu Province, China. Polymerase chain reaction (PCR) was used to guarantee that the crabs were free of spiroplasma. Spiroplasma-free crabs were laboratory-cultured in 60 L tanks containing aerated freshwater at 30 °C. Fifteen crabs were cultured in each tank and given commercial feed daily. Crabs were cultured for 1 week before samples were withdrawn. The hepatopancreas, intestine, heart, gill, muscle, nerve and hemocytes were collected from five healthy crabs for analysis of the tissue distribution of EsTLSP-I and EsTLSP-II. Total RNA extract was obtained using TRIzol Reagent (Invitrogen, USA) according to the manufacturer's protocol. After a quality check using electrophoresis and a Lightcycler® 96 Instrument (Roche, Germany) the sample was treated with DNase I (Takara, Japan). Then, the total RNA was reverse-transcribed into cDNA using the PrimeScript ™ RT reagent Kit (Takara, Japan). Quantitative real-time PCR (qRT-PCR) was conducted using 2 × SYBR Premix Ex Taq Kit (Takara, Japan). The reaction system was a volume dose of 10 μL containing 5 μL 2 × SYBR Premix Ex Taq™ (Takara, Japan), 0.4 μL forward primer (10 μM, Table 1), 0.4 μL reverse primer (10 μM, Table 1), 1 μL cDNA template and 3.2 μL RNasefree Water. GAPDH was amplified as an internal control using primers (EsGAPDH-QF, EsGAPDH-QR) (Table 1). The PCR program was 95 °C for 30 s, 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The amplicon lengths of EsTLSP-I and EsTLSP-II were 103 bp and 153 bp, respectively.

2.3. Immune challenge For the S. eriocheiris infection experiment, 100 spiroplasma-free crabs were randomly divided into two groups: challenge group and control group. The crabs in each group were cultured in three tanks. Crabs in the challenge group were individually injected with 90 μL S. eriocheiris (108 cells/ml) and the control group was injected with 90 μL PBS. The hemocytes of three individuals from different tanks were collected at the time points of 0, 1, 3, 5, 7 and 9 d post injection. The total RNA was reverse-transcribed into cDNA using the PrimeScript ™ RT reagent Kit (Takara, Japan). The relative expression levels of two TLSP was tested by qRT-PCR. 2.4. EsTLSP-I and EsTLSP-II RNA interference assay Double-stranded RNA of EsTLSP-I, EsTLSP-II and GFP (as control) 521

Aquaculture 501 (2019) 519–526

Q. Gao et al.

Fig. 3. Tissue distribution of EsTLSP-I (A) and EsTLSP-II (B) mRNAs in healthy Eriocheir sinensis. The qRT-PCR was conducted in triplicate for each sample from different tanks and expression of the gene encoding GAPDH was used as the control. Vertical bars represent the mean ± S.E. (n = 15).

Fig. 4. The expression analyses of EsTLSP-I (A) and EsTLSP-II (B) after Spiroplasma eriocheiris or PBS challenge. Vertical bars represent the mean ± S.E. (n = 9). Each sample is from different tanks. Statistically significant differences between treatments are indicated by asterisks (**P < 0.01; ***P < 0.001).

analyzed by qRT-PCR, simultaneously.

were synthesized with an in vitro transcription T7 kit for dsRNA synthesis (Takara, Japan). The DNA fragment for preparation of EsTLSP-I, EsTLSP-II and GFP was amplified by PCR from cDNA using gene specific primers (Table 1). Agarose gel electrophoresis and spectrophotometric quantitative analyses were utilized to monitor the synthetic quality of dsRNAs. To ensure the efficiency of RNA interference (RNAi), the crabs were injected with 60 μg EsTLSP-I-dsRNA and EsTLSP-II-dsRNA as the experimental groups and 60 μg GFP-dsRNA as the control group, respectively. Sixty crabs were divided into four groups. At 24 h post injection, the crabs were injected with the same dsRNA to amplify the RNAi effect. The hemocytes of five crabs in each group were sampled and analyzed by qRT-PCR using primer pairs EsTLSP-I-QF/EsTLSP-I-QR and EsTLSP-II-QF/EsTLSP-II-QR (Table 1) at 48, 72, 96 h after the first injection, respectively. The upstream and downstream genes of EsTLSP-I and EsTLSP-II, beta-1,3-glucan binding protein (LGBP) and proPO, were

