Yeast pyruvate carboxylase: Gene isolation

Yeast pyruvate carboxylase: Gene isolation

Vol. 145, No. 1, 1987 BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS Pages 390-396 May 29, 1987 YEAST PYRUVATE C. Phillip Morris, Depart...

508KB Sizes 0 Downloads 76 Views

Vol. 145, No. 1, 1987

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS Pages 390-396

May 29, 1987

YEAST

PYRUVATE

C. Phillip

Morris,

Department

Received

March

31,

CARBOXYLASE Filip Lim,

: GENE

ISOLATION

and John C. Wallace

of Biochemistry, University of Adelaide, Adelaide, South Australia 5000.

1987

To improve our understanding of pyruvate carboxylase (PC)(EC 6.4.1.1) structure and the evolution of the biotin-dependent carboxylases we have isolated and sequenced a yeast (Saccharomyces cerevdsiae) genomic DNA fragment encoding PC. The identity of the cloned gene was confirmed by comparing the encoded protein with the sequence of a 26 amino acid biotin-containing peptide isolated from yeast PC. The yeast PC sequence is homologous (43% amino acid homology) to the rat PC sequence, although the carboxyl-terminus was found to be 44 residues from the biotinyl-lysine whereas in all biotin carboxylases sequenced to date the biotin is 35 residues from the carboxyl-terminus. Q 1987

Academic

Press,

Inc.

Pyruvate enzyme

found

vertebrate

carboxylase

in all higher

liver

from lactate tricarboxylic

in lipogenic

to have

been examined size from

in other

of the “family”

the enzyme

(2).

churomyces

cerevisiue)

sheep (6,7)

and rat (7) h ave shown

a tetrahedron-like

structure.

active

site of the enzyme

lysine

residue.

Each

origin

(1).

carboxylases

identical studies

(4), Rhizopua

urrhizua

subunit

one biotin

attached

390

through

mitochondria

which

species subunits

of PC from

in the native

contains

from

to the

tissues.

of four apparently

niduluna

role in relation

In all eukaryotic

microscopic

In

of gluconeogenesis

groups

that the subunits

and covalently

0006-291X/87 $1.50 Copyright 0 1987 by Academic Press, Inc. All rights of reproduction in any form reserved.

synthesizing

Electron

(3), Aspergillua

and some prokaryotes.

of acetyl

of biotin-dependent

is composed

to 125,000

fungi

biotin-dependent

in the regulation

in the transport

evolutionary

distributed

tissues it has an anaplerotic

and acetyl-choline

a common

115,000

than plants),

it acts as a key enzyme

whilst

PC is a member posed

(other

acid cycle, particularly

to the cytosol

is a widely

6.4.1.1)

eukaryotes

and kidney

and alanine,

(PC)(EC

the c-amino

which

have

ranging yeast

(5), chicken

enzyme

moiety

are pro-

(Sac(6,7),

are arranged

located group

within

in

in the

of a specific

BIOCHEMICAL

Vol. 145, No. 1, 1987 The properties studies

general

understanding

the limited turkey

peptide

PC described

44 amino

revealed

DNA

homology

site. We have found terminus,

which

enzymes.

However

to 44 residues

of sequence

that the biotin with

moiety

35 residues

carboxylases,

data for PC from

nucleic

to and

acid sequence

clone (11). a fragment

gene. The yeast PC sequence the biotin

to the protein

enzymes

is the first report additionally

limited

chicken

of a clone containing

arrangement

from the carboxyl-terminus

Structural

for PC is restricted

and rat PC around

in all of the biotin-containing

regulatory

(8,9).

site of sheep,

PC cDNA

carboxylase

is attached

the general

which

attachment

and sequencing

human

and potential

its structure

data,

a human

from the pyruvate

in yeast PC. This

of the yeast biotin

the biotin

acids) from

sheep, chicken,

is consistent

is attached

from

the identification derived

with

about

et al. (10) and the extremely

by Rylatt

Here we report of yeast genomic

than is knowledge

data

RESEARCH COMMUNICATIONS

mechanism

by the lack of sequence

sequence

data (151 bp encoding

group

of the catalytic

of PC is more advanced have been hampered

AND BIOPHYSICAL

close to its carboxyl-

seen in other examined whereas

of any sequence

it is the first report

attachment

biotin-containing

so far the prosthetic

this distance

is increased

data for yeast PC or any of a significant

amount

any species.