2.5. S. eriocheiris copy number and survival rate of E. sinensis assay Four hundred and forty healthy crabs were randomly divided into eight groups, EsTLSP-I-dsRNA group, EsTLSP-I-dsRNA + S. eriocheiris group, EsTLSP-II-dsRNA group, EsTLSP-II-dsRNA + S. eriocheiris group, GFP-dsRNA group, GFP-dsRNA + S. eriocheiris group, PBS group and PBS + S. eriocheiris group. The crabs in each group were cultured in three tanks. EsTLSP-I-dsRNA group and EsTLSP-I-dsRNA + S. eriocheiris group were injected with 60 μg EsTLSP-I-dsRNA, respectively. EsTLSPII-dsRNA group and EsTLSP-II-dsRNA + S. eriocheiris group were separately injected with 60 μg EsTLSP-II-dsRNA. GFP-dsRNA group and GFPdsRNA + S. eriocheiris group were individually injected with 60 μg GFPdsRNA. Each of the PBS group and PBS + S. eriocheiris group was injected with 60 μL PBS. At 24 h post-injection, the same amount of 522

Aquaculture 501 (2019) 519–526

Q. Gao et al.

Fig. 5. The expressions analyses from EsTLSP-I (A) and EsTLSP-II (B) dsRNA interference. The transcript levels of EsTLSP-I (A) and EsTLSP-II (B) were detected at 48, 72 and 96 h post dsRNAs injection that were employed to detect the efficiencies of gene silencing. GAPDH was used as a reference gene. Vertical bars represent the mean ± S.E. (n = 15). Each sample is from different tanks. Statistically significant differences between treatments are indicated by asterisks (**P < 0.01; ***P < 0.001).

KU301758). EsTLSP-II has a Tryp-SPc domain of 249 AA. The nucleotide and deduced amino acid sequences of EsTLSP-I are shown in Fig. 1.B. To analyze the evolutionary relationships between EsTLSP-I, EsTLSP-II and other serine proteases, the NJ method to establish a phylogenetic tree was used. In the tree (Fig. 2), EsTLSP-I and EsTLSP-II were classified into two clades; and selected proteins of each were classified into two groups. EsTLSP-I and EsTLSP-II and other serine proteases were clustered in the Decapoda group.

dsRNAs and PBS were injected. Each of the crabs in the EsTLSP-IdsRNA + S. eriocheiris group, EsTLSP-II-dsRNA + S. eriocheiris group, GFP-dsRNA + S. eriocheiris group and PBS + S. eriocheiris group was challenged with 90 μL S. eriocheiris (108 cells/mL) at 48 h first post-injection. Three crabs from each EsTLSP-I-dsRNA + S. eriocheiris group, EsTLSP-II-dsRNA + S. eriocheiris group, GFP-dsRNA + S. eriocheiris group and PBS + S. eriocheiris group from different tanks were collected to calculate the copies of S. eriocheiris at 0, 1, 3, 5, 7 and 9 d. The total DNA was extracted from hemocytes with Easy Pure Genomic DNA Kit (TransGen, China) and detected by absolute real-time PCR with primer pairs Se-QF and Se-QR (Ding et al., 2014) (Table 1). All experiments were performed in triplicate. The survival rate of the crabs was calculated to test the differences in mortality each day.

3.2. The spatiotemporal expression of EsTLSP-I and EsTLSP-II EsTLSP-I and EsTLSP-II were detected in each tissue by qRT-PCR. EsTLSP-I and EsTLSP-II were highly expressed in hemocytes, intestine and gill; but, relatively lower expression levels were measured in heart, nerve, muscle, hepatopancreas and stomach (Fig. 3.A and B). To analyze the transcripts of EsTLSP-I and EsTLSP-II due to S. eriocheiris challenges, EsTLSP-I and EsTLSP-II in hemocytes were detected by qRT-PCR. The expression level of EsTLSP-I was significantly increased from 3 d to 5 d in hemocytes after injecting with S. eriocheiris, but returned back to normal after 7 d (Fig. 4.A). The transcript levels of EsTLSP-II after S. eriocheiris injection were significantly up-regulated from 1 d to 7 d, and returned to normal level at 9 d (Fig. 4.B). The expression tendency between EsTLSP-I and EsTLSP-II in hemocytes is similar after S. eriocheiris challenges.

2.6. Statistical analysis Statistical significance was identified by one-way analysis of variance (ANOVA) followed by Duncan and Tukey multiple comparison tests using Origin 8.1. 3. Results 3.1. Sequence analysis of EsTLSP-I and EsTLSP-II The full-length of EsTLSP-I has 1525 bp containing 93 bp in the 5′untranslated region (UTR), 1143 bp in the open reading frame (ORF) and 289 bp in the 3’-UTR with a poly (A) tail (GenBank accession number: GQ325713). The ORF encodes a predicted protein of 380 amino acids (AA) with a Tryp-SPc domain of 233 AA. The nucleotide and deduced amino acid sequences of EsTLSP-I are identified in Fig. 1.A. The theoretical isoelectric point and predicted molecular weight of EsTLSP-I is 6.33 and 40.01 kDa, respectively. EsTLSP-II contains 1728 bp with 124 bp in the 5′- UTR, 1209 bp in the ORF and 395 bp in the 3’-UTR with a poly (A) tail and the ORF encodes a predicted protein of 402 AA with pI of 6.26 and predicted molecular weight of 43.64 kDa (GenBank accession number:

3.3. EsTLSP-I and EsTLSP-II silencing and its effects during S. eriocheiris challenge For assessing the functions of EsTLSP-I and EsTLSP-II in S. eriocheiris infection, EsTLSP-I and EsTLSP-II were silenced and then the crabs were injected with S. eriocheiris. The transcriptions of EsTLSP-I and EsTLSP-II were detected after interference by qRT-PCR assays (Fig. 5.A and B). The results showed that the interference of EsTLSP-I and EsTLSP-II in the treatment group was effective when compared to the control group and lasted to 96 h. The upstream and downstream genes of EsTLSP-I and EsTLSP-II, 523

Aquaculture 501 (2019) 519–526

Q. Gao et al.

Fig. 6. The expressions analyses of LGBP (A, C) and proPO (B, D) that resulted from the EsTLSP-I (A, B) and EsTLSP-II (C, D) dsRNA interference. The transcript levels of LGBP and proPO were detected at 48, 72 and 96 h post dsRNAs injection. GAPDH was used as reference gene. Vertical bars represent the mean ± S.E. (n = 15). Each sample is from different tanks. Statistically significant differences between treatments are indicated by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

respectively. In conclusion, the results illustrated that survival rate of crabs was significantly decreased by silencing EsTLSP-I and EsTLSP-II.

LGBP (Fig. 6.A and C) and proPO (Fig. 6.B and D) were detected using qRT-PCR to find out the regulatory mechanism of EsTLSP-I and EsTLSPII in the proPO system of E. sinensis. The expression level of LGBP, and the upstream gene of EsTLSP-I, was significantly less than in the control group. At the same time, the transcriptions of proPO, and the downstream gene of EsTLSP-I, were also less than observed in the control group from 48 h to 96 h. LGBP and proPO were expressed substantially less than the control group when EsTLSP-II was interfered. The copies of S. eriocheiris in crabs were measured by absolute realtime PCR (Fig. 7.A and B). Compared to the control group, the copy number of S. eriocheiris in the EsTLSP-I-dsRNA + S. eriocheiris group increased significantly from 3 d to 7 d. The copy number of S. eriocheiris in the EsTLSP-II-dsRNA + S. eriocheiris group was significantly higher than in the control groups from 1 d to 9 d. Compared to the control group, the survival rate of EsTLSP-IdsRNA + S. eriocheiris group and EsTLSP-II-dsRNA + S. eriocheiris group were decreased significantly (Fig. 8.A and B). At 12 d, the cumulative survival rates of the EsTLSP-I-dsRNA + S. eriocheiris group and EsTLSP-II-dsRNA + S. eriocheiris group were individually 15% and 12% in contrast to the GFP-dsRNA + S. eriocheiris group and PBS + S. eriocheiris group, where the cumulative survival rates were 47.5% and 43%,