Materials and Methods The yeast genomic library was provided by M. Carlson and D. Botstein (12) and was prepared by subcloning a partial Sau 3A digest of yeast DNA into the yeast/E. coli plasmid vector YEp24. It was screened using a [32P]-labelled biotin carboxylase specific oligonucleotide probe (described below) by the high density colony screening procedure of Hanahan (13). Restriction endonucleases, T&polynucleotide kinase and various other enzymes were purchased from New England Biolabs. [cy-32P]dATP, [a-32P]dCTP and dideoxynucleotide sequencing kits were purchased from BRESA Pty. Ltd.

Positive colonies were purified by a further round of screening and plasmid DNA was prepared by the method of Birnboim and Doly (14). 01 i g onucleotide positive Eco RI restriction fragments were identified, Southern blotted (15) and subcloned into EcoRI cleaved pUC19 (16). I nsert DNAs were sequenced by cleavage with the appropriate restriction endonucleases and subcloning of the isolated fragments into M13mp18 and mp19 (16) and sequenced by the dideoxynucleotide chain termination method described by Sanger (17). Yeast pyruvate carboxylase was purified as described previously (3) and digested to completion with trypsin. The biotin-containing tryptic peptide was purified by avidinSepharose chromatography followed by reversed phase HPLC and sequenced using an Applied Biosystems gas phase sequencer (18). 391

Vol. 145, No. 1, 1987

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

Results and Discussion The highly

conserved

lases and PC in particular cleotide

probe

NHz

mRNA

5’

Probe

3’

* Biotin

attached

genomic from

fragments

In order carboxylases cloned

about

the right

species

detected

GCN

AUG

AAR

AUG

GAR

ACN

3’

TAC

TTY

TAC

CTY

TG

5’

linkage

to e-NH2

R = purine,

Y = pyrimidine.

carboxylase

specific

revealed

further

that

unique

in rat liver

chain

termination

and non-coding (about extended

sequence into

method. sequence

3 kb) awaits

and eliminate

(pYPC

(Figure

M13mp19

The sequence

PC cDNA

to very near the end of the original

with

clone (11).

derived

the biotin were sub-

using

YEp24

The

majority the strategy

the appropriate

the dideoxynucleotide

contained The remaining

clone insert.

analysis species of

about

half coding

coding

yeast PC clone since the sequence

392

in size

the 4.2 kb mRNA

following

by subcloning

by sequencing nucleotides)

than

to a single mRNA

and sequenced

2) was determined

of a longer

inserts

were used in Northern

and comparable

(531 and 653 bp respectively).

the isolation

of

mapping

Eco RI fragments

5) hybridized

(1184

Restriction

all genes other

obtained

mapped

followed

ranging

of the clones contained

by a human

1.

inserts

a library

not shown).

subclones

shown

The nucleotide

three

PC (d a t a not shown) extracts

clones with

clones, probe-positive

One subclone

size to encode

was used to screen

5~10~ recombinants.

(data

analysis

positive

The three

(14-mer)

by screening

of the yeast genome

mRNA.

fragments

probe

COOH

of lysine.

YEp 24. Five positive

of pYPC 5 was restriction

restriction

group

oligonu-

below;

Thr

the 1.3 kb insert in Figure

as shown

Glu

from these 14-mer

of yeast poly( A)+

of four lPmers,

carboxy-

an unambiguous

Met

to simplify

into pUC19.

to generate

site of biotin

Lys*

Southerns

the same region

attachment

Met

in the vector

probed

the biotin

Ala

1.4 kb to 11 kb were obtained

and 14-mer from

biotin

around

an opportunity

of a mixture

in amide

N = any nucleotide,

This

provides

composed

Protein

sequence

sequence obtained

of

Vol. 145, No. 1, 1987 h

A

BIOCHEMICAL s

A

s

AND BIOPHYSICAL

SH h

RESEARCH COMMUNICATIONS

A

.

HR

s

R

AS

ASh

. .