4. Discussion With the development of the aquaculture industry, epidemic diseases in aquaculture have become more prevalent. Especially, TD has emerged which is caused by a novel pathogen, S. eriocheiris, resulting in drastic decreases in E. sinensis numbers, with consequent catastrophic economic losses in recent years (Wang et al., 2004; Srisala et al., 2018). To cut economic losses, it is important to study the mechanism of innate immunity in E. sinensis. Accumulating evidence shows that serine proteases exist in invertebrates to regulate a rapid, local response to infection and wounding (Jiang and Kanost, 2000; Ligoxygakis et al., 2002; Gai et al., 2009). Though there are many studies of serine proteases, the function of serine proteases when E. sinensis is infected by S. eriocheiris is not clear. Here the characteristics of two TLSPs of E. sinensis were studied and made certain that they both have a Tryp-SPc domain. Many studies showed that proteinase zymogens required a proteinase with trypsin-like specificity to cleave at a specific residue for their own activation and then take part in the proPO system (Lee et al., 524

Aquaculture 501 (2019) 519–526

Q. Gao et al.

Fig. 7. The changes of Spiroplasma eriocheiris copies in Eriocheir sinensis hemocyte in EsTLSP-I group (A) and EsTLSP-II group (B) after infection. Absolute real-time PCR analyses were performed in triplicate for each detected sample (n = 9). Each sample is from different tanks. Statistically significant differences between treatments are indicated by asterisks (*P < 0.05; **P < 0.01; ***P < 0.001).

Fig. 8. Eriocheir sinensis cumulative mortality following treatment with EsTLSP-I (A) and EsTLSP-II (B) dsRNA during Spiroplasma eriocheiris infection.

sapidus, serine protease, was substantially up-regulated after bacterial invasion and took part in the innate immune and proPO system (Buda and Shafer, 2005; Jiang et al., 2005). The experiments that examined tissue distribution, and the effects of S. eriocheiris challenge, illustrated EsTLSP-I and EsTLSP-II play important roles in innate immunity. Pattern recognition proteins (PRPs) of the proPO system, such as lipopolysaccharide and β-1, 3-glucan binding protein (LGBP), were important in mediating recognition of invasion and then initiating immune responses, participating in the activation of the proPO system by the cascade of serine proteases (Lee et al., 2000; Sritunyalucksana and Söderhäll, 2000; Du et al., 2007). In the current studies, the expression of LGBP and proPO decreased when EsTLSP-I and EsTLSP-II were silenced. In some studies, LGBP was bound to LPS and β-1, 3-glucan, but did not bind to peptidoglycan (Cheng et al., 2005; Liu et al., 2009; Zhao et al., 2009; Amparyup et al., 2012). The expression of the proPO gene decreased dramatically in the experimental group, and illustrated that EsTLSP-I and EsTLSP-II join in proPO system. Due to silencing, the S.

1998; Satoh et al., 1999; Jiang et al., 2003). EsTLSP-I and EsTLSP-II have similar domains, so we deduced both them were involved in proPO activation to resist pathogen infection. According to the expression pattern in tissues, EsTLSP-I and EsTLSPII transcripts were detected in all examined tissues, with the highest expression in hemocytes. The expression pattern is similar to that of serine proteases in other arthropods, such as Penaeus monodon, Drosophila melanogaster and Penaeus vannamei; overall, with the higher expression levels in hemocytes (De et al., 2001; Jimenez et al., 2005; Lin et al., 2006). In invertebrates, the hemocyte circulation plays an essential role in innate immune responses against pathogens; for example, coagulation, melanization and phagocytosis (Lin et al., 2011). As S. eriocheiris mainly infects the hemocytes, it was speculated that EsTLSP-I and EsTLSP-II played an important role in S. eriocheiris infection. After S. eriocheiris challenge, the expression of EsTLSP-I was increased from 3 d to 5 d; and the transcript of EsTLSP-II was increased markedly from 1 d to 7 d. In E. sinensis, Manduca sexta and Callinectes 525

Aquaculture 501 (2019) 519–526

Q. Gao et al.

eriocheiris copies among crabs in the EsTLSP-I-dsRNA + S. eriocheiris group, and EsTLSP-II-dsRNA + S. eriocheiris group, were distinctively higher than among crabs in the PBS + S. eriocheiris group and GFPdsRNA + S. eriocheiris group. The cumulative mortality of the crabs in EsTLSP-I-dsRNA + S. eriocheiris group and EsTLSP-II-dsRNA + S. eriocheiris group was higher than crabs in PBS + S. eriocheiris group and GFP-dsRNA + S. eriocheiris group. Based on the observations from this study and from previous studies, S. eriocheiris entry could activate the proPO system by the serine protease cascade. Some studies also have determined that serine proteases participate in defense against pathogens by using silencing. For example, knockdown of serine protease of Scylla paramamosain slowed down the rate of hemolymph clotting and decreased the expression of proPO (Zhang et al., 2018). In Drosophila, serine protease silencing impaired the melanization reaction in response to injury and infection (Castillejo-López and Häcker, 2005). Therefore, TLSPs take part in protecting E. sinensis from S. eriocheiris infection. In conclusion, EsTLSP-I and EsTLSP-II belong to the serine protease family as determined by bioinformatics analysis. The tissue distribution experiment reveals that EsTLSP-I and EsTLSP-II were expressed the highest in hemocytes, and are involved in the innate immunity of E. sinensis against S. eriocheiris challenge. RNAi assay revealed that EsTLSP-I and EsTLSP-II regulate the immune responses by initiating the proPO activation cascade in response to E. sinensis infection by S. eriocheiris. Therefore, this discovery should provide a foundation to more fully investigate the function and mechanism of EsTLSP-I and EsTLSP-II in the invertebrate immune system.