. I

I

I

I

I

0

0.2

0.4

0.6

0.6

Nucleotides

I

I

1 .o

1.2

(Kb)

Partial restriction map of pYPC 5 containing part of the yeast pyruvate carboxylase gene. The extent of sequencing is indicated by the length of each arrow, and the direction of the arrow indicates the strand that was sequenced. The solid line indicates the extent of the coding region. Only restriction endonuclease cleavage sites used in the sequence analysis are indicated : Alu I (A), Hae III (H), Hha I (h), Rsa I (R) and Sau 3A (S). Figure

The the predicted attachment

1.

encoded

peptide

when

site found

in all carboxylases identified

the sequence

around

acid, biotin-containing The sequence

process codon

TGA

residue

little

an additional

in yeast

propionyl-Cob

(20,23)

constraint

and placed

has been satisfied

cross-reaction

including

sequences because

of the protein

between

with

a 26 amino

involved

(22).

The

in the

termination

44 amino

acids from

the lysine

of the biotin-containing

peptide

as the site

human

from

other

biotin

in all the biotin

(19),

enzymes

Cassady,

E. coli and chicken

transcarboxylase

(21).

of the biotin

in the other

This

stearothermophilus

which

personal

liver

acetyl-

suggests

that

biotin-containing

way in yeast PC. It may be significant

the yeast and Bacillus

enzymes

since the biocytin

and rat PC (11, A.I.

carboxylase

393

obtained

but the correct

the sequences

yeast PC differs

on the position

clone

2).

(AATAAA)

defined

biotin

The

match

acids at its carboxyl-terminus

P. shermanii

in a different

conserved

yeast PC (Figure

are poorly

acid sequencing

9 amino

to the highly

by the identical

acids from the carboxyl-terminus

human

carboxylase

enzymes

amino

been sequenced

communication),

the structural

obvious

a carboxyl-terminus

35 amino

have currently

CoA

is not

since it contained

site was a compared

from purified

in yeast PC. In this respect

in that it contains is positioned

carboxylase

two polyadenylation

termination

during

of biotinylation

carboxylase

to date (10, 11,19,20,21).

attachment

isolated

termination

defines

identified

the biotin

contained

of transcription

examined

as pyruvate

peptide

site of transcription

as a biotin

Ala Met Lys Met, corresponding

sequence

was unambiguously

was identified

enzymes

that there is responsible

BIOCHEMICAL

Vol. 145, No. 1, 1987

AND 6lOPHYSlCAL

Tyr Pro Arg Val Tyr Glu Asp Phe Gin Lys Met Arg Glu TACCCAAGAGTTTATGAAGACTTCCAAAAGATGAGAGAAACGTATGGTGATTTATCTGTA

Thr

Leu Pro Thr Arg Ser Phe Leu Ser Pro Leu Glu Thr Asp TTGCCAACAAGAAGCTTTTTGTCTCCACTAGAGACTGACGAAGAAATTGAAGTTGTAATC

Glu

Ile Lys Leu Gin Ala Val Glu Gln Gly Lys Thr Leu Ile GAACAAGGTAAAACGCTAATTATCAAGCTACAGGCTGTGGGTGATTTGAACAAAAAGACC

Gly

Gly Glu Arg Glu Val Tyr Phe Asp Leu Am Gly Glu Met GGTGAAAGAGAAGTTTACTTTGATTTGAATGGTGAAATGAGAAAAATTCGTGTTGCTGAC

Arg

Arg Ser Gln Lys Val GIu Thr Val Thr Lys Ser Lys Ala AGATCACAAAAAGTGGAAACTGTTACTAAATCCAAAGCAGACATGCATGATCCATTACAC

Asp

Val Glu Val Lys Ile Gly Ala Pro Met Ala Gly Val Ile ATTGGTGCACCAATGGCAGGTGTCATTGTTGAAGTTAAAGTTCATAAAGGATCACTAATA

Val

Lys Lys Gly Gln Pro Val Ala Vd Leu Ser Ala Met Lys AAGAAGGGCCAACCTGTAGCCGTATTAAGCGCCATGAAAATGGAAA~GATTATATCTTCT

Met

Pro Ser Asp Gly Gln Val Lys Glu Val Phe Val Ser Asp CCATCCGATGGACAAGTTAAAGAAGTGTTTGTCTCTGATGGTGAAAATGTGGACTCTTCT