pathogen in the freshwater crayfish, Procambarus clarkia. J. Invertebr. Pathol. 115, 51–54. Du, X.J., Zhao, X.F., Wang, J.X., 2007. Molecular cloning and characterization of a lipopolysaccharide and beta-1,3-glucan binding protein from fleshy prawn (Fenneropenaeus chinensis). Mol. Immunol. 44, 1085–1094. Gai, Y.C., Zhao, J.M., Song, L.S., Li, C.H., Zheng, P.L., Qiu, L.M., Ni, D.J., 2008. A prophenoloxidase from the Chinese mitten crab Eriocheir sinensis: gene cloning, expression and activity analysis. Fish Shellfish Immunol. 24, 156–167. Gai, Y.C., Qiu, L.M., Wang, L.L., Song, L.S., Mu, C.K., Zhao, J.M., Zhang, Y., Li, L., 2009. A clip domain serine protease (cSP) from the Chinese mitten crab Eriocheir sinensis: cDNA characterization and mRNA expression. Fish Shellfish Immunol. 27, 670–677. Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., Ezekowitz, R.A.B., 1999. Phylogenetic perspectives in innate immunity. Science 284, 1313–1318. Iwanaga, S., Lee, B.L., 2005. Recent advances in the innate immunity of invertebrate animals. J. Biochem. Mol. Biol. 38, 128–150. Jiang, H., Kanost, M.R., 2000. The clip-domain family of serine proteinases in arthropods. Insect Biochem. Mol. Biol. 30, 95–105. Jiang, H., Wang, Y., Yu, X.Q., Kanost, M.R., 2003. Prophenoloxidase-activating proteinase-2 from hemolymph of Manduca sexta. A bacteria-inducible serine proteinase containing two clip domains. J. Biol. Chem. 278, 3552–3561. Jiang, H., Wang, Y., Gu, Y., Guo, X., Zou, Z., Scholz, F., Trenczek, T.E., Kanost, M.R., 2005. Molecular identification of a bevy of serine proteinases in Manduca sexta hemolymph. Insect Biochem. Mol. Biol. 35, 931–943. Jimenez, V.F., Vargas, A.F., Söderhäll, K., 2005. Characterisation of a serine proteinase from Penaeus vannamei haemocytes. Fish Shellfish Immunol. 18, 101–108. Lee, S.Y., Cho, M.Y., Hyun, J.H., Lee, K.M., Homma, K.I., Natori, S., 1998. Molecular cloning of cDNA for pro-phenol-oxidase-activating factor I, a serine protease is induced by lipopolysaccharide or 1,3-beta-glucan in coleopteran insect, Holotrichia diomphalia larvae. Eur. J. Biochem. 257, 615–621. Lee, S.Y., Wang, R., Söderhäll, K., 2000. A lipopolysaccharide- and beta-1,3-glucan-binding protein from hemocytes of the freshwater crayfish Pacifastacus leniusculus. Purification, characterization, and cDNA cloning. J. Biol. Chem. 275, 1337–1343. Lehnert, S.A., Johnson, S.E., 2002. Expression of hemocyanin and digestive enzyme messenger RNAs in the hepatopancreas of the Black Tiger Shrimp Penaeus monodon. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 133, 163–171. Ligoxygakis, P., Pelte, N., Hoffmann, J.A., Reichhart, J.M., 2002. Activation of Drosophila toll during fungal infection by a blood serine protease. Science 297, 114–116. Lin, C.Y., Hu, K.Y., Ho, S.H., Song, Y.L., 2006. Cloning and characterization of a shrimp clip domain serine protease homolog (c-SPH) as a cell adhesion molecule. Dev. Comp. Immunol. 30, 1132–1144. Lin, X., Söderhäll, K., Söderhäll, I., 2011. Invertebrate hematopoiesis: an astakine-dependent novel hematopoietic factor. J. Immunol. 186, 2073–2079. Liu, F., Li, F., Dong, B., Wang, X., Xiang, J., 2009. Molecular cloning and characterisation of a pattern recognition protein, lipopolysaccharide and beta-1,3-glucan binding protein (LGBP) from Chinese shrimp Fenneropenaeus chinensis. Mol. Biol. Rep. 36, 471–477. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−delta delta C(T)) method. Methods 25, 402–408. Meng, Q.G., Gu, W., Bi, K.R., Ji, H.Y., Wang, W., 2010. Spiralin-like protein SLP31 from Spiroplasma eriocheiris as a potential antigen for immunodiagnostics of tremor disease in Chinese mitten crab Eriocheir sinensis. Folia Microbiol. 55, 245–250. Muhliaalmazán, A., Garcíacarreño, F.L., Sánchezpaz, J.A., Yepizplascencia, G., Peregrinouriarte, A.B., 2003. Effects of dietary protein on the activity and mRNA level of trypsin in the midgut gland of the white shrimp Penaeus vannamei. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 135, 373–383. Nappi, A.J., Christensen, B.M., 2005. Melanogenesis and associated cytotoxic reactions: applications to insect innate immunity. Insect Biochem. Mol. Biol. 35, 443–459. Satoh, D., Horii, A., Ochiai, M., Ashida, M., 1999. Prophenoloxidase-activating enzyme of the silkworm, Bombyx mori. Purification, characterization, and cDNA cloning. J. Biol. Chem. 274, 7441–7453. Shi, X.Z., Ren, Q., Zhao, X.F., Wang, J.X., 2009. Expression of four trypsin-like serine proteases from the chinese shrimp, Fenneropenaeus chinensis, as regulated by pathogenic infection. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 153, 54–60. Söderhäll, K., Cerenius, L., 1998. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 10, 23–28. Srisala, J., Pukmee, R., McIntosh, R., Choosuk, S., Itsathitphaisarn, O., Flegel, T.W., Sritunyalucksana, K., Vanichviriyakit, R., 2018. Distinctive histopathology of Spiroplasma eriocheiris infection in the giant river prawn Macrobrachium rosenbergii. Aquaculture 493, 93–99. Sritunyalucksana, K., Söderhäll, K., 2000. The proPO and clotting system in crustaceans. Aquaculture 191, 53–69. Wang, W., Zhu, N.N., Gu, Z.F., Du, K.H., 2002. Study on the transmission of tremor disease (TD) in the Chinese mitten crab, Eriocheir sinensis (Crustacea: Decapoda). J. Invertebr. Pathol. 81, 202–204. Wang, W., Wen, B.H., Gasparich, G.E., Zhu, N.N., Rong, L.W., Chen, J.X., Xu, Z.K., 2004. A spiroplasma associated with tremor disease in the Chinese mitten crab (Eriocheir sinensis). Microbiology 150, 3035–3040. Xu, Y.B., Hao, W.J., Xiang, T., Zhou, H.F., Wanng, W., Meng, Q.G., Ding, Z.F., 2018. iTRAQbased quantitative proteomic analysis of Procambarus clakii hemocytes during Spiroplasma eriocheiris infection. Fish Shellfish Immunol. 77. Yuan, M.J., Ning, M.X., Wei, P.P., Hao, W.J., Jing, Y.T., Gu, W., Wang, W., Meng, Q.G., 2018. The function of serpin-2 from Eriocheir sinensis in Spiroplasma eriocheiris infection. Fish Shellfish Immunol 76, 21–26. Zhang, D., Wan, W., Kong, T., Zhang, M., Aweya, J.J., Gong, Y., Li, S.K., 2018. A clip domain serine protease regulates the expression of proPO and hemolymph clotting in mud crab, Scylla paramamosain. Fish Shellfish Immunol. 79, 52–64. Zhao, D., Chen, L., Qin, C., Zhang, H., Wu, P., Li, E., Chen, L., Qin, J., 2009. Molecular cloning and characterization of the lipopolysaccharide and beta-1, 3-glucan binding protein in Chinese mitten crab (Eriocheir sinensis). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 154, 17–24.

Acknowledgments We thank Professor O. Roger Anderson of Columbia University in the City of New York for editing the manuscript. The current work was supported by grants from the National Natural Sciences Foundation of China (NSFC Nos. 31570176; 31602198; 31870168), the Natural Science Foundation of Jiangsu Province (Grant No. BK20151545), Project for Aquaculture in Jiangsu Province (Grant Nos. Y2016-28; Y2017-34), the Modern Fisheries Industry Technology System Project of Jiangsu Province (Grant No. JFRS-01) and the project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). References Amparyup, P., Sutthangkul, J., Charoensapsri, W., Tassanakajon, A., 2012. Pattern recognition protein binds to lipopolysaccharide and beta-1,3-glucan and activates shrimp prophenoloxidase system. J. Biol. Chem. 287, 10060–10069. Amparyup, P., Charoensapsri, W., Tassanakajon, A., 2013. Prophenoloxidase system and its role in shrimp immune responses against major pathogens. Fish Shellfish Immunol. 34, 990–1001. Arunee, A., Pronprapa, W., Gordon, M.H., 1990. Purification and characterization of a prophenoloxidase activating enzyme from crayfish blood cells. Insect Biochem. Mol. Biol. 20, 709–718. Aspán, A., Huang, T.S., Cerenius, L., Söderhäll, K., 1995. cDNA cloning of prophenoloxidase from the freshwater crayfish Pacifastacus leniusculus and its activation. Proc. Natl. Acad. Sci. U. S. A. 92, 939–943. Buda, E.S., Shafer, T.H., 2005. Expression of a serine proteinase homolog prophenoloxidaseactivating factor from the blue crab, Callinectes sapidus. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 140, 521–531. Castillejo-López, C., Häcker, U., 2005. The serine protease Sp7 is expressed in blood cells and regulates the melanization reaction in Drosophila. Biochem. Biophys. Res. Commun. 338, 1075–1082. Cerenius, L., Söderhäll, K., 2004. The prophenoloxidase-activating system in invertebrates. Immunol. Rev. 77, 21–26. Cheng, W., Liu, C.H., Tsai, C.H., Chen, J.C., 2005. Molecular cloning and characterisation of a pattern recognition molecule, lipopolysaccharide- and beta-1,3-glucan binding protein (LGBP) from the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 18, 297–310. Chosa, N., Fukumitsu, T., Fujimoto, K., Ohnishi, E., 1997. Activation of prophenoloxidase A1, by an activating enzyme in Drosophila melanogaster. Insect Biochem. Mol. Biol. 27, 61–68. De, G.E., Spellman, P.T., Rubin, G.M., Lemaitre, B., 2001. Genome-wide analysis of the Drosophila immune response by using oligonucleotide microarrays. Proc. Natl. Acad. Sci. U. S. A. 98, 12590–12595. Ding, Z.F., Tang, J.Q., Xue, H., Li, J.J., Ren, Q., Gu, W., Meng, Q.G., Wang, W., 2014. Quantitative detection and proliferation dynamics of a novel Spiroplasma eriocheiris

526