Gly

Asp Leu Leu Val Leu Leu Glu Asp Gln Val Pro Val Glu GATTTATTAGTTCTATTAGAAGACCAAGTTCCTGTTGAAACTAAGGCATGAACCGGTTAG

Thr

RESEARCH COMMUNICATtONS

Tyr

Gly

Asp

Leu

Ser

Val 60

Glu

Ile

Glu

Val

Val

Ile 120

Asp

Leu

Am

Lys

Lys

Thr 180

Lys

Ile

Arg

Val

Ala

Asp 240

Met

His

Asp

Pro

Leu

His 300

His

Lys

Gly

Ser

Leu

Ile 360

Glu

Met

Ile

Ile

Se1

Ser 420

Glu

Am

Val

Asp

Ser

Ser 480

Lys

Ala

Stop 540

TTCTCATTTATAATGTATAATATACCCGAATCTTATTTATTTACCTTTCCTATTTTTTGA

600

CGACCAGTAAATACTAATACATAATTAGGAACAAAAGTTA~~~AAAAAAAAATAAT

660

TTAACGCATCCAATTAACGTGTCCTTTTTTCATCATTAATTTATCTACTATTTCGATTTA

720

AATTCCATATACCCTAGATACATTCCCGAAAGTCATCTTTTAGCGAAACATCT

780

TCCTTGAGCTGCTAGCAGTGGGCTTAGTCCACCTGTTAGTTACTCTTGGTATACCACTAG

840

GTCTTTTCGAGGCAGGAACATGGGTCTTTCTTACTCTTCCGTTATTTGAAATTCCTGCCG

900

AAGAAACGGGCCTTCTACCAGATTGCACACCGTACCTTGGATTTAAGCCTTGATTTGGTG

960

GCTTTGCTGGTGCAGCATCCTTTTCACCCTTCCTATTTTCTAATTTTTGTCTCAAATCCA1020 AGATCTCCTTCTTTTTCAACGCTATCACGTTGTGTAAAGTACTCCCATCTTCATCATTTGlOSO TGTTTACATTTTCATTGTGCAGTCTATCATTAATTAGCTTTAAATAGGTTTGATCGCTCA1140 TCAATTTATCAATATAACCAGCTTGAGAATGAATGATGATCCAT

1184

Figure 2. Nucleotide sequence of a yeast genomic DNA fragment containing part of the pyruvate carboxylaee gene and the deduced amino acid sequence. The extent of the match with the 26 amino acid peptide used to identify the gene is indicated by boxing, the lysine to which biotin is attached is indicated by a star (*), putative polyadenylation sequences are boxed and the sequence matching the 14-mer oligonucleotide probe is underlined - the last base did not match the probe.

for the attachment biotinyl specificity

of biotin

holoenzyme

to pyruvate

synthetases

apocarboxylase

have shown

a general

(24), whereas lack of species

other

studies

with

or apocarboxylase

(25). It is difficult

this is the first

report

to make comparisons of a significant

of this data with

amount 394

other

of PC sequence

PC sequences

from

any species.

because There

BIOCHEMICAL

Vol. 145, No. 1, 1987 (-Pro]

Yeast

ArgjVall

Tyr Glu AspmGln

AND BIOPHYSICAL

Lys Met Arg Glu~Thryr~AspjLeul

RESEARCH COMMUNICATIONS

Ser Val~Prophr~~Ser~[

Ser Pro Leu

TACCCAAGAGTTTATGAAGACTTCCAAAAGATGAGAGAAACCTATGGTGATTTATCTGTATTGCCAACAAGAAGCTTTTTGTCTCCACT

Rat Yeast

Gh Thr Asp-j

Iie -Val]

Val

Iie mGh$iy

LYS Thr Leu] Iie I&

Leu Glnm

Gly[Asr,jAsn]Lys

LyS

Thr

GAGACTGACGAAGAAATTGAAGTTGTAATCGAACAAGGTAAAACGCTAATTATCAAGCTACAGGCTGTCCGTGATTTGAACAAAAAGA . . .. . . . . . . .. . .. . . .. . . .. .. . .. . . . . . . . .. . ..

Rat Yeast

Gly Glu&!Glu

~Tyr~Aspl~jGIu

MetmLys

Ser [-[Asp

Met His Asp Pro Leu His IIle

@

Argm

AlamArg

Ser Gin Lys Vd aThr

Val Thr Lys

GGTGAAACAGAAGTTTACTTTGATTTGAATGGTGAAATGAGAAAAATTCGTGTTGCTGACAGATCACAAAAAGTGGAAACTGTTACTAA

Rat Yeast Rat

Prol~Leu

Yeast Rat

Lys Asp Vd

Rat

Ile Val GlulmLysIIis

Lys Gly Gln

Ile Gly Ala Pro Met Pro(GlylLys

Lys ]Lys Gly Gln Pro1 Val Ala [%I Leu Ser Ala Met Lys Met GIulMet

(vail

Gly Gln ProlLeu

Ser Leu

Ile

Ile

Val

Ile Asp

Ile Serm

al Lys Val Ala Alaa Ser AspmGln

Ala Lys Val

Val Lys Glu !$iJPhe

Cys Val Leu Ser Ala Met Lys Met Glu]Thr

Ser Asp Gly Glu Am Val Asp Ser Ser]AspjLeu

Val Val Thr Ser Pro Met Glu Gl

Val Leu LaDAsp

Thr Ile Arg Lys Val His

Gln Val Pro Val Glu Thr Lys Ala

GTCTCTGATGGTGAAAATGTGGACTCTTCTCATTTATTAGTTCTATTAGAAGACCAAGTTCCTGTTGAAACTAACGCATGAACCGGTTAG ~fGA~CA~G~ACATG~CfC~~~~AGGCCA~~~CC~CA;~GTGATCTTACT~CAGACTGG~AGCCTGGCC~~~~CTACCC

mThr

Lys Asp Met Thr Leu Glu Gly AspI-

Ile Leu Glu

Ile m

Figure 3. Comparison of the nucleotide and deduced amino rounding the biotin-binding site of yeast and rat pyruvate carboxylases. nucleotide sequences is indicated by the symbol “s” spanning identical the sequences where the amino acid residues match have been boxed.

is however cDNA

a larger

clones

(AI.

amount

of as yet unpublished

Cassady

and R.A.

the yeast PC gene with

of which present

corresponds

The

of biotin

sequences

level yet the high

degree

acid substitutions

been acting

others during

personal

regions

about

attachment

structurally

process

importance with

important 395

of

communication, conservation,

one that

is

site by the biotinyl

the correct

conservation indicates

personal

of sequence

low level of homology

acid sequence

of functional

transfer

PC

Comparison

Some of the conservation

of the biotin

of the full yeast PC sequence

to yield more information

Cassady,

may serve to provide

show a relatively of amino

data from rat and human

blocks

attachment.

the carboxyl

acid sequences surHomology of the bases. Positions in

communications).

(A.I.

several

are taken into account)

to preserve

Comparison

revealed

to the recognition while

sequence

sequence

to the site of biotin

synthetase

for the movement enzyme.

elsewhere)

may be related

holoenzyme

Gravel,

the rat PC cDNA

full data to be published

amino

Lysm

AAGAAGGGCCAACCTGTAGCCGTATTAAGCGCCATGAAAATGGAAATGATTATATCTTCTCCATCCGATGGACAAGTTAAAGAAGTG . .. . .. .. .. . . .. . .. .. .. .. . .. .. . GTTAAGGGCCAGCCCCTCTGTGCTCAGCGCCATGAAGATGGAGACTG'iCGfGA;;;;G;; ATG&G"&CTAkCC;[email protected] +, VallLys

Yeast

Gly Ala Pro MetlAlamVal

TCCAAAGCAGACATGCATGATCCATTACACATTGGTGCACCAATGGCAGCTGTCATTGTTGAAGTTAAAGTTCATAAAGGATCACT~4 . .. . . . . . . .. . . .. . .. . . . . . .. . .. CCCAAGGCCTTGAAGGATGTGAAGGGCCAA TTCGGGCCCCTATGCCTGGGAAGG~CA~A~~C~~C~~G~~GGCAGC~~~~G~CAAGG~G

cleft

environment

at the active (48%)

site of the

at the nucleic

(43%,

acid

57% if conservative

that strong

selective

forces have

in these enzymes. that of a higher regions

than

eukaryote

comparisons

is likely between

Vol. 145, No. 1, 1987

BIOCHEMICAL

AND BIOPHYSICAL

RESEARCH COMMUNICATIONS

higher eukaryote sequencessuch as those from human and rat becausethe strong degreeof sequenceconservation shown between these PC sequencesreflects their modest evolutionary separation. In support of this idea, a human PC cDNA clone (R.A. Gravel, personal communication) showed only four conservative substitutions when it was compared with the same rat PC data shown in Figure 3. Acknowledgments This work was supported by the Australian Research Grants Schemegrant D283 / 15800. The authors would like to acknowledge the assistanceof A.I. Cassady, R.A. Gravel and G. Pure for helpful discussions. We wish to thank Ms. Yvonne Riese for her valuable technical assistance. References 1. Obermayer, M. and Lynen, F. (1976) Trends Biochem. Sci. 1, 169-171. 2. Wallace, J.C. and Easterbrook-Smith, S.B. (1985) Pyruvate Carboxylase, pp. 65108, Keech D.B. and Wallace, J.C. eds., CRC Press, Boca Raton, Florida. 3. Rohde, M., Lim, F. and Wallace, J.C. (1986) Eur. J. Biochem. 156, 15-22. 4. Osmani, S.A., Mayer, F., Marston, A.O., Selmes, I.P. and Scrutton, M.C. (1984) Eur. J. Biochem. 139, 509-518. 5. Mayer, F., Osmani, S.A. and Scrutton, M.C. (1985) FEBS Letts. 192, 215-219. 6. Goss, N.H., Dyer, P.Y., Keech, D.B. and Wallace, J.C. (1979) J. Biol. Chem. 254, 1734-1739. 7. Mayer, F., Wallace, J.C. and Keech, D.B. (1980) Eur. J. Biochem. 112, 265-272. 8. Attwood, P.V. and Keech, D.B. (1984) Curr. Topics Cellular Regulation 23, l-55. 9. Barritt, G.J. (1985) (1985) Pyruvate Carboxylase, pp. 141-178, Keech D.B. and Wallace, J.C. eds., CRC Press, Boca Raton, Florida. 10. Rylatt, D.B., Keech, D.B. and Wallace, J.C. (1977) Arch. Biochem. Biophys. 183, 113-122. 11. Freytag, S.O. and Collier, K.J. (1984) J. Biol. Chem. 259, 12831-12837. 12. Carlson, M. and Botstein, D. (1983) Cell 28, 145-154. 13. Hanahan, D. and Meselson, M. (1980) Gene 10, 63-67. 14. Birnboim, H.C. and Doly, J. (1979) Nucl. Acids. Res. 7, 1531-1523. 15. Southern, E.M. (1975) J. Mol. Biol. 98, 503-517. 16. Yaaisch-Perron, C., Vieira, J. and Messing, J. (1985) Gene 33, 103-119. 17. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467. 18. Hunkapiller, M.W., Hewick, R.M., Dreyer, W.J. and Hood, L.E. (1985) Meths. Enzymol. 91, 399-412. 19. Lamhonwah, A., Barankiewicz, T.J., Willard, H.F., Mahuran, D. J., Quan, F. and Gravel, R.A. (1986) Prot. Natl. Acad. Sci. U.S.A. 83, 4864-4868. 20. Sutton, M.R., Fall, R.R., Nervi, A.M., Alberts, A.W., Vagelos, P.R. and Bradshaw, R.A. (1977) J. Biol. Chem. 252, 3934-3940. 21. Maloy, W.L., Bowien, B.U., Zwolinski, G.K., Kumar, K.G., Wood, H.G., Ericsson,L.H. and Walsh, K.A. (1979) J. Biol. Chem. 254, 11615-11622. 22. Birnstiel, M.L., Busslinger, M. and Strub, K. (1985) Cell 41, 349-359. 23. Takai, T., Wada, K. and Tanabe, T. (1987) FEBS Letts. 212, 98-102. 24. Sundaram, T.K., Cazzulo, J.J. and Kornberg, H.L. (1971) Arch. Biochem. Biophys. 143, 609-616. 25. Wood, H.G. and Barden, R.E. (1977) Ann. Rev. Biochem. 46, 385-413. 